History
A farrowing-to-finish swine system was visited for technical assistance. The nursery phase had 19,712 piglets vaccinated with commercial vaccines for porcine circovirus type 2 (PCV-2), Mycoplasma hyopneumoniae, Actinobacillus pleuropneumoniae, and Streptococcus suis serotype 2. The vaccine administration protocol included 2 doses, at 20 and 40 days of age. One of the main problems described by the owner in the nursery phase was neurological disorders. During the visit, an 8-week-old piglet with a 3-day history of neurological signs was clinically evaluated and later euthanized and submitted to postmortem examination.
Clinical and Gross Findings
The evaluated piglet had with a poor body condition, and the clinical findings were motor incoordination, tremors, lateral recumbency (Figure 1), inability to stand, paddling, and opisthotonus. Treatment was attempted with IM administration of amoxicillin (15 mg/kg, q 24 h) for 3 days, but clinical improvement was not observed. Therefore, the animal was euthanized and submitted to postmortem examination. Autopsy revealed discrete increase in blood volume in the arteries (hyperemia) of the leptomeninges of the brain and a fibrinopurulent exudate covering the meningeal layers. No remarkable gross lesions were seen in the other organs.
Photograph of an 8-week-old piglet with a 3-day history of neurological clinical signs. A—The piglet is in lateral recumbency. B—In the leptomeninges of the brain, there is multifocal purulent exudate (arrow) and marked hyperemia of blood vessels (arrowhead).
Citation: Journal of the American Veterinary Medical Association 261, 4; 10.2460/javma.22.11.0499
Histopathologic Findings
Organ samples were collected, fixed in neutral-buffered 10% formalin, routinely processed for histopathology, sectioned at 3 µm, and stained with H&E. Histologically, the neurological lesions consisted of diffuse infiltration by a large number of inflammatory cells in the leptomeninges of the brain and cervical segment of the spinal cord, fourth ventricle, choroid plexus, and ependyma (Figure 2). The inflammatory infiltrate was composed of viable and degenerate neutrophils and fewer macrophages and was interspersed by fibrin exudation. Multifocally, the perivascular (Virchow-Robin) spaces in the cerebral cortex and cervical spinal cord were expanded by a moderate amount of neutrophils, lymphocytes, and plasma cells arranged in whorling patterns (perivascular cuffing). No significant lesions were observed in other organs.
Photomicrograph of a section of CNS from the piglet described in Figure 1. A—There is a diffuse thickening of the choroid plexus and ependyma by viable and degenerate neutrophils admixed with fibrin deposition. These neutrophils are also eventually seen around blood vessels in the adjacent neuropil (arrowhead). H&E stain; bar = 500 μm. B—Arachnoid space of the leptomeninges is expanded by viable and degenerate neutrophils admixed with fibrin deposition. H&E stain; bar = 200 μm.
Citation: Journal of the American Veterinary Medical Association 261, 4; 10.2460/javma.22.11.0499
Microbiological and Immunohistochemical Findings
Fresh samples of the brain were submitted for DNA extraction by PCR assay, which was performed with a primer set specific for S suis (5′- CAGTATT TACCGCATGGTAGATAT -3′ and 5′- GTAAGATACCGTCAAGTGAGAA -3′). The submitted samples were positive. In addition, formalin-fixed, paraffin-embedded sections of the brain with significant lesions were submitted for immunohistochemistry (IHC) using a polyclonal anti–S suis type 2 antibody (dilution 1:200; Abbiotec). Multifocal immunolabeling was seen in the cytoplasm of neutrophils and macrophages (Figure 3). Samples were not sent for bacterial culture because the animal was previously treated with antibiotic.
Photomicrograph of a section of brain from the piglet described in Figure 1. Cytoplasmic immunolabeling for Streptococcus suis in neutrophils and macrophages. Immunohistochemistry; bar = 50 µm.
Citation: Journal of the American Veterinary Medical Association 261, 4; 10.2460/javma.22.11.0499
Morphologic Diagnosis and Case Summary
Morphologic diagnosis: marked, diffuse suppurative meningoencephalitis and meningomyelitis.
Case summary: streptococcal meningoencephalitis in a nursery piglet.
Comments
The clinical history and pathological findings of the piglet in this report were characteristic of meningoencephalitis by S suis, a gram-positive bacterium. Streptococcal meningitis generally affects animals between 5 and 10 weeks of age1 and represents an important disease in pig farms.2 There are 29 serotypes of S suis based on the differentiation of its capsule antigens, and the majority of S suis strains isolated from clinical cases belong to serotypes 1 through 9.1,2 Serotype 2 is described as the most prevalent in humans and pigs.3 However, the pig farm of this report had a recent history of S suis serotype 9 infection. While several virulence factors have been associated with the occurrence of the disease, the importance of these factors in the pathogenesis is not fully understood.2 The polysaccharide capsule conferring serotype specificity is the most important virulence factor demonstrated.2 Other investigated virulence factors are the cell wall protein (muramidase-released protein) and extracellular protein factor.1 In addition, the suilysin exotoxin can be considered another important factor for virulence because it is related to the invasion of epithelial cells due to its great toxicity to different types of cells.2
S suis is distributed worldwide, and the transmission of virulent strains between herds usually occurs through the introduction of carrier pigs into a noninfected farm.2 In acute cases, infected piglets can develop several clinical signs, including motor incoordination, convulsions, lateral recumbency, and opisthotonus,4 which may persist for up to 3 weeks until death. Less frequently, super acute (sudden death) and chronic forms can also occur.1,2 Stress factors (eg, early weaning, overcrowding, and high temperatures) can lead the pigs to immunosuppression and predisposes them to S suis infection,2 which is similar to the present report, since issues surrounding environmental factors such as high temperature were identified in the facility. Affected pigs respond well to parenteral treatment when it is given soon after the first clinical signs.2 The most frequently used antibiotics are ampicillin, amoxicillin, cephalosporin, and florfenicol.2 As an opportunity to reduce the use of antibiotics in swine production, the prophylactic use of vaccines is possible.5 However, as the complexity of S suis epidemiology in swine increases due to multiple serotypes and multiple strains within serotypes with high phenotypical diversity, “vaccine failure” is common.1
According to the literature, gross findings of meningoencephalitis caused by S suis can be unapparent.1 When it is present, there are turbid cerebrospinal fluid and fibrinosuppurative exudate in the meninges and middle ear.2 Histologically, the leptomeninges present marked inflammatory infiltrate composed mainly of neutrophils admixed with fibrin deposition.1,2 Sometimes, the same infiltrate is seen within the ventricles.2 Lymphoplasmacytic infiltrate can be seen in leptomeninges of surviving pigs.4 Similar to what was observed in the piglet of the present report, lesions in spinal cord also occurred in the pigs of that report,4 but less frequently. In addition to meningitis, S suis is also responsible for a variety of infections such as pneumonia, septicemia, and arthritis.1
Meningoencephalitis by S suis is the most frequent neurological disease in piglets in the nursery phase.2 However, some diseases that cause neurological signs in nursery piglets should be considered differential diagnoses. Lesions on the entire brain produce predominantly incoordination, tremors, paddling, and convulsions, as in Aujeszky disease, salt poisoning, and edema disease.4 In Glasser disease, the exudate is concentrated over the cerebellum and occipital poles of the cerebrum and produces motor incoordination and lateral recumbency.4 Listeriosis affects predominantly the brainstem and is associated with paresis.4 Damage to the spinal cord, as seen in Teschovirus infection, results in locomotory signs.4 However, many of the diseases can produce similar clinical signs at different stages, which makes clinical differentiation difficult. Therefore, although the presumptive diagnosis of streptococcus meningitis can be made based on the clinical findings and history, subsequent pathological, bacteriological, and molecular tests on samples from nervous tissue confirm the diagnosis2 and allow us to exclude these differential diagnoses.
Acknowledgments
This study was supported by the Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq) and Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES).
The authors declare that there were no conflicts of interest.
References
- 1. ↑
Gottschalk M, Segura M. Streptococcosis. In: Zimmerman JJ, Karrieker LA, Ramirez A, Schwartz KJ, Stevenson GW, Zhang J, eds. Diseases of Swine. 11th ed. Wiley-Blackwell; 2019:934–950.
- 2. ↑
Guedes RMC, Barcellos DESN. In: Sobestiansky J, Barcellos D, eds. Doença dos Suínos. 3rd ed. Cânone Editorial; 2022:232–241.
- 3. ↑
Costa ATR, Lobato FCF, Abreu VLV, Assis RA, Reia R, Uzal FA. Serotyping and evaluation of the virulence in mice of Streptococcus suis strains isolated from diseased pigs. Rev Inst Med Trop São Paulo. 2005;47(2):113–115. doi:10.1590/S0036-46652005000200012
- 4. ↑
Cantile C, Youssef S. The nervous system. In: Maxie M, ed. Jubb, Kennedy, and Palmer’s Pathology of Domestic Animals. 5th ed. Saunders Elsevier; 2016:250–406.
- 5. ↑
Rocha DL, Santos LF, Santos DL, Costa WMT, Santos JL. Sorotipos de Streptococcus suis identificados em suínos com meningite no estado do Paraná. Arq Bras Med Vet Zootec. 2012;64(2):488–490. doi:10.1590/S0102-09352012000200032
