Introduction
Equine nuchal bursitis is a condition characterized by pain and swelling over the poll, decreased neck flexion, and abnormal head carriage. Nuchal bursitis can develop in the cranial or caudal nuchal bursa in close association with the nuchal ligament.1 Nuchal bursitis has been associated with both nonseptic inflammation and septic infection secondary to a variety of bacteria, including Brucella abortus, Staphylococcus spp, Streptococcus equi subsp zooepidemicus, Escherichia coli, Bacillus spp, Enterococcus spp, and the spirochete Borrelia burgdorferi.1–3
Several B burgdorferi–associated conditions have been described in the horse, including neuroborreliosis, uveitis, and cutaneous pseudolymphoma.4 Borrelia burgdorferi has been detected by PCR within nuchal bursa fluid in 3 equine nuchal bursitis cases, 1 of which also had elevated outer surface protein A (OspA) antibodies in serum identified by use of the equine Lyme multiplex assay.1,5 Serum OspA elevation in horses has previously been associated with prior vaccination with commercially available canine vaccines or early infection,6 making the presence of elevated serum OspA in a case of chronic nuchal bursitis a novel finding, warranting further investigation.5
The primary objective of this retrospective study was to assess the association between elevated serum OspA antibodies in cases of equine nuchal bursitis and the molecular detection of B burgdorferi in nuchal bursa synovial fluid or tissue. Additional objectives included describing clinical cases of B burgdorferi PCR–positive equine nuchal bursitis and comparing the histologic changes between nuchal bursitis cases with and without B burgdorferi PCR detection.
Methods
Case inclusion criteria
A retrospective multicenter cohort study was performed by use of a keyword-based search of the medical record databases of the Cornell University Equine and Nemo Farm Animal Hospital (Ithaca, New York), Cornell University Animal Health Diagnostic Center (AHDC; Ithaca, New York), Tufts University Cummings School of Veterinary Medicine (North Grafton, Massachusetts), and University of Pennsylvania School of Veterinary Medicine’s New Bolton Center (Kennett Square, Pennsylvania) between 2013 and 2023. Keywords equine and nuchal bursitis were used for all searches except for those of the AHDC database, which used the keyword Lyme PCR for equine cases with B burgdorferi PCR requests on nuchal bursa specimens and a history of nuchal bursitis noted on their submission form. For all institutions, horses were included if they were given a diagnosis of nuchal bursitis, had B burgdorferi detection by PCR on nuchal bursa synovial fluid or tissue, and had no prior history of B burgdorferi vaccination in the medical record or through communication with the submitting veterinarian. Additionally, to find all specimens submitted for B burgdorferi PCR, data were acquired from AHDC laboratory management software from 2007 to 2023 by use of the keywords equine and Lyme PCR.
The following data for each of the 19 antemortem cases were obtained from the medical records or via a questionnaire completed by the treating veterinarian: signalment, geographic location, primary equestrian discipline, medical history, B burgdorferi vaccination status, duration of clinical signs associated with nuchal bursitis prior to presentation and presenting clinical signs, diagnostics applied to achieve a diagnosis of nuchal bursitis, nuchal bursitis treatment, and clinical outcome. Diagnostic data collected included the following: the results of clinical pathology testing (including CBC, serum amyloid A [SAA], heat precipitate fibrinogen, and serum chemistry profile), serology (including B abortus card test and equine Lyme multiplex assay), imaging (including ultrasound, radiographs, and CT), nuchal bursa synovial fluid cytology analysis, nuchal bursa synovial fluid or tissue aerobic and anaerobic culture, nuchal bursa synovial fluid or tissue B burgdorferi PCR targeting flagellin,7 and histopathology.
Control case inclusion criteria
Control group horses were sourced collaboratively from Cornell University orthopedic research postmortem cases. Control horses were required to have an available serum sample, no history of neurologic disease or natural joint disease, no history of vaccination for B burgdorferi, and no clinical evidence of nuchal bursitis (no heat, pain, or swelling upon palpation of the nuchal bursa with normal head range of motion).
Molecular analysis
A real-time PCR assay for the detection of Borrelia spp flagellin gene in either nuchal bursa synovial fluid or fresh or formalin-fixed, paraffin-embedded (FFPE) nuchal bursa synovium was performed on all nuchal bursitis cases. Borrelia burgdorferi was detected by use of forward primer sequence TCTTTTCTCTGGTGAGGGAGCT, reverse primer sequence TCCTTCCTGTTGAACACCCTCT, and probe sequence FAM-AAACTGCTCAGGCTGCACCGGTTC-BHQ1, as described previously.7
Histopathology investigation
Nuchal bursa histologic findings were compared between horses with and without B burgdorferi PCR–positive nuchal bursitis. Cases for nuchal bursa histopathology investigation were identified by use of the previously described case inclusion criteria and through a search of medical record databases at the AHDC and Pennsylvania Animal Diagnostic Laboratory System (PADLS). This search identified former AHDC and PADLS equine nuchal bursitis cases with stored FFPE blocks through diagnosis search terms equine and nuchal. Once identified, B burgdorferi PCR7 was performed on FFPE scrolls from the identified blocks. Histologic findings in nuchal bursa tissue submitted to PADLS were reviewed, nonanonymized, by a veterinary pathologist (JE) to compare histologic changes in nuchal bursitis cases with and without B burgdorferi PCR detection. In select cases, B burgdorferi immunohistochemical stain was applied. Immunohistochemistry was performed by use of the BOND-MAX Fully Automated IHC and ISH Staining System (Leica Biosystems Nussloch GmbH). Unstained slides were prepared and deparaffinized with BOND Dewax Solution (Leica Biosystems Nussloch GmbH). The antibody, rabbit anti–Borrelia burgdorferi (No. B65302R; Biodesign), was diluted to 1:500 with BOND Primary Antibody Diluent (Leica Biosystems Nussloch GmbH) and applied to the slides for 30 minutes. Slides were then stained with the BOND Polymer Refine Red Detection kit (Leica Biosystems Nussloch GmbH) for 40 minutes, including hematoxylin.
Serologic analysis
The Lyme multiplex ELISA assay was performed at the AHDC, as previously described.8 Additional B burgdorferi antigens were cloned from B burgdorferi B31 (genome assembly ASM868v2) and expressed and purified from E coli, as previously described.9 The factor H–binding protein B served as a negative control for nonspecific binding.10 To measure the response to these antigens, ELISA was performed, as previously described, with relative antibody binding measured by absorbance at 405 nm (A405).11
Statistical analysis
An unpaired t test was performed with Prism (version 10.0.0 for Windows; GraphPad Software Inc) to compare serum equine Lyme multiplex assay results between the case and control groups. A 1-sample t test was performed to compare the mean values for each ELISA antigen to a hypothetical mean at the reference point.
Results
Retrospective analysis of equine specimens submitted for B burgdorferi PCR to the AHDC between 2007 and 2023 found that, of the 500 equine specimens submitted, B burgdorferi was detected in 35 specimens (7%). Eighty-six percent (30 of 35) of the B burgdorferi PCR–positive equine specimens were from the nuchal bursa, with the remaining originating from skin (2 of 35 [6%]), cerebrospinal fluid (2 of 35 [6%]), and brain (1 of 35 [3%]), with 1 suspect result on aqueous humor. Additionally, although 33% (163 of 500) of all B burgdorferi PCR requests originated from equine joints or bursae, B burgdorferi was detected only within the nuchal bursae and not found in specimens originating from appendicular synovial structures (Figure 1).
Borrelia burgdorferi PCR results from equine synovial samples (n = 163) submitted to the Cornell Animal Health Diagnostic Center over a 16-year period (2007 to 2023), including appendicular joint fluid and synovium, not otherwise specified (NOS) joint fluid and synovium, nuchal bursa fluid, and nuchal bursa tissue.
Citation: Journal of the American Veterinary Medical Association 262, 11; 10.2460/javma.24.05.0312
Nineteen horses were identified with B burgdorferi PCR–positive results that met the inclusion criteria for nuchal bursitis clinical cases (Table 1), including 13 geldings, 5 mares, and 1 stallion. Median age was 15 years (range, 6 to 25 years). Breeds included warmblood (7 of 19 [37%]), Andalusian/Lusitano (3 of 19 [16%]), Thoroughbred (2 of 19 [11%]), Quarter Horse (2 of 19 [11%]), Arabian (2 of 19 [11%]), draft breeds (2 of 19 [11%]), and Friesian (1 of 19 [5%]). The disciplines of clinical cases included performance (10 of 19 [53%]), pleasure (6 of 19 [32%]), and retired (2 of 19 [11%]), with 1 horse’s discipline being unknown (1 of 19 [5%]). Fifteen control animals were identified, including 8 geldings and 7 mares with a median age of 6 years (range, 4 to 29 years). The control horses’ breed distribution included mixed-breed horses (7 of 15 [47%]), warmblood (2 of 15 [13%]), Thoroughbred (2 of 15 [13%]), pony breed (2 of 15 [13%]), Standardbred (1 of 15 [7%]), and draft (1 of 15 [7%]). Cases originated from private practices or university teaching hospitals in the northeastern US, including New York, New Jersey, Pennsylvania, and Massachusetts.
Distribution of diagnostic results for equine nuchal bursitis cases where Borrelia burgdorferi PCR and histopathology were performed.
| B burgdorferi detected (n) | B burgdorferi not detected (n) | Cases with nuchal bursa histopathology (n) | |
|---|---|---|---|
| Nuchal bursitis cases with antemortem B burgdorferi PCR performed on nuchal bursa fluid or synovium | 19 | 0 | 4 |
| Nuchal bursitis cases with B burgdorferi PCR performed only on nuchal bursa FFPE scrolls after death | 5 | 6 | 11 |
| Control group | 0 | 15 | 0 |
| Total | 24 | 21 | 15 |
FFPE = Formalin-fixed paraffin-embedded.
Clinical findings
Presenting complaints and initial physical examination findings in horses with nuchal bursitis included swelling at the level of the poll (17 of 19 [89%]), pain on palpation of the poll area (12 of 19 [63%]), reluctance to move the head (7 of 19 [37%]), draining tract near the poll (4 of 19 [21%]), low head carriage (3 of 19 [16%]), and head tilt (2 of 19 [11%]). All horses had normal vital parameters at presentation.
Antemortem diagnostic findings
Eleven nuchal bursitis horses had CBCs performed, 2 of which were abnormal, with one being characterized by leukocytosis (13.7 X 103 cells/µL; reference range, 5.2 X 103 to 10.1 X 103 cells/µL) and the other by leukopenia (4.24 X 103/µL; reference range, 5.90 X 103 to 11.20 X 103/µL) secondary to neutropenia (2.16 X 103/µL; reference range, 2.30 X 103 to 9.10 X 103/µL) and lymphopenia (1.56 X 103/µL; reference range, 1.60 X 103 to 5.20 X 103/µL). Five horses had hyperfibrinogenemia (median, 500 mg/dL; range, 300 to 800 mg/dL; reference range, 0 to 200 mg/dL). Of the 6 horses in which an SAA was performed, only 1 horse’s SAA was elevated (446 µg/mL; reference range, 0 to 24 µg/mL). Eight horses had chemistry panels performed, 2 of which were hyperglobulinemic (5.3 and 5.6 g/dL; reference range, 2.3 to 3.8 g/dL). Radiographs of the poll region revealed mineralization in the region of the nuchal bursa (Table 2; Figure 2). Common nuchal bursa ultrasound abnormalities included fluid distention, mineralization, and thickened synovium. One horse had a nuclear scintigraphy (bone scan) performed that revealed increased radiopharmaceutical uptake at the dorsal aspect of C1 with no definitive evidence of bursal involvement. Bursal fluid cytology revealed marked neutrophilic inflammation without identifiable infectious agents. While Borrelia spp culture was not requested, aerobic bacterial culture growth occurred in 4 nuchal bursa synovial fluid samples. Three of these cases presenting with draining tracts had Trueperella pyogenes, Streptococcus equi subsp zooepidemicus, and Burkholderia cepacia complex isolated from aerobic cultures. Although the fourth case did not present with a draining tract, an ulcerated area over the poll was noted on presentation and Enterococcus faecalis and Staphylococcus xylosus were isolated on aerobic culture of the fluid obtained from the bursa.
Diagnostic results for equine nuchal bursitis cases with antemortem B burgdorferi molecular detection within the nuchal bursa.
| Test performed | Count | Results (n) |
|---|---|---|
| Imaging | ||
| Ultrasound | 100% (19/19) | Fluid distension (16) |
| Mineralization (9) | ||
| Thickened synovium (12) | ||
| Radiograph | 79% (15/19) | Mineralization of nuchal bursa (15) |
| CT | 11% (2/19) | Heterogenous mass with fluid cavities (1) |
| Mineralization (2) | ||
| Nuclear scintigraphy (bone scan) | 5% (1/19) | Repeatable increased radiopharmaceutical uptake at dorsal aspect of C1 with no definitive evidence of bursal involvement |
| Bursal diagnostics | ||
| Bursal fluid or synovium B burgdorferi PCR | 100% (19/19) | Positive (19) |
| Bursal fluid culture | 68% (13/19) | No growth (9) |
| Growth (4) | ||
| Bursal fluid cytology | 37% (7/19) | Marked neutrophilic inflammation (7) |
| No infectious organisms observed (7) | ||
| Bursal tissue histopathology | 21% (4/19) | Necrosis, mineralization, and fibrin (4) |
| No infectious agents (4) | ||
| Serology | ||
| Lyme multiplex ELISA (Figure 3) | 68% (13/19) | OspA positive, > 2,000 MFI (12); median, 8,027 MFI; range, 2,074–27,506 MFI |
| OspA equivocal (1); OspA 1,962 MFI | ||
| OspC positive, > 2,000 MFI (6); median, 600 MFI; range, 94–24,237 MFI | ||
| OspF positive, > 1,250 MFI (3); median, 623 MFI; range, 286–5,956 MFI | ||
| Brucella card agglutination | 32% (6/19) | Negative (6) |
MFI = Median fluorescence intensity. OspA = Outer surface protein A. OspC = Outer surface protein C. OspF = Outer surface protein F.
A—Lateral radiograph of the atlanto-occipital area of a horse with B burgdorferi PCR–positive nuchal bursitis showing mineralization in the region of the nuchal bursa (arrows). B—Ultrasonographic image of the cranial nuchal bursa at the level of the first cervical vertebra showing marked distension with anechoic fluid and synovial proliferation (arrows) in a horse with B burgdorferi PCR–positive nuchal bursitis.
Citation: Journal of the American Veterinary Medical Association 262, 11; 10.2460/javma.24.05.0312
Serum was available in only a subset of antemortem cases (13 of 19). Lyme multiplex assay was performed to obtain quantitative antibody values for OspA, outer surface protein C (OspC), and outer surface protein F (OspF). Outer surface protein A antibody values in these B burgdorferi–positive nuchal bursitis cases were significantly increased (t[26] = 4.750; P < .001) in comparison to controls (n = 15; Figure 3). Twelve of these 13 horses had positive OspA antibody values, defined as a result > 2,000 median fluorescence intensity (MFI), with 1 having an equivocal OspA antibody value (range, 1,962 to 27,506 MFI; median, 8,027 MFI). Only 6 of these 13 horses had antibodies positive for OspC (> 2,000 MFI; range, 94 to 24,237 MFI; median, 600 MFI), and only 3 of these 13 horses had antibodies positive for OspF (> 1,250 MFI; range, 286 to 5,956 MFI; median, 623 MFI). Of the 13 serum samples, 8 had sufficient volume for further ELISA evaluation. Outer surface protein A was the dominant antigen in this panel of additional B burgdorferi protein antigens and was the only antigen to produce a significant increase in absorption as compared to a hypothetical A405 mean of 0.35 (t[7] = 4.854; P = .0018), with 7 of 8 samples having appreciable antibodies detected (A405 > 0.65). The only other antigen in the ELISA testing that resulted in appreciable antibodies detected in more than 1 horse was family 12 lipoprotein A (FtlA)12, with 3 horses having A405 > 0.65; however, the mean of the 8 sample values was not significantly greater than a hypothetical A405 mean of 0.35.
Antibody response to various B burgdorferi protein antigens. A—Outer surface protein A (OspA) antibody value distribution (median fluorescence intensity [MFI]) for clinical cases of nuchal bursitis (n = 13) and control horses (15) compared by an unpaired t test (P < .001; t[26] = 4.750). Values above 2,000 MFI indicate OspA antibody levels within positive range on the Lyme multiplex assay. B—Antibodies detected by ELISA, measured in absorbance at 405 nm (A405), for 8 of the B burgdorferi nuchal bursitis cases. Fifteen different B burgdorferi proteins were evaluated; factor H–binding protein B (FhbB) is an unrelated protein to evaluate for nonspecific binding. The reference value, represented by a dotted line, is 3 times the measured blank value for the assay. For mean values greater than the reference value, the difference between the reference value as a hypothetical mean and the measured mean value is significant only for OspA (t[7] = 4.854; P = .0018).
Citation: Journal of the American Veterinary Medical Association 262, 11; 10.2460/javma.24.05.0312
Treatment and outcome findings
Treatment was variable and involved a combination of therapeutic modalities, yet all horses received systemic antimicrobials and NSAIDs at some point during the management of their nuchal bursitis. Thirteen of 19 horses (68%) received surgical bursoscopy and debridement of the nuchal bursa performed by distending the nuchal bursa with sterile saline to allow insertion of an arthroscope for visualization of the bursa and synovium. The bursa was explored, the abnormal synovium was debrided, and the bursa was copiously lavaged with sterile saline. Six of 19 horses (32%) were treated with medical management alone, involving systemic antibiotics and nonsteroidal anti-inflammatories. As part of their therapy, 4 of 19 horses (21%) had drainage of bursal fluid via needle aspiration, performed independent of surgical drainage. Fifteen of 19 horses (79%) received at least 1 therapeutic intrabursal injection that included 1 or more of the following medications: amikacin, ceftiofur sodium, Polyglycan, hyaluronic acid, and corticosteroids. Two of 19 horses (11%) received at least 1 session of extracorporeal shock wave therapy over the poll area.
Eighty-four percent (16 of 19) of cases improved clinically following treatment. Of these cases, 56% (9 of 16) of horses returned to athletic work, with 67% (6 of 9) returning to their previous level of performance and 33% (3 of 9) returning to a lower level of exercise. Sixteen percent (3 of 19) of cases did not improve despite treatment, with 1 horse having undergone 2 cranial nuchal bursoscopy procedures and 2 horses having received medical management alone. One horse was euthanized due to unresolved nuchal bursitis.
Histologic findings
A total of 15 nuchal bursitis cases with histologic samples were identified, 11 of which originated from the search for nuchal bursitis postmortem cases with stored FFPE tissues at the AHDC and PADLS (Table 1). Of the 11 postmortem nuchal bursitis cases with stored FFPE tissues, 45% (5 of 11) had B burgdorferi detected via PCR on FFPE scrolls. When combined with the 4 cases having B burgdorferi PCR detection identified before death, there existed a total of 9 nuchal bursitis histologic specimens with B burgdorferi PCR detection in this study and 6 without. The histologic abnormalities identified in nuchal bursitis cases with and without PCR detection of B burgdorferi were similar. Common findings in both groups included the presence of fibrin, necrosis, and mineralization, with a variable population of WBCs (Figure 4). Lymphohistiocytic and/or plasmacytic infiltrates were seen in 56% (5 of 9) of the B burgdorferi PCR–positive samples and 33% (2 of 6) of the B burgdorferi PCR–negative samples. Necrosuppurative lesions were seen in 22% (2 of 9) of the PCR-positive samples and 33% (2 of 6) of the PCR-negative samples. Another common finding was thickening of the nuchal bursa synovium and capsule by organizing fibrovascular tissue (ie, granulation tissue). Borrelia burgdorferi was not identified histologically by use of H&E staining or argyrophilic histochemical stains. Immunohistochemical staining was negative for B burgdorferi in 2 AHDC cases where B burgdorferi was detected with PCR.
Gross and histologic images of the nuchal bursa (incised) in a B burgdorferi PCR–positive nuchal bursitis case showing intraluminal fibrin (arrows) containing foci of inflammatory cells, mineralization (arrowheads), and thickening of the bursal capsule by inflamed granulation tissue (double-headed arrows).
Citation: Journal of the American Veterinary Medical Association 262, 11; 10.2460/javma.24.05.0312
Discussion
This study demonstrates that significant elevation of serum OspA is associated with the PCR detection of B burgdorferi in chronic equine nuchal bursitis (Figures 3 and 4). This is a novel association, as a high OspA antibody value in horses has previously been attributed to prior vaccination with a Lyme vaccine approved for canine use or early natural infection.13 A similar finding of high OspA has been described in human patients with prolonged severe Lyme arthritis.14,15 Expression of OspA by B burgdorferi is thought to facilitate the spirochete’s colonization of the tick midgut, and its expression is downregulated as the spirochetes enter the mammalian host.16 This downregulation causes OspA antibodies to be low or undetectable after natural infection in most animals.6 The persistence of high OspA antibodies in unvaccinated horses with nuchal bursitis, in combination with PCR detection of B burgdorferi within the nuchal bursa in the absence of other pathogens, suggests persistent infection of the nuchal bursa and immune response to the infection. Borrelia burgdorferi bacterial culture of nuchal bursa synovial fluid or tissue has not yet been described in equine nuchal bursitis cases, but doing so would help further support the hypothesis that B burgdorferi infection is actively present at this site. Although the antibody responses to several common immunodominant proteins reported to be associated with B burgdorferi infection, including OspC and OspF, were not elevated in most of the described cases, antibody response to B burgdorferi protein FtlA was noted in several cases. Camire et al12 previously described FtlA antibody response in a group of B burgdorferi–seropositive horses. In their study, anti-FtlA antisera displayed complement-dependent antibody-mediated killing activity, suggesting that FtlA may be a candidate for inclusion in multivalent vaccines for B burgdorferi.
While OspA antibodies can occasionally be found in apparently healthy, non–Lyme-vaccinated horses that have traveled to regions where the Ixodes spp vector exists, seroprevalence studies conducted by Funk et al17 and Neely et al18 utilizing healthy, unvaccinated horses in North America suggest OspC and OspF are more often detected. These studies utilized the equine Lyme multiplex assay and demonstrated seroprevalence of 3.4% and 6% for OspA and an overall seroprevalence of 14% and 33% for horses in the Canadian province of Ontario and the US state of Virginia, respectively.17–19 Their work also demonstrated that horses may maintain elevated OspA antibody titers during a 1-year period.17,19 In contrast, OspA antibody was not detected in a group of horses from the California desert where exposure to Ixodes spp ticks is unlikely.20 Due to the expanding endemic range of the Ixodes spp tick in North America,4 there remains a need for updated seroprevalence studies characterizing the presence of OspA and other Borrelia-specific antibodies in healthy, unvaccinated horses across broad regions of North America.
Upon review of all equine synovial specimens submitted for B burgdorferi PCR to the AHDC between 2007 and 2023, the nuchal bursa was the only synovial structure from which B burgdorferi was detected (Figure 1). This observation that B burgdorferi was identified within the nuchal bursa only, despite the testing of many synovial structure specimens from the equine limb, suggests that the equine nuchal bursa may be more vulnerable to B burgdorferi infection than other synovial structures in horses. This finding is in contrast to the propensity of B burgdorferi to infect appendicular synovial structures of humans and dogs, resulting in arthritis months after the initial infection,21,22 and the outcome of an experimental infection study of ponies performed by Chang et al,23 which found that the limb synovial membranes are commonly infected 9 months after tick attachment, though the nuchal bursa was not evaluated in that study. Other B burgdorferi–positive or suspect specimens tested at the AHDC reflected cases of pseudolymphoma (skin), neuroborreliosis (CSF and brain), and uveitis (aqueous humor).
Most of the presenting clinical signs and imaging abnormalities in horses with nuchal bursitis in this study are similar to those previously described in the literature and are not specific to nuchal bursitis cases involving B burgdorferi.1,2 However, 2 study horses had a primary complaint of head tilt, which has not been previously described in association with equine nuchal bursitis. A head tilt in the horse could indicate dysfunction of the peripheral vestibular system with differentials including otitis media interna, head trauma, and temporohyoid osteoarthropathy.24,25 One of our study horses that presented with a head tilt was originally diagnosed with right-sided temporohyoid osteoarthropathy and did not improve with surgical ceratohyoidectomy. Only after CT imaging, nuchal bursitis was suspected due to increased radiopharmaceutical uptake at the dorsal aspect of C1. This case demonstrates that nuchal bursitis should be considered as a differential for equine head tilt and that CT can be complementary to more standard imaging modalities of radiographs and ultrasound.
Two additional ancillary diagnostic trends were noted in the horses in this study. First, positive aerobic culture of nuchal bursa synovial fluid or tissue occurred predominant in those horses with nuchal bursa draining tracts. The positive aerobic bacterial cultures in horses with nuchal bursa draining tracts were thought to be secondary to ascending bacterial infection (Table 2). The second ancillary diagnostic trend characterizing our cases was neutrophilic inflammation in nuchal bursa synovial fluid. This cytologic abnormality was previously described by Guarino et al5 in their report summarizing a single case of B burgdorferi–positive equine nuchal bursitis and has been found in cerebrospinal fluid of equine neuroborreliosis and equine ocular borreliosis cases and B burgdorferi–associated arthritis of dogs and humans.1,2,21,26–28
Histopathology did not differ between horses in this study with B burgdorferi PCR–positive nuchal bursitis and those without. In comparison, preliminary histopathology of normal horse nuchal bursa reveals minimal to no inflammatory infiltrate nor significant histopathologic abnormalities.29 The nuchal bursitis histopathologic findings of lymphohistiocytic and plasmacytic infiltrates with occasional necrosuppurative lesions are similar to those reported in equine neuroborreliosis and ocular borreliosis cases,28,30,31 as well as experimentally infected dogs that developed arthritis characterized by fibrinosuppurative or lymphoplasmacytic infiltrates.21 These histologic features of inflammation are nonspecific; therefore, B burgdorferi–associated nuchal bursitis cannot be differentiated on histopathology alone. In the future, considering B burgdorferi involvement in horses with nuchal bursitis and high serum OspA antibodies is recommended, even when molecular testing is negative. Lack of B burgdorferi detection by PCR in FFPE samples from nuchal bursitis cases in this study could be attributed to low or waxing and waning numbers of B burgdorferi, previous treatment with antibiotics, or degradation of genetic material following formalin fixation32–34 and is not uncommon in equine neuroborreliosis and equine ocular borreliosis cases.27,31 The finding that B burgdorferi immunohistochemistry on nuchal bursa tissue was negative in 2 cases with B burgdorferi molecular detection suggests that a low number of organisms may have been present in the specimens, and PCR on fresh tissue may be a more sensitive diagnostic tool in these cases.
Due to the variability in treatment regimens in our cases, it was not possible to correlate treatment selection with patient outcome and therefore it is too soon to speculate on treatment recommendations. Targeted therapy for B burgdorferi–positive equine nuchal bursitis cases requires further investigation. The case outcomes in this study reflect published literature findings1,2 that indicate equine nuchal bursitis resolution often requires bursoscopy, a surgical treatment that is not specifically targeted at B burgdorferi. Bergren et al2 found that, although 78.6% of horses with nuchal bursitis may return to their previous level of exercise following bursoscopy, clinical signs can persist despite surgical and medical intervention.
A limitation of this retrospective study was incomplete medical records or diagnostic datasets for all horses. Unfortunately, not every clinical case included bacterial culture, nor did all cases have serology for brucellosis and B burgdorferi performed. All tested cases were negative for B abortus antibodies, and since B abortus has been eradicated from the US beyond the Greater Yellowstone area, there is a low probability of seropositivity in horses from the northeastern US.35 Despite not all cases having a Lyme multiplex assay performed, there was a statistically significant difference in the OspA values between cases in which B burgdorferi was detected by PCR compared to control horses.
Increased serum OspA antibodies are associated with the presence of B burgdorferi in the nuchal bursa of horses. The role of this pathogen in equine nuchal bursitis may be underestimated, as evidenced by 45% (6 of 11) of postmortem nuchal bursitis samples, which were not previously identified as B burgdorferi infected, retrospectively testing positive for B burgdorferi. Targeted therapy for B burgdorferi–associated nuchal bursitis requires further investigation.
Acknowledgments
The authors would like to acknowledge the case data contributions of private practitioners Dr. Rachel Gardner, Dr. Petrisor Baia, Dr. Jeffery LaPoint, Dr. Joseph Tashjian, Dr. Michael Fugaro, and Dr. Sean Nash. In addition, we would like to acknowledge the diagnostic contributions of laboratory staff at the Cornell Animal Health Diagnostic Center and the Pennsylvania Animal Diagnostic Laboratory System.
Disclosures
The authors have nothing to disclose. No AI-assisted technologies were used in the generation of this manuscript.
Funding
The authors have nothing to disclose.
References
- 1.↑
García-López JM, Jenei T, Chope K, Bubeck KA. Diagnosis and management of cranial and caudal nuchal bursitis in four horses. J Am Vet Med Assoc. 2010;237(7):823-829. doi:10.2460/javma.237.7.823
- 2.↑
Bergren AL, Abuja GA, Bubeck KA, Spoormakers TJP, García-López JM. Diagnosis, treatment and outcome of cranial nuchal bursitis in 30 horses. Equine Vet J. 2018;50(4):465-469. doi:10.1111/evj.12787
- 3.↑
Denny HR. A review of brucellosis in the horse. Equine Vet J. 1973;5(3):121-125. doi:10.1111/j.2042-3306.1973.tb03208.x
- 4.↑
Divers TJ, Gardner RB, Madigan JE, et al. Borrelia burgdorferi infection and Lyme disease in North American horses: a consensus statement. J Vet Intern Med. 2018;32(2):617-632. doi:10.1111/jvim.15042
- 5.↑
Guarino C, Pinn-Woodcock T, Levine DG, Miller J, Johnson AL. Case report: nuchal bursitis associated with Borrelia burgdorferi infection in a horse. Front Vet Sci. 2021;8:743067. doi:10.3389/fvets.2021.743067
- 6.↑
Wagner B, Freer H, Rollins A, et al. Antibodies to Borrelia burgdorferi OspA, OspC, OspF, and C6 antigens as markers for early and late infection in dogs. Clin Vaccine Immunol. 2012;19(4):527-535. doi:10.1128/CVI.05653-11
- 7.↑
Pahl A, Kühlbrandt U, Brune K, Röllinghoff M, Gessner A. Quantitative detection of Borrelia burgdorferi by real-time PCR. J Clin Microbiol. 1999;37(6):1958-1963. doi:10.1128/JCM.37.6.1958-1963.1999
- 8.↑
Wagner B, Freer H, Rollins A, Erb HN, Lu Z, Gröhn Y. Development of a multiplex assay for the detection of antibodies to Borrelia burgdorferi in horses and its validation using Bayesian and conventional statistical methods. Vet Immunol Immunopathol. 2011;144(3-4):374-381. doi:10.1016/j.vetimm.2011.08.005
- 9.↑
Cramer NA, Socarras KM, Earl J, Ehrlich GD, Marconi RT. Borreliella burgdorferi factor H-binding proteins are not required for serum resistance and infection in mammals. Infect Immun. 2024;92(3):e0052923. doi:10.1128/iai.00529-23
- 10.↑
Miller DP, Bell JK, McDowell JV, et al. Structure of factor H-binding protein B (FhbB) of the periopathogen, Treponema denticola: insights into progression of periodontal disease. J Biol Chem. 2012;287(16):12715-12722. doi:10.1074/jbc.M112.339721
- 11.↑
Schuler EJA, Patel DT, Marconi RT. The leptospiral OmpA-like protein (Loa22) is a surface-exposed antigen that elicits bactericidal antibody against heterologous Leptospira. Vaccine X. 2023;15:100382. doi:10.1016/j.jvacx.2023.100382
- 12.↑
Camire AC, O’Bier NS, Patel DT, et al. FtlA and FtlB are candidates for inclusion in a next-generation multiantigen subunit vaccine for Lyme disease. Infect Immun. 2022;90(10):e0036422. doi:10.1128/iai.00364-22
- 13.↑
Guarino C, Asbie S, Rohde J, Glaser A, Wagner B. Vaccination of horses with Lyme vaccines for dogs induces short-lasting antibody responses. Vaccine. 2017;35(33):4140-4147. doi:10.1016/j.vaccine.2017.06.052
- 14.↑
Akin E, McHugh GL, Flavell RA, Fikrig E, Steere AC. The immunoglobulin (IgG) antibody response to OspA and OspB correlates with severe and prolonged Lyme arthritis and the IgG response to P35 correlates with mild and brief arthritis. Infect Immun. 1999;67(1):173-181. doi:10.1128/IAI.67.1.173-181.1999
- 15.↑
Kalish RA, Leong JM, Steere AC. Association of treatment-resistant chronic Lyme arthritis with HLA-DR4 and antibody reactivity to OspA and OspB of Borrelia burgdorferi. Infect Immun. 1993;61(7):2774-2779. doi:10.1128/iai.61.7.2774-2779.1993
- 16.↑
Schwan TG, Piesman J. Temporal changes in outer surface proteins A and C of the Lyme disease-associated spirochete, Borrelia burgdorferi, during the chain of infection in ticks and mice. J Clin Microbiol. 2000;38(1):382-388. doi:10.1128/JCM.38.1.382-388.2000
- 17.↑
Funk RA, Pleasant RS, Witonsky SG, Reeder DS, Werre SR, Hodgson DR. Seroprevalence of Borrelia burgdorferi in horses presented for Coggins testing in southwest Virginia and change in positive test results approximately 1 year later. J Vet Intern Med. 2016;30(4):1300-1304. doi:10.1111/jvim.13973
- 18.↑
Neely M, Arroyo L, Jardine C, et al. Evaluation of 2 ELISAs to determine Borrelia burgdorferi seropositivity in horses over a 12-month period. J Vet Diagn Invest. 2021;33(4):736-739. doi:10.1177/10406387211016103
- 19.↑
Neely M, Arroyo LG, Jardine C, et al. Seroprevalence and evaluation of risk factors associated with seropositivity for Borrelia burgdorferi in Ontario horses. Equine Vet J. 2021;53(2):331-338. doi:10.1111/evj.13317
- 20.↑
Slaughter KM, Halland SK, Schur LA, Wagner B, DeMel DM, Bertone JJ. Humoral response of Borrelia burgdorferi outer surface protein A (OspA) vaccination in equids. Equine Vet Educ. 2017;29(10):572-576. doi:10.1111/eve.12690
- 21.↑
Appel MJG, Allan S, Jacobson RH, et al. Experimental Lyme disease in dogs produces arthritis and persistent infection. J Infect Dis. 1993;167(3):651-664. doi:10.1093/infdis/167.3.651
- 22.↑
Bockenstedt LK, Wooten RM, Baumgarth N. Immune response to Borrelia: lessons from Lyme disease spirochetes. Curr Issues Mol Biol. 2021;42:145-190. doi:10.21775/cimb.042.145
- 23.↑
Chang YF, Novosol V, McDonough SP, et al. Experimental infection of ponies with Borrelia burgdorferi by exposure to Ixodid ticks. Vet Pathol. 2000;37(1):68-76. doi:10.1354/vp.37-1-68
- 24.↑
Watrous BJ. Head tilt in horses. Vet Clin North Am Equine Pract. 1987;3(2):353-370. doi:10.1016/S0749-0739(17)30678-8
- 25.↑
Oliver ST, Hardy J. Ceratohyoidectomy for treatment of equine temporohyoid osteoarthopathy (15 cases). Can Vet J. 2015;56(4):382-386.
- 26.↑
Barthold SW, de Souza MS, Janotka JL, Smith AL, Persing DH. Chronic Lyme borreliosis in the laboratory mouse. Am J Pathol. 1993;143(3):959-971.
- 27.↑
Johnstone LK, Engiles JB, Aceto H, et al. Retrospective evaluation of horses diagnosed with neuroborreliosis on postmortem examination: 16 cases (2004-2015). J Vet Intern Med. 2016;30(4):1305-1312. doi:10.1111/jvim.14369
- 28.↑
Priest HL, Irby NL, Schlafer DH, et al. Diagnosis of Borrelia-associated uveitis in two horses. Vet Ophthalmol. 2012;15(6):398-405. doi:10.1111/j.1463-5224.2012.01000.x
- 29.↑
Sfraga HRM, Demeter EA, Pinn-Woodcock TL, Guarino C, Cercone M. Post-mortem characterization of subclinical inflammation of nuchal bursae and nuchal ligaments in horses. Abstract presented at: Cornell University College of Veterinary Medicine’s Clinical Investigators’ Day; March 15, 2024; Ithaca, NY.
- 30.↑
Imai DM, Barr BC, Daft B, et al. Lyme neuroborreliosis in 2 horses. Vet Pathol. 2011;48(6):1151-1157. doi:10.1177/0300985811398246
- 31.↑
Scherrer NM, Knickelbein KE, Engiles JB, Johnstone LK, Tewari D, Johnson AL. Ocular disease in horses with confirmed ocular or central nervous system Borrelia infection: case series and review of literature. Vet Ophthalmol. 2020;23(6):1014-1024. doi:10.1111/vop.12817
- 32.↑
Bockenstedt LK, Wormser GP. Review: unraveling Lyme disease. Arthritis Rheumatol. 2014;66(9):2313-2323. doi:10.1002/art.38756
- 33.
Chang YF, Novosel V, Chang CF, et al. Experimental induction of chronic borreliosis in adult dogs exposed to Borrelia burgdorferi-infected ticks and treated with dexamethasone. Am J Vet Res. 2001;62(7):1104-1112. doi:10.2460/ajvr.2001.62.1104
- 34.↑
Ferrer I, Armstrong J, Capellari S, et al. Effects of formalin fixation, paraffin embedding, and time of storage on DNA preservation in brain tissue: a BrainNet Europe study. Brain Pathol. 2007;17(3):297-303. doi:10.1111/j.1750-3639.2007.00073.x
- 35.↑
National Brucellosis Eradication Program. USDA APHIS. June 7, 2023. Updated June 21, 2024. Accessed December 8, 2023. https://www.aphis.usda.gov/aphis/ourfocus/animalhealth/animal-disease-information/cattle-disease-information/national-brucellosis-eradication/brucellosis-eradication-program
