History
A captive 24-year-old 192-kg (422.4-lb) male Nile crocodile (Crocodylus niloticus) was unexpectedly found dead in a zoo after a 2-day period of inactivity. At that time, 2 other crocodiles were kept under the same conditions and were healthy. The crocodiles lived in an external enclosure but also had an internal refuge with heat plates and a radiant ceiling. The external enclosure included a 40-cm-deep pond and a 2-m-deep estuary with a water filtration system. The water temperature range was 26° to 28°C in summer and 20° to 21°C in winter. Each animal was fed 2 eviscerated chickens weekly; fish or rabbits were substituted for chickens at 1 feeding each month. Food was supplemented with a vitamin complex.a
Clinical and Gross Findings
The crocodile had been transferred from another zoo 4 years earlier; on arrival, it had had no clinical signs or medical history with the exception of chronic cutaneous ulcers. Postmortem examination revealed multiple ulcers in the skin of the ventral regions of the head, trunk, extremities, and tail (Figure 1) In the pleural cavity, there was 2.5 L of serohemorrhagic exudate with fibrin strands. In the celomic and pericardial cavities, a small quantity of serohemorrhagic fluid was also observed. The parietal pleura had a thick irregular yellow fibrin membrane, and the lungs had numerous yellow 1- to 5-mm-diameter nodules distributed in the parenchyma. In the heart, there was a yellow 7-mm-diameter necrotic nodule in the left auricle and multifocal to coalescing areas of necrotizing endocarditis and myocarditis with abundant fibrinous exudate in the right ventricle. Multifocal to coalescing white-yellow nodules were observed in the liver. Numerous foreign bodies (28 different types of coins and some small stones) were found in the stomach with no associated lesions.
Photographs obtained from a captive 24-year-old Nile crocodile (Crocodylus niloticus) that was unexpectedly found dead in a zoo. A—Notice the focal ulcerative dermatitis on the left hind foot. Multiple ulcers were also present in the skin of the ventral regions of the head, trunk, and tail. B—In the right ventricle of the heart, there is necrotizing endocarditis with a large amount of fibrinous exudate. C—The liver has evidence of severe multifocal to coalescing caseous hepatitis. D—In cut section, numerous white-yellow nodules are visible in the hepatic tissue.
Citation: Journal of the American Veterinary Medical Association 255, 12; 10.2460/javma.255.12.1349
Photographs obtained from a captive 24-year-old Nile crocodile (Crocodylus niloticus) that was unexpectedly found dead in a zoo. A—Notice the focal ulcerative dermatitis on the left hind foot. Multiple ulcers were also present in the skin of the ventral regions of the head, trunk, and tail. B—In the right ventricle of the heart, there is necrotizing endocarditis with a large amount of fibrinous exudate. C—The liver has evidence of severe multifocal to coalescing caseous hepatitis. D—In cut section, numerous white-yellow nodules are visible in the hepatic tissue.
Citation: Journal of the American Veterinary Medical Association 255, 12; 10.2460/javma.255.12.1349
Photographs obtained from a captive 24-year-old Nile crocodile (Crocodylus niloticus) that was unexpectedly found dead in a zoo. A—Notice the focal ulcerative dermatitis on the left hind foot. Multiple ulcers were also present in the skin of the ventral regions of the head, trunk, and tail. B—In the right ventricle of the heart, there is necrotizing endocarditis with a large amount of fibrinous exudate. C—The liver has evidence of severe multifocal to coalescing caseous hepatitis. D—In cut section, numerous white-yellow nodules are visible in the hepatic tissue.
Citation: Journal of the American Veterinary Medical Association 255, 12; 10.2460/javma.255.12.1349
Formulate differential diagnoses from the history, clinical findings, and Figure 1—then turn the page→
Histopathologic and Microbiological Findings
Histologic examination of ulcerated skin samples revealed moderate chronic multifocal ulcerative dermatitis with granulomas that were composed of a center of necrotic material delimited by a wall of epithelioid cells and numerous Langhans-type multinucleated giant cells and surrounded by fibrous connective tissue in the superficial dermis (Figure 2) Many well-demarcated granulomas, all surrounded by fibrous connective tissue, were observed in sections of lung, heart, and liver tissues. Scant acid-fast bacteria were present inside the granulomas. The granulomatous lesions were associated with extensive areas of caseous necrosis with abundant gram-negative bacteria in the heart, liver, and lungs. Bacterial emboli were observed in all the examined tissues.
Photomicrographs of tissue sections from the crocodile in Figure 1. A—In a section of ulcerated skin, notice the ulcerative and granulomatous dermatitis with numerous Langhans-type multinucleated giant cells (arrow). H&E stain; bar = 300 μm. Inset—Higher-magnification view of a well-demarcated granuloma with central necrosis (asterisk) and cholesterol clefts (arrow) surrounded by numerous Langhans-type multinucleated giant cells (arrowheads), epithelioid cells, and lymphocytes in a section of the heart. H&E stain; bar = 100 μm. B—In a section of liver tissue, a few acid-fast bacteria (arrow) are located inside a multinucleated giant cell. Fite Ziehl-Neelsen stain; bar = 20 μm. C—An artery in a section of lung tissue has a fibrinocellular embolus (arrow) that contains myriad basophilic bacteria. H&E stain; bar = 70 μm. D—Multiple gram-negative bacteria (arrows) are visible inside a pulmonary embolus. Gram stain; bar = 50 μm.
Citation: Journal of the American Veterinary Medical Association 255, 12; 10.2460/javma.255.12.1349
Photomicrographs of tissue sections from the crocodile in Figure 1. A—In a section of ulcerated skin, notice the ulcerative and granulomatous dermatitis with numerous Langhans-type multinucleated giant cells (arrow). H&E stain; bar = 300 μm. Inset—Higher-magnification view of a well-demarcated granuloma with central necrosis (asterisk) and cholesterol clefts (arrow) surrounded by numerous Langhans-type multinucleated giant cells (arrowheads), epithelioid cells, and lymphocytes in a section of the heart. H&E stain; bar = 100 μm. B—In a section of liver tissue, a few acid-fast bacteria (arrow) are located inside a multinucleated giant cell. Fite Ziehl-Neelsen stain; bar = 20 μm. C—An artery in a section of lung tissue has a fibrinocellular embolus (arrow) that contains myriad basophilic bacteria. H&E stain; bar = 70 μm. D—Multiple gram-negative bacteria (arrows) are visible inside a pulmonary embolus. Gram stain; bar = 50 μm.
Citation: Journal of the American Veterinary Medical Association 255, 12; 10.2460/javma.255.12.1349
Photomicrographs of tissue sections from the crocodile in Figure 1. A—In a section of ulcerated skin, notice the ulcerative and granulomatous dermatitis with numerous Langhans-type multinucleated giant cells (arrow). H&E stain; bar = 300 μm. Inset—Higher-magnification view of a well-demarcated granuloma with central necrosis (asterisk) and cholesterol clefts (arrow) surrounded by numerous Langhans-type multinucleated giant cells (arrowheads), epithelioid cells, and lymphocytes in a section of the heart. H&E stain; bar = 100 μm. B—In a section of liver tissue, a few acid-fast bacteria (arrow) are located inside a multinucleated giant cell. Fite Ziehl-Neelsen stain; bar = 20 μm. C—An artery in a section of lung tissue has a fibrinocellular embolus (arrow) that contains myriad basophilic bacteria. H&E stain; bar = 70 μm. D—Multiple gram-negative bacteria (arrows) are visible inside a pulmonary embolus. Gram stain; bar = 50 μm.
Citation: Journal of the American Veterinary Medical Association 255, 12; 10.2460/javma.255.12.1349
Swab samples from areas of ulcerated skin and from the heart, lung, and liver lesions were collected. The swab samples were plated onto blood, chocolate, and Schaedler agar and cystine-lactose-electrolyte-deficient medium and were incubated at 35°C for 24 to 48 hours or 7 days (for cultures on Schaedler agar) under aerobic or anaerobic conditions. Citrobacter braakii was the predominant bacterium identified in the heart, lung, and liver samples. In the skin lesion samples, mixed flora were isolated among which Morganella morganii predominated.
Paraffin-embedded skin, heart, liver, and lung sections were tested with mycobacteria-specific PCR assays. Primers were designed for Mycobacterium tuberculosis insertion sequence [IS]6110, Mycobacterium avium subsp paratuberculosis IS900, Mycobacterium avium subsp avium IS901, and Mycobacterium marinum 16S-23S ribosomal DNA internal transcribed spacer (Appendix). The PCR assays were performed with a thermal cyclerb at 95°C for 30 seconds, then 95°C for 5 seconds and 60°C for 34 seconds (40 cycles), followed by 95°C for 15 seconds and then 60°C for 1 minute. Products were stored at 4°C prior to mycobacteria detection.c Results of the PCR assays performed on the paraffin-embedded samples confirmed the presence of M avium subsp avium in the skin, lung, and liver sections.
Toxicological Analyses
Given the number, type, year minted, and composition of the coins detected in the crocodile's stomach, formalin-fixed samples of the liver and heart underwent toxicological analyses for heavy metals (aluminum, cobalt, manganese, nickel, tin, and zinc). Before the analyses were performed, the tissue samples were rinsed, homogenized, and dried at 75° to 80°C until a constant weight was attained. For each type of tissue, dried material (0.211 to 0.235 g) underwent microwave digestion with HNO3 (65%), H2O2 (30%), and H2O (5%). The concentrations of aluminum, cobalt, manganese, nickel, tin, and zinc were measured by inductively coupled plasma mass spectrometry.d The analytical precision was verified by analysis of fish protein certified reference material for trace metals.e Although there are no reference values for concentrations of heavy metals in the tissues of this species of crocodile, the concentration of aluminum in heart tissue (7,027.98 ng/g) was high and concentrations of cobalt in liver tissue (7.54 ng/g) and heart tissue (7.14 ng/g) were low, compared with published data for alligators.1,2
Morphologic Diagnosis and Case Summary
Morphologic diagnosis and case summary: ulcerative dermatitis and septicemia associated with disseminated granulomatous and necrotic lesions caused by M avium subsp avium and C braakii coinfection in a Nile crocodile.
Comments
The crocodile of the present report was unexpectedly found dead in its pond after a 2-day period of inactivity. It has been reported that septicemic processes in crocodilians are usually associated with sudden death without previous clinical signs but can also cause lethargy, anorexia, and weight loss.3
Septicemia in crocodiles in captivity has been rarely reported. However, reptiles, including crocodiles, are known to be susceptible to mycobacteriosis.4 Systemic granulomatous inflammation in Crocodylus johnstoni and C niloticus caused by Mycobacterium ulcerans5 and M avium,6 respectively, has been described. Granulomatous dermatitis has been associated with infection with unidentified Mycobacterium species in Crocodylus porosus.7
Aerobic bacteria, such as Aeromonas spp or Pseudomonas spp, are among the microorganisms that are most frequently involved in the development of septicemia in crocodiles. However, septicemia as a result of infection with Salmonella sp, Pasteurella sp, Klebsiella sp, Edwardsiella sp, Proteus sp, Citrobacter freundii, Enterobacter agglomerans, M morganii, Serratia marcescens, and Klebsiella oxytoca in crocodiles has been reported.3,8 The enterobacteria C braakii and M morganii (as were isolated from the crocodile of the present report) are typically present among the commensal flora of crocodilians.9 Some septicemic processes are associated with bacteria from an individual's commensal flora, which suggests an influence of factors such as stress caused by overcrowding within an exhibit, sudden diet changes, poor hygienic conditions, and immunosuppression.1
It has been experimentally demonstrated in rats and mice that aluminum, a ubiquitous environmental metal, can cause toxic effects on the immune system.10 Administration of AlCl3 to rats lowers the T- and B-lymphocyte proliferation rates and circulating concentrations of IgG, interleukin-2, and tumor necrosis factor-α and alters CD4+ and CD8+ T-cell subset proportions and lymphocyte immune function.11 On the other hand, cobalt is an essential element for vitamin B12 formation, and a deficiency in cobalt alters RBC formation, causes liver disorders and neurologic problems, and delays growth.12
Occasionally, skin lesions allow pathogenic microorganisms to gain access to a body with resulting septicemia.3 For the crocodile of the present report, the wide dissemination of mycobacterial lesions in the skin and internal organs and the histologic characteristics of the granulomas indicated a chronic disease process. The pathological findings suggested that chronic ulceration, along with possible immunosuppression associated with the mycobacterial infection, could have facilitated spread of C braakii and resulted in the animal's death. The high concentration of aluminum in heart tissue and low concentration of cobalt in heart and liver tissues could have had an immunosuppressive effect. Morganella morganii could be considered a contaminant because it was isolated only from swab samples of skin ulcers; however, given the limited number of analyzed swab samples, the presence of M morganii in other body locations could not be ruled out.
The most common source of exposure to mycobacteria for reptiles is thought to be contaminated food, water, or soil.4 In the case described in the present report, the origin of M avium subsp avium was not determined. At all times in any zoological collection, it is prudent to have measures in place to minimize the risk of microbial exposure of staff, visitors, and animals.
For the crocodile of the present report, the gross and microscopic lesions were highly characteristic of mycobacterial infection. However, in granulomatous lesions, only a small number of acid-fast bacteria were detected following Ziehl-Neelsen staining, and use of mycobacteria-specific PCR assays as a complementary diagnostic tool5 was needed to identify the causative agent.
Acknowledgments
Funded by CEU Universidad Cardenal Herrera (IDOC-1610). Analyses were performed with a slide scanner purchased with European Union funds (FEDER Programme: PO FEDER 2007–2013).
The preliminary results of this case were presented at the 28th Annual Meeting of the Spanish Society of Veterinary Pathology, Coroloba, June 2016; and the 34th Annual Meeting of the European Society of Veterinary Pathology, Bologna, Italy, September 2016.
The authors thank Ms. Rocío González and Ms. Isabel M. Navas for technical support.
Footnotes
Akwavit Regular mini, Kasper Faunafood, Woerden, Netherlands.
Applied Biosystems 7500 RT-PCR System, Life Technologies, Carlsbad, Calif.
SYBR Premix Ex Taq II, Takara Bio Inc, Kusatsu, Japan.
ICP-MS Thermo-Optek Serio X7, Waltham, Mass.
DORM-4, Ottawa, ON, Canada.
References
1. Campbell JW, Waters MN, Tarter A, et al. Heavy metal and selenium concentrations in liver tissue from wild American alligator (Alligator mississippiensis) livers near Charleston, South Carolina. J Wildl Dis 2010;46:1234–1241.
2. Nilsen FM, Kassim BL, Delaney JP, et al. Trace element bio-distribution in the American alligator (Alligator mississippiensis). Chemosphere 2017;181:343–351.
3. Orós J. Patologías más frecuentes en crocodilianos (orden Crocodylia). In: Atlas de patología de reptiles. Buenos Aires, República Argentina: Editorial Intermédica, 2008;189–214.
4. Roh YS, Park H, Cho A, et al. Granulomatous pneumonia in a captive freshwater crocodile (Crocodylus johnstoni) caused by Mycobacterium szulgai. J Zoo Wildl Med 2010;41:550–554.
5. Ariel E, Ladds PW, Roberts BL. Mycobacteriosis in young fresh-water crocodiles (Crocodylus johnstoni). Aust Vet J 1997;75:831–833.
6. Huchzermeyer FW, Huchzermeyer HF. Mycobacterial infections in farmed and captive crocodiles, in Proceedings. 15th Work Meet Crocodile Spec Group 2000;109–112.
7. Buenviaje GN, Ladds P, Martin Y. Pathology of skin diseases in crocodiles. Aust Vet J 1998;76:357–363.
8. Novak SS, Seigel RA. Gram-negative septicaemia in American alligators (Alligator mississippiensis). J Wildl Dis 1986; 22:484–487.
9. Johnston MA, Porter DE, Scott GI, et al. Isolation of faecal coliform bacteria from the American alligator (Alligator mississippiensis). J Appl Microbiol 2010;108:965–973.
10. Zhu Y, Li Y, Miao L, et al. Immunotoxicity of aluminum. Chemosphere 2014;104:1–6.
11. Yang X, Xu F, Zhuang C, et al. Effects of corticosterone on immune functions of cultured rat splenic lymphocytes exposed to aluminum trichloride. Biol Trace Elem Res 2016;173:399–404.
12. Simonsen LO, Harbak H, Bennekou P. Cobalt metabolism and toxicology—a brief update. Sci Total Environ 2012;432:210–215.
Appendix
Primers used in PCR assays to detect mycobacteria in paraffin-embedded skin, heart, liver, and lung sections obtained from a captive 24-year-old Nile crocodile (Crocodylus niloticus) that was unexpectedly found dead in a zoo.
| Organism (sequence) | Primer |
|---|---|
| Mycobacterium tuberculosis (IS6110) | Forward: CTCGTCCAGCGCCGCTTCGG |
| Reverse: CCTGCGAGCGTAGGCGTCGG | |
| Mycobacterium avium subsp paratuberculosis (IS900) | Forward: GATCGGAACGTCGGCTGGTCAGG |
| Reverse: GATCGCCTTGCTCATCGCTGCCG | |
| Mycobacterium avium subsp avium (IS901) | Forward: AAGCCGAGGTGGTGTATGT |
| Reverse: AGCGAAGATGGCGGTGAGCAT | |
| Mycobacterium marinum (16S-23S ITS) | Forward: CACCACGAGAAACACTCCAA |
| Reverse: ACATCCCGAAACCAACAGAG |
IS = Insertion sequence. ITS = Internal transcribed space.
