Molecular analysis suggests that there is an association between viral infections and UMRD in people.1,2 For example, nucleic acids of enterovirus, adenovirus, influenza viruses, human herpesvirus 6, Epstein-Barr virus, cytomegalovirus, hepatitis C virus, and parvovirus B19 have been detected by means of nested and reverse transcriptase PCR assays in myocardial tissue from human patients with histologic evidence of myocarditis.3
Myocarditis has been documented in dogs with DCM or rhythm disturbances by postmortem histologic examination of myocardial tissue.4–9 Reported causes of myocarditis in dogs include viral, protozoal, bacterial, fungal, parasitic, and noninfectious, but little is known about their respective prevalences.6 Preliminary findings10 from our group indicate the presence of wild-type viruses (ie, canine parvovirus 2, canine coronavirus, and canine herpesvirus 1) in EMB samples from adult dogs with DCM and UMRD. Another study11 used a PCR assay to identify canine parvovirus 2 in myocardial tissue collected from cadavers of young dogs (< 2 years of age) with myocardial inflammation, fibrosis, or necrosis (at least some of which also had parvoviral enteritis) and confirmed that result by means of in situ hybridization.
Endomyocardial biopsy has become the technique of choice for antemortem diagnosis of myocardial disease in people with UMRD.12 A retrospective chart review indicated that predicting the underlying cause of UMRD on the basis of clinical signs alone was inaccurate in 31% of human patients; however, when EMB samples were used, a definitive diagnosis was determined for 75% of patients with a high degree of specificity.13 Myocarditis is the most common disorder diagnosed by examination of EMB samples, and up to 30% of human patients with myocarditis progress to develop DCM, which is associated with a poor prognosis.1 Treatment of many forms of myocarditis is determined on the basis of clinical signs; however, histologic examination and immunohistochemical and molecular analysis of EMB samples can play a critical role in identifying patients who may benefit from targeted treatment.14–16
It has been suggested that EMB samples could be useful for reliably identifying underlying causes of UMRD in dogs.17 However, this approach has not been systematically evaluated in dogs. Therefore, the objectives of the study reported here were to detect nucleic acid from viral, bacterial, and protozoal pathogens in EMB samples from dogs with UMRD and from a group of control dogs with CHD and to compare prevalences of these pathogens between these 2 groups. A secondary objective was to determine whether nucleic acids from the same pathogens could be detected in blood samples from dogs with positive PCR assay results for EMB samples.
Materials and Methods
Animals
The study was designed as a prospective cross-sectional study and included dogs that were evaluated at the Clinica Veterinaria Malpensa or the Ospedale Veterinario I Portoni Rossi between January 2013 and March 2017 because of unexplained clinical DCM, rhythm disorders (eg, AVB, ventricular arrhythmias, and supraventricular arrhythmias), or both and dogs that required RV catheterization. A diagnosis of DCM was made by means of echocardiography; rhythm disorders were documented by use of 12-lead surface ECG and Holter monitoring. Dogs with CHD that were evaluated during the same time period and required RV catheterization for correction of the disorder were included as control dogs.
Medical history, including vaccination status and whether dogs had recently (ie, in the previous month) had any clinical signs of respiratory or gastrointestinal disease, episodes of pyrexia, or episodes of transient loss of consciousness or weakness, was recorded for each dog. Physical examination findings, current treatment information, and results of 12-lead surface ECG, Holter monitoring, thoracic radiography, echocardiography, and clinicopathologic testing, including testing for antibodies against Anaplasma phagocytophilum, Anaplasma platys, Borrelia burgdorferi, Ehrlichia canis, and Ehrlichia ewingii,a were also recorded for each dog. The study protocol was approved by the hospitals’ boards. Owners were informed about potential complications, and dogs were enrolled in the study only after owner consent was obtained.
Sample collection
Dogs were anesthetized, and RV EMB was performed by use of a previously described18 modified transvenous technique that yielded biopsy samples approximately 2 mm in diameter (Figure 1). For dogs with CHD, RV EMBs were performed during the same anesthetic episode during which interventional procedures were performed to correct the CHD. During EMB, attempts were made to collect 6 biopsy samples (3 from the RV apex and 3 from the interventricular septum) from each dog. Biopsy samples were submitted for histologic examination and for testing with PCR assays for nucleic acids from 12 pathogens; PCR assays were also performed on blood samples, when available, from dogs with EMB samples that yielded positive PCR assay results.
Representative fluoroscopic images from a dog with unexplained supraventricular arrhythmia that underwent EMB. A—A 7F 45-cm introducer was guided across the tricuspid valve annulus and positioned in the RV inflow tract. B—A precurved bioptome was advanced through the introducer to reach and sample the RV apex.
Citation: Journal of the American Veterinary Medical Association 255, 10; 10.2460/javma.255.10.1150
Representative fluoroscopic images from a dog with unexplained supraventricular arrhythmia that underwent EMB. A—A 7F 45-cm introducer was guided across the tricuspid valve annulus and positioned in the RV inflow tract. B—A precurved bioptome was advanced through the introducer to reach and sample the RV apex.
Citation: Journal of the American Veterinary Medical Association 255, 10; 10.2460/javma.255.10.1150
Representative fluoroscopic images from a dog with unexplained supraventricular arrhythmia that underwent EMB. A—A 7F 45-cm introducer was guided across the tricuspid valve annulus and positioned in the RV inflow tract. B—A precurved bioptome was advanced through the introducer to reach and sample the RV apex.
Citation: Journal of the American Veterinary Medical Association 255, 10; 10.2460/javma.255.10.1150
Histologic examination of EMB samples
Light microscopy—Formalin-fixed EMB samples were processed by routine methods, embedded in paraffin wax, and sectioned at a thickness of 5 μm. Twenty-four serial sections were prepared for each EMB sample; 12 were evaluated histologically to provide a good representation of the entire sample, and 12 were used for immunohistochemical analysis. Sections were numbered sequentially, and the 12 sections for histologic examination were mounted on glass slides and stained with H&E stain (slides 1, 6, 11, 16, 21, and 24) for morphological evaluation or with Masson trichrome stain (slides 2, 7, 12, 17, 22, and 23) to detect collagen deposition. Each EMB sample was assessed by a single individual (MT) for evidence of myocyte hypertrophy, sarcoplasm vacuolization, fibrosis, and lymphocytic inflammation. A semiquantitative scoring system was used to describe myocyte hypertrophy and sarcoplasm vacuolization (score, 0 to 3, where 0 = absent, 1 = mild, 2 = moderate, and 3 = severe). Fibrosis was categorized as endocardial, interstitial, or replacement. On the basis of the Dallas criteria,19 lymphocytic inflammation was classified as interstitial without myocyte degeneration or necrosis, interstitial with myocyte degeneration or necrosis (or both), or myocytic with degeneration or necrosis (or both) of the myocardial fiber.
Immunohistochemical analysis—The remaining 12 sections were mounted on poly-l-lysine–coated slides and processed for immunohistochemical analysis by use of the standard avidin-biotin-peroxidase complex method. Sections were deparaffinized, treated with 0.3% hydrogen peroxide for 30 minutes, and heated in retrieval solution (citrate buffer solution, pH 6.0) in a microwave oven (3 passages of 5 minutes each at 650 W). Sections were then washed with PBS solution, incubated for 60 minutes with the primary antibody (polyclonal rabbit anti-human CD3 antibody [1:50 dilution] or monoclonal mouse anti-human CD79 antibody [clone JCB117; 1:25 dilution] to detect T and B lymphocytes, respectively), and rewashed with PBS solution. Biotin-labeled (anti-rabbit or anti-mouse) immunoglobulin G was applied at a 1:50 dilution, and slides were incubated for 30 minutes; a streptavidinbiotin-peroxidase conjugate was then applied.b The chromogen was 3,3'-diaminobenzidine tetrahydrochloride. Sections were counterstained with Mayer hematoxylin stain. Lymph node tissue samples from separate healthy dogs were used as positive control samples.
Morphometric analysis—Following histologic examination, sections stained with Masson trichrome stain were evaluated to quantify the extent of fibrosis (calculated as a percentage of the surface area), and sections stained with H&E stain were evaluated to quantify the extent of lymphocytic inflammation (calculated as the number of lymphocytes per mm2). Commercial photo-editing softwarec was used. The surface area of the sections was calculated by applying the “count-size” function of the software, with a size marker used for calibration.
To quantify the extent of fibrosis, sections were photographed at a magnification of 2,500X and the count-size function of the software was successively applied, with chromatic differences used to differentiate fibrous tissue (blue stain) from the myocardium (red stain). To quantify the extent of lymphocytic inflammation, sections were photographed at a magnification of 200X and the number of lymphocytes in the section was manually counted. Finally, the number of lymphocytes was divided by surface area of the section.
Detection of viral, protozoal, and bacterial nucleic acids by PCR assay
At least 1 EMB sample from each of the 47 dogs underwent analysis by PCR assay, reverse transcriptase PCR assay, and real-time PCR assay (ad hoc optimized) for detection of nucleic acid from canine coronavirus, canine herpesvirus 1, canine distemper virus, canine adenovirus 1, canine adenovirus 2, canine parvovirus 2, West Nile virus, and Bartonella spp (Appendix). Additionally, EMB samples from 9 of 47 dogs were also screened by use of PCR assay for nucleic acid from B burgdorferi, Toxoplasma gondii, and Leishmania infantum.
All EMB samples were stored in RNA stabilization solution until processed. To extract nucleic acids, a tissue homogenizerd was used to disrupt EMB samples, and DNA and RNA were then extracted with guanidinium thiocyanate,e according to the manufacturer's instructions. The procedure for nucleic acid extraction was optimized for small tissue samples. Extracted nucleic acids were quantified and checked for quality by use of spectrophotometryf and stored at −80°C until analyzed with a PCR assay. The glyceraldehyde-3-phosphate dehydrogenase gene for DNA and ATPase subunit-α transcripts for RNA were amplified to verify the absence of PCR assay inhibitors and to serve as internal controls for nucleic acid extraction.20,21 Two microliters (100 ng/μL) of extracted DNA and 2.5 μL (100 ng/μL) of extracted RNA were added to the master mix.
Commercially available kits were used to amplify DNAg and RNAh in processed EMB samples according to the manufacturers’ instructions. The reaction conditions for DNA amplification included denaturation at 95°C for 5 minutes; 45 cycles at 95°C for 15 seconds, 53° to 56°C for 30 seconds, and 72°C for 30 seconds; and a final extension at 72°C for 7 minutes.i The reaction conditions for RNA amplification included reverse transcription at 45°C for 20 minutes; denaturation at 95°C for 1 minute; 45 cycles at 95°C for 10 seconds, 52° to 57°C for 30 seconds, and 72°C for 30 seconds; and a final extension at 72°C for 10 minutes.
For detection of West Nile virus nucleic acid, a commercially available kitj was used according to the manufacturer's instructions for RNA amplification. The reaction conditions included reverse transcription at 50°C for 30 minutes, denaturation at 95°C for 5 minutes, and 50 cycles at 95°C for 10 seconds and 60°C for 30 seconds. Postamplification melting temperature analysis was conducted at 50° to 95°C (in 0.5°C increments) to quantify the NS5 product; the manufacturer's detection software was used to determine the threshold cycle value, primer melting temperature, and standard curve.i
Each amplified gene was expressed in a cloning vector.k A standard curve was generated for each amplified gene with known copy numbers and used to evaluate the sensitivity of each PCR assay. To confirm the specificity of PCR products, amplicons were purified and externally sequenced.l The positive control samples for the PCR assay were genomic DNA or RNA extracted from bacterial, viral, parasitic, and protozoal field strains, and the negative control samples were from healthy animals.
Statistical analysis
On the basis of results of previous studies22,23 involving humans, we expected the prevalence of cardiotropic pathogens to be 67% to 76% in dogs with UMRD and 0% in dogs with CHD. A sample size was calculated to achieve 90% power to detect a difference of 67% in the prevalence of selected pathogens between dogs in the UMRD and CHD groups at a significance level of 5%. The following formula was used for calculation of the required sample size:
where 1.28 is the 1-sided percentage point of the normal distribution corresponding to 100% – power (as a percentage), 1.96 is the percentage point of the normal distribution corresponding to the 2-sided significance level, p1 is the prevalence in the UMRD group, p0 is the prevalence in the CHD group, and p’ is the mean prevalence or (p1+ p0)/2.
An adjustment for unequal sample sizes was performed, assuming a ratio of dogs with CHD to dogs with UMRD of 1:4.24 The sample size calculation accounted for a potential 10% dropout rate. The resulting minimum sample size was calculated to be 22.3 (rounded to 23) dogs with UMRD and 5.6 (rounded to 6) dogs with CHD.
Distributions of age and body weight data were evaluated by means of a Shapiro-Wilk test, and summary statistics were calculated. Differences between dogs with UMRD and dogs with CHD regarding sex, age, and body weight were assessed with a Fisher exact test (for categorical variables) or Student t test or Mann-Whitney U test (for normally and nonnormally distributed continuous variables, respectively).
Logistic regression was performed to identify factors associated with the outcome (ie, detection of nucleic acid from ≥ 1 cardiotropic pathogen by PCR assay). First, univariate logistic regression models were used to evaluate candidate variables (ie, age, sex, body weight, and type of cardiac disorder [UMRD vs CHD]) for potential inclusion in the multivariate model.25 Variables with a value of P < 0.1 were included in the multivariate regression model.22 Odds ratios and 95% CIs were reported to describe the strength of the association between the predictor and outcome variables. Nagelkerke R2 values were calculated to determine the proportion of variability in the outcome explained by the model. No subgroup analyses were performed because of the limited sample size.
All analyses were performed with commercially available software.m Two-sided values of P < 0.05 were considered significant.
Results
Animals
Forty-seven dogs (37 with UMRD and 10 control dogs with CHD) were enrolled in the study. Diagnoses for the 37 dogs with UMRD were DCM (n = 25), AVB (6), nonfamilial ventricular arrythmias (4), and supraventricular arrythmias (2); diagnoses for the 10 dogs with CHD were pulmonic stenosis (9) and congenital right-sided accessory pathway (1). There were 30 males (5 in the CHD group) and 17 females (5 in the CHD group); 42 dogs were sexually intact (8 in the CHD group), and 5 were neutered (2 in the CHD group). The 47 dogs consisted of 5 mixed-breed dogs and 6 Labrador Retrievers, 5 Dogues de Bordeaux, 5 Boxers, and 26 dogs representing other breeds. Median age and body weight for dogs with UMRD were 4.0 years (range, 0.5 to 11.0 years) and 32.0 kg (70.4 lb; 11.7 to 64.0 kg [25.7 to 140.8 lb]). Median age and body weight for dogs with CHD were 2.5 years (range, 0.7 to 6.0 years) and 29.7 kg (65.3 lb; 15.0 to 51.0 kg [33.0 to 112.2 lb]). Dogs with CHD and dogs with UMRD did not differ significantly with respect to sex, body weight, or age.
The 37 dogs with UMRD had a history of heart failure (n = 14), transient loss of consciousness (12), acute weakness attributable to incessant supraventricular tachycardia (2) or ventricular arrhythmias (2), periodic episodes of weakness (4), and cardiogenic shock (3). The 9 dogs with pulmonic stenosis had all been referred for valvuloplasty; no arrhythmias were documented on ECG examination. The dog with a congenital right-sided accessory pathway had episodic weakness and was referred for radiofrequency ablation. All dogs were current on vaccinations.26 For dogs with UMRD, the recent history included signs of gastrointestinal disease in 7 and signs of respiratory disease in 3.
ECG and echocardiographic findings
Results of ECG performed at the time of admission included normal sinus rhythm (n = 13), persistent atrial fibrillation (11), monomorphic ventricular tachycardia (8), third-degree AVB (6), ventricular arrhythmias (5), focal atrial tachycardia (2), nonsustained orthodromic atrioventricular reciprocating tachycardia (1), and typical atrial flutter (1). Echocardiographic findings for dogs included various degrees of DCM (n = 30), severe pulmonic stenosis (9), mild pericardial effusion without cardiac tamponade (2), and presumptive arrhythmogenic cardiomyopathy (2 Boxers with ventricular arrhythmia); 4 dogs had no notable echocardiographic findings. Ventricular arrhythmia was diagnosed in both dogs with pericardial effusion because of persistent monomorphic ventricular tachycardia requiring antiarrhythmic treatment.
EMB samples
A total of 197 EMB samples were collected (172 from the dogs with UMRD and 25 from the dogs with CHD). Of these, 113 samples were evaluated histologically (102 from the dogs with UMRD and 11 from the dogs with CHD) and 84 samples were analyzed by means of PCR assays (70 from the dogs with UMRD and 14 from the dogs with CHD). All 47 dogs had at least 1 EMB sample submitted for histologic evaluation (mean ± SD, 2.4 ± 1.2 samples; range, 1 to 7 samples) and at least 1 sample submitted for testing with the PCR assays (1.8 ± 0.7 samples; range, 1 to 3 samples). The 113 EMB samples used for histologic evaluation were collected from the RV apex (n = 76), interventricular septum (34), and RV free wall (3); samples were obtained from 1, 2, or all 3 of these sites for 21 dogs, 25 dogs, and 1 dog, respectively. The 84 samples used for PCR assay were collected from the RV apex (n = 46), interventricular septum (36), and RV free wall (2); samples were obtained from 1 or 2 of these sites for 23 and 24 dogs, respectively.
PCR assay
Nucleic acid from at least 1 pathogen was detected in EMB samples from 21 of the 37 (57%; 95% CI, 41% to 71%) dogs with UMRD, but nucleic acid from cardiotropic pathogens was detected in EMB samples from only 1 of the 10 (10%; 95% CI, 2% to 40%) dogs with CHD. On univariate logistic regression, dogs with UMRD were significantly (OR, 11.8; 95% CI, 1.3 to 103.0) more likely than dogs with CHD to be positive for the outcome (ie, detection of nucleic acid from ≥ 1 cardiotropic pathogen by PCR assay); no other predictors were associated with the outcome (Table 1). In the final multivariate regression model, which included age and type of cardiac disorder (CHD vs UMRD), only cardiac disorder type was significantly (P = 0.046) associated with the outcome. Dogs with UMRD were 9.4 times as likely to have nucleic acid from ≥ 1 cardiotropic pathogen as were dogs with CHD (OR, 9.4; 95% CI, 1.04 to 84.3). The multivariate model explained 24% of the variability in the outcome (Nagelkerke R2, 0.24).
Results of univariate logistic regression for dogs with UMRD (n = 37) or CHD (10) for which EMB samples were examined by use of PCR assays to detect nucleic acid from 12 cardiotropic pathogens.
| Variable | Dogs with positive results (n = 22) | Dogs with negative results (n = 25) | OR (95% CI) | P value |
|---|---|---|---|---|
| Disease type | ||||
| UMRD | 21 (57) | 16 (43) | 11.8 (1.3–103.0) | 0.02 |
| CHD | 1 (10) | 9 (90) | Referent | NA |
| Age (y) | 5.4 (3.4) | 3.7 (2.6) | 1.2 (0.9–1.5) | 0.07 |
| Body weight (kg) | 36.6 (15.5) | 31.5 (10.7) | 1.0 (0.9–1.1) | 0.19 |
| Sex | ||||
| Male | 15 (50) | 15 (50) | 1.4 (0.4–4.7) | 0.56 |
| Female | 7 (41) | 10 (59) | Referent | NA |
Values are reported as mean (SD) for continuous data and as number of dogs (%) for categorical data. The OR represents the likelihood of a positive result (ie, detection of nucleic acid from ≥ 1 cardiotropic pathogen) in dogs with UMRD versus CHD or in male dogs versus female dogs or the increase in the likelihood of a positive result for each 1-year increase in age or 1-kg increase in body weight.
NA = Not applicable.
For the 21 dogs with UMRD in which nucleic acid from cardiotropic pathogens was detected by PCR assay, 14 were positive for RNA viruses, 8 were positive for DNA viruses, 4 were positive for bacteria (Bartonella spp), and 1 was positive for a protozoan (L infantum). Fifteen dogs had nucleic acid from a single pathogen detected (canine distemper virus [n = 8], canine herpesvirus 1 [2], canine coronavirus [2], canine parvovirus 2 [1], canine adenovirus 1 [1], and Bartonella spp [1]), and the remaining 6 dogs had nucleic acid from > 1 pathogen detected (canine adenovirus 1, canine parvovirus 2, and canine enteric coronavirus [1]; canine parvovirus 2 and canine distemper virus [1]; canine adenovirus 2 and Bartonella spp [1]; canine parvovirus 2 and Bartonella spp [1]; canine coronavirus and Bartonella spp [1]; and canine coronavirus and L infantum [1]). Details of the combined histologic findings and PCR assay results were summarized (Supplementary Appendix S1, available at avmajournals.avma.org/doi/suppl/10.2460/javma.255.10.1150). The single dog that had CHD and positive PCR assay results had nucleic acid from canine coronavirus detected.
Blood samples were available from 18 of the 21 dogs with positive PCR assay results for EMB samples; all 18 blood samples were negative for nucleic acid from cardiotropic pathogens. Accordingly, the sensitivity of using PCR assays to detect nucleic acid from cardiotropic pathogens in blood samples from these dogs was 0% (95% CI, 0% to 19%).
Histologic findings
Fifteen of 47 (32%) dogs had histologic evidence of endocardial hemorrhage and focal neutrophilic infiltration, and 3 of the 15 also had very early endocardial thrombus formation, likely caused by the EMB procedure (Figure 2).
Photomicrograph of an EMB sample from a dog. Notice the large area of aggregated RBCs and visible fragmentation of the myocardial fibers that most likely resulted from trauma associated with the biopsy procedure. H&E stain; bar = 50 μm.
Citation: Journal of the American Veterinary Medical Association 255, 10; 10.2460/javma.255.10.1150
Photomicrograph of an EMB sample from a dog. Notice the large area of aggregated RBCs and visible fragmentation of the myocardial fibers that most likely resulted from trauma associated with the biopsy procedure. H&E stain; bar = 50 μm.
Citation: Journal of the American Veterinary Medical Association 255, 10; 10.2460/javma.255.10.1150
Photomicrograph of an EMB sample from a dog. Notice the large area of aggregated RBCs and visible fragmentation of the myocardial fibers that most likely resulted from trauma associated with the biopsy procedure. H&E stain; bar = 50 μm.
Citation: Journal of the American Veterinary Medical Association 255, 10; 10.2460/javma.255.10.1150
Of the 37 dogs with UMRD, 19 (51%) had histologic evidence of CIMD16 (Supplementary Appendix S1), including 9 dogs that had inflammatory infiltrates and 1 that was suspected to have arrhythmogenic cardiomyopathy. Seven of the 37 dogs had histologic changes classified as nonspecific cardiomyopathy, of which 1 was suspected to have arrhythmogenic cardiomyopathy. Finally, 5 of the 37 dogs had histologic signs of acute or subacute myocarditis (Figure 3), 3 did not have any notable histologic findings, 2 had histologic findings classified as borderline myocarditis, and 1 had histologic evidence of chronic myocarditis (Figure 4). On the basis of immunohistochemical analysis, only 1 dog with histologic evidence of CIMD and inflammatory infiltrates had EMB samples that were positive for CD3 (T lymphocytes).
Photomicrograph of an EMB sample from a dog. Notice the focal, moderate mononuclear infiltration of myocardial tissue and lysis of myocardial fibers suggestive of acute myocarditis. H&E stain; bar = 25 μm.
Citation: Journal of the American Veterinary Medical Association 255, 10; 10.2460/javma.255.10.1150
Photomicrograph of an EMB sample from a dog. Notice the focal, moderate mononuclear infiltration of myocardial tissue and lysis of myocardial fibers suggestive of acute myocarditis. H&E stain; bar = 25 μm.
Citation: Journal of the American Veterinary Medical Association 255, 10; 10.2460/javma.255.10.1150
Photomicrograph of an EMB sample from a dog. Notice the focal, moderate mononuclear infiltration of myocardial tissue and lysis of myocardial fibers suggestive of acute myocarditis. H&E stain; bar = 25 μm.
Citation: Journal of the American Veterinary Medical Association 255, 10; 10.2460/javma.255.10.1150
Photomicrographs of EMB samples from a dog. A—Notice the focal, mild interstitial mononuclear infiltration of myocardial tissue (oval) associated with fibrosis (arrows). H&E stain; bar = 30 μm. B—A higher-magnification view of the mononuclear infiltration associated with fibrosis. H&E stain; bar = 25 μm.
Citation: Journal of the American Veterinary Medical Association 255, 10; 10.2460/javma.255.10.1150
Photomicrographs of EMB samples from a dog. A—Notice the focal, mild interstitial mononuclear infiltration of myocardial tissue (oval) associated with fibrosis (arrows). H&E stain; bar = 30 μm. B—A higher-magnification view of the mononuclear infiltration associated with fibrosis. H&E stain; bar = 25 μm.
Citation: Journal of the American Veterinary Medical Association 255, 10; 10.2460/javma.255.10.1150
Photomicrographs of EMB samples from a dog. A—Notice the focal, mild interstitial mononuclear infiltration of myocardial tissue (oval) associated with fibrosis (arrows). H&E stain; bar = 30 μm. B—A higher-magnification view of the mononuclear infiltration associated with fibrosis. H&E stain; bar = 25 μm.
Citation: Journal of the American Veterinary Medical Association 255, 10; 10.2460/javma.255.10.1150
Fibrosis was identified in 21 dogs with UMRD and was described as interstitial in 7 dogs (Figure 5), replacement fibrosis in 5 dogs (Figure 6), and endocardial in 6 dogs; there was a combination of interstitial and replacement fibrosis in 2 dogs and a combination of endocardial and replacement fibrosis in 1 dog. Interstitial fibrosis was identified in 6 dogs with CIMD, 2 dogs with acute myocarditis, and 1 dog with cardiomyopathy. Replacement fibrosis was found in 3 dogs with CIMD, 2 dogs with cardiomyopathy, 1 dog with chronic myocarditis, and 1 dog with primary AVB. Endocardial fibrosis was found in 3 dogs with cardiomyopathy, 2 dogs with CIMD, 1 dog with acute myocarditis, and 1 dog with primary AVB. For all 47 dogs, the extent of fibrosis as a percentage of the sample area ranged from 6% to 95%.
Photomicrograph of an EMB sample from a dog. Notice the diffuse, moderate interstitial fibrosis of myocardial tissue caused by deposition of connective tissue. Masson trichrome stain; bar = 30 μm.
Citation: Journal of the American Veterinary Medical Association 255, 10; 10.2460/javma.255.10.1150
Photomicrograph of an EMB sample from a dog. Notice the diffuse, moderate interstitial fibrosis of myocardial tissue caused by deposition of connective tissue. Masson trichrome stain; bar = 30 μm.
Citation: Journal of the American Veterinary Medical Association 255, 10; 10.2460/javma.255.10.1150
Photomicrograph of an EMB sample from a dog. Notice the diffuse, moderate interstitial fibrosis of myocardial tissue caused by deposition of connective tissue. Masson trichrome stain; bar = 30 μm.
Citation: Journal of the American Veterinary Medical Association 255, 10; 10.2460/javma.255.10.1150
Photomicrograph of an EMB sample from a dog. Notice the large area of replacement fibrosis in myocardial tissue. Masson trichrome stain; bar = 50 μm.
Citation: Journal of the American Veterinary Medical Association 255, 10; 10.2460/javma.255.10.1150
Photomicrograph of an EMB sample from a dog. Notice the large area of replacement fibrosis in myocardial tissue. Masson trichrome stain; bar = 50 μm.
Citation: Journal of the American Veterinary Medical Association 255, 10; 10.2460/javma.255.10.1150
Photomicrograph of an EMB sample from a dog. Notice the large area of replacement fibrosis in myocardial tissue. Masson trichrome stain; bar = 50 μm.
Citation: Journal of the American Veterinary Medical Association 255, 10; 10.2460/javma.255.10.1150
Biopsy samples from the 9 dogs with pulmonic stenosis (CHD group) had various degrees of hypertrophy and fibrosis. The sample from the dog with a congenital right-sided accessory pathway and arrhythmia-induced cardiomyopathy had minimal lymphocytic inflammation.
Adverse events
Three of the 47 (6%) dogs had complications associated with the EMB procedure. A major complication occurred in 1 dog (perforation of the RV wall and self-limiting intrapericardial hemorrhage without cardiac tamponade) and minor complications occurred in 2 dogs (self-limiting polymorphic ventricular tachycardia during the procedure). The arrhythmias rapidly resolved without requiring antiarrhythmic treatment or discontinuation of the procedure.
Discussion
Results of the present study suggested that nucleic acid from cardiotropic pathogens can be detected in myocardial tissue from a relatively high percentage of dogs with UMRD, with 21 of 37 (57%; 95% CI, 41% to 71%) dogs in the present study having nucleic acid from at least 1 pathogen detected, compared with only 1 of 10 (10%; 95% CI, 2% to 40%) dogs with CHD. Although detection of nucleic acid within the myocardium does not prove that these pathogens were the underlying cause of the cardiac disease in the dogs of the present study, our findings underscore the need for future studies to explore the role of infectious myocarditis in the development of certain myocardial diseases.
The percentage of dogs with UMRD in the present study in which nucleic acid from cardiotropic pathogens was detected (57%) was similar to what has previously been reported22 for humans with UMRD (67%). Among the 15 dogs in the present study in which nucleic acid from a single pathogen was detected, 14 were positive for viruses and 1 was positive for bacteria, suggesting that the prevalence of bacterial myocarditis may be higher in dogs than in humans with myocarditis.1,6 Also, 6 of 21 (29%) dogs with UMRD in the present study had nucleic acid from ≥ 1 cardiotropic pathogen, which was similar to the reported percentage of human patients with multiple pathogens (27%).22 Three of 6 dogs in the present study with multiple pathogens detected were positive for viruses and bacteria, 2 were positive for multiple viruses, and 1 was positive for a virus and a protozoan. Bartonella spp was detected in 3 of 6 dogs with multiple pathogens detected; however, it was difficult to determine which, if any, pathogen played a key role in the disease process. Previous studies8,27 have found evidence of Bartonella infection in dogs with endocarditis and myocarditis.
For the 10 dogs of the present study with CHD, the negative immunohistochemical results and the absence of inflammatory infiltrates and negative PCR assay results for most (9/10) dogs suggested a possible link between cardiac disease and the detected pathogens for dogs with UMRD. Furthermore, the positive PCR assay results associated with mild inflammatory infiltrates in 1 dog with CHD were consistent with an association between histologic evidence of myocarditis and viral persistence.
Nine of 19 dogs with CIMD in the present study had inflammatory infiltrates, and in all 9 of these dogs, the infiltrates were characterized as lymphoplasmacytic; none of the 19 dogs with CIMD had extensive neutrophilic infiltrates, in contrast to expected findings for bacterial myocarditis. Endocardial hemorrhage with focal neutrophilic infiltration and very early thrombus formation were found in biopsy samples from 15 of the 47 (32%) dogs. We attributed these findings to direct trauma associated with the biopsy procedure. Indeed, a previous study28 showed an increase in serum concentration of cardiac troponin T, a marker of myocardial damage, in people 10 minutes after undergoing EMB.
In the dogs of the present study, interstitial and replacement fibrosis appeared to be more frequently associated with a diagnosis of CIMD and positive PCR assay results, whereas endocardial fibrosis was found in dogs with UMRD and negative PCR assay results and in dogs with CIMD; however, the small sample size prevented us from evaluating these associations statistically. Similarly, myocardial fibrosis has been documented in young dogs in which canine parvovirus 2 has been identified,11 and Bartonella infection has been suggested as a possible cause of endomyocarditis in cats.29 Moreover, a viral etiology was hypothesized in a recent case series30 of cats with restrictive cardiomyopathy, even though no testing was done to detect viral nucleic acid in postmortem samples from cats with endomyocardial fibrosis. In the present study, only 1 dog with inflammatory infiltrates was positive for CD3 by immunohistochemical analysis, despite our expectation that most dogs with CIMD would have infiltrations of leukocytes. This finding may have resulted from focal infiltration of leukocytes that were absent from the sections used for immunohistochemical analysis.
Dogs with DCM made up the largest proportion of dogs in the present study (25/47 [53%]). In human patients with biopsy-proven viral myocarditis (ie, by histologic confirmation and PCR assay of biopsy samples), decreasing left ventricular function is associated with persistent detection of viral nucleic acid in the myocardium by PCR assay.14 Conversely, in a large cohort of human patients with various types of viral infections, spontaneous viral clearance is associated with hemodynamic improvement.3 However, in humans, autoimmune processes persist independently of viral nucleic acid detection in myocardial samples and can lead to chronic DCM.15,16 This is similar to the situation in dogs with Chagas disease (caused by Trypanosoma cruzi), in which severe, acute myocardial involvement, even with a low number of intracellular parasites, is caused by the immunologic response.31 Infectious myocarditis secondary to viral or bacterial persistence was reported in 13 of 25 (52%) dogs with DCM in the present study. Canine distemper virus was the most commonly detected virus in dogs with CIMD (5/19 [26%]). A smaller number of dogs with DCM had histologic evidence of cardiomyopathy, negative PCR assay results, interstitial and replacement fibrosis, fatty degeneration, and hypertrophy of cardiomyocytes. Familial cardiomyopathy, cardiomyopathy secondary to viral pathogens for which we did not test or that were cleared following infection, and tachycardia-induced cardiomyopathy were the most probable differential diagnoses for these dogs.
Three of the 6 dogs with AVB in the present study were classified as having primary rhythm disturbances.32 This contrasted with findings for human patients, in whom acute myocarditis with transitory myocardial interstitial edema is the most common cause of transient AVB.1 This difference could be attributable to our inclusion mainly of dogs with a chronic form of AVB or to the underdiagnosis of acute myocarditis as a cause of paroxysmal AVB in veterinary medicine. It has been previously shown that 13% of dogs with high-grade AVB have complete or partial regression of the conduction disturbance within 1 month following pacemaker implantation, suggesting acute myocarditis as the cause of transient AVB. Interestingly, canine coronavirus was the most commonly detected pathogen in dogs with AVB in the present study. A study33 of rabbits showed myocardial conduction disturbances following experimental infection with rabbit coronavirus. In the present study, L infantum was detected in 1 of 6 dogs with AVB. Severe lymphoplasmacytic myocarditis and detection of L infantum by real-time PCR assay in dogs with leishmaniasis and renal azotemia have been reported.9 Sousa et al34 reported that sinus arrest, right bundle branch block, and atrial premature beats are the most common ECG findings in dogs with visceral leishmaniasis, but the prevalence of AVB secondary to myocarditis caused by L infantum is not known.
Ventricular premature complexes and ventricular tachycardia are nonspecific arrhythmias that have been described with myocarditis, myocardial infarction and ischemia, sepsis, anemia, and metabolic disturbances.35 In the present study, 3 of 4 dogs with ventricular tachycardia had histologic evidence of CIMD and multiple pathogens detected by PCR assay. A Boxer with canine coronavirus detected by PCR assay also had histologic evidence of arrhythmogenic cardiomyopathy, which could have been the primary cause of the ventricular arrhythmia. In humans, although the pathogenesis of arrhythmogenic cardiomyopathy is unclear, it is hypothesized that an infectious component contributes to the onset and progression of the disease because of the frequent finding of myocarditis on histologic examination.36
The 2 dogs of the present study with supraventricular tachycardia had canine distemper virus detected by PCR assay and histologic evidence of inflammation. Inflammation of atrial myocardium is recognized as a common cause of atrial tachycardia and permanent and paroxysmal lone atrial fibrillation in humans, although it is unknown whether atrial immunoreactivity is a primary phenomenon or is induced by a viral or a toxic agent.37 A recent study38 that analyzed inflammatory cell numbers in the atria of human patients with myocarditis but without symptomatic atrial fibrillation found that atrial myocarditis occurred concurrently with ventricular myocarditis in patients with myocarditis of various causes, suggesting that myocarditis patients may be predisposed to the development of supraventricular tachycardia and subsequent complications, such as sudden cardiac death and heart failure. The findings of this previous study38 could explain the relatively high prevalence of atrial fibrillation (14%) in human patients with suspected myocarditis.39
To exclude the possibility of a systemic infectious process and confirm that the positive PCR assay results did not result from peripheral blood contamination, we used the PCR assays to test blood samples from 18 of 21 dogs with positive myocardial PCR assay results; no evidence of viral, bacterial, or protozoal pathogens was detected. This finding supported our conclusion that detection of nucleic acid from cardiotropic pathogens in the myocardium did not result from blood contamination.
Although the present study provided insight into a possible association between unexplained cardiac disorders and various pathogens reported to cause myocarditis in dogs, it had several limitations. The relatively small number of dogs included in the study and the heterogeneity among the included dogs were important limitations given the wide spectrum of diseases potentially associated with myocardial and arrhythmic disorders.
We used PCR assays to detect selected cardiotropic pathogens, but it is possible that we excluded other pathogens that might have been involved in the disease process. It could be informative to apply next-generation sequencing technology to these biopsy samples, as it would allow the detection of nucleic acid from all pathogens in a sample, even those not included in the present study.
For ethical reasons, the number of biopsy samples collected was lower for dogs with CHD than for dogs with UMRD in the present study. This could have been a potential source of bias owing to the resultant higher chance of detecting viral, bacterial, or protozoal pathogens in dogs with UMRD. However, among dogs with UMRD from which only 1 biopsy sample was collected, 5 of 11 had positive PCR assay results, which was similar to the proportion of positive results among dogs from which 2 or 3 biopsy samples were collected (13/19 and 3/7, respectively). Therefore, it seems unlikely that differences in the numbers of samples collected from each group of dogs impacted the results of our study. To further reduce this potential source of bias and to normalize the comparison between samples, we used the same amount of DNA or RNA to perform each PCR assay. Furthermore, the 1 biopsy sample from a dog with CHD and nucleic acid from canine coronavirus detected by PCR assay had evidence of possible myocarditis (ie, lymphocytic infiltration).
Another limitation of the present study was the age of the dogs. Univariate logistic regression revealed no association between age and positive PCR assay results. Although the difference in age between dogs with UMRD and those with CHD (median, 4.0 and 2.5 years, respectively) was not significant, it may have been clinically meaningful. Age could represent a confounder, with a greater opportunity for older dogs to be exposed to pathogens over their lifetime. However, when included in the multivariate logistic regression model, age was not significantly associated with positive PCR assay results. Furthermore, from a pathophysiologic perspective, the pathogens we included in our study typically affect younger dogs.11 Therefore, we believe that this association was spurious and driven by the difference in age between the dogs in the UMRD and CHD groups.
Finally, the EMB technique used in the present study restricted sample collection to the right ventricle, which could have reduced our ability to detect infections limited to the left ventricle.1 For future studies, a biventricular biopsy approach would be preferable for dogs with suspected focal myocardial disorders. The biopsy technique used in the present study appeared feasible and had a complication rate similar to those previously reported18,40 for dogs and humans.
In conclusion, we used EMB samples to show a significantly higher prevalence of nucleic acids from selected cardiotropic pathogens in dogs with UMRD than in dogs with CHD, indicating a possible association between these pathogens and development of certain cardiac diseases (eg, canine distemper virus in dogs with DCM and canine coronavirus in dogs with AVB). Further studies are needed to confirm these findings, and long-term follow-up of dogs with UMRD is necessary to determine whether clinical improvement occurs when treatment is guided by results of testing of EMB samples.
Acknowledgments
No external funding was used in this study. The authors declare that there were no conflicts of interest.
Presented in abstract form at the Annual Congress of the European College of Veterinary Internal Medicine for Companion Animals, Lisbon, September 2015.
The authors thank Drs. Romain Pariaut, Flavia Giacomazzi, and Eva Oxford for reviewing the manuscript prior to submission.
ABBREVIATIONS
| AVB | Atrioventricular block |
| CHD | Congenital heart disease |
| CI | Confidence interval |
| CIMD | Chronic infectious myocardial disease |
| DCM | Dilated cardiomyopathy |
| EMB | Endomyocardial biopsy |
| RV | Right ventricular |
| UMRD | Unexplained myocardial and rhythm disorders |
Footnotes
SNAP 4Dx Plus, Idexx Europe, Hoofddorp, Netherlands.
LSAB+, Dako REAL detection systems, Agilent Technologies Inc, Santa Clara, Calif.
Image-Pro Plus, Media Cybernetics Inc, Rockville, Md.
TissueLyser II, Qiagen, Hilden, Germany.
TRIzol reagent, Thermo Fisher Scientific, Waltham, Mass.
NanoDrop 2000, Thermo Fisher Scientific, Waltham, Mass.
MyTaq PCR kit, Bioline, London, England.
MyTaq One-Step RT-PCR kit, Bioline, London, England.
Applied Biosystems 7300 Real Time PCR System, Thermo Fisher Scientific, Waltham, Mass.
Precision PLUS OneStep RT-qPCR master mix, Primerdesign Ltd, Camberley, England.
pCR-XL-TOPO cloning vector, Thermo Fisher Scientific, Milano, Italy.
BMR Genomics Srl, Padova, Italy.
SPSS Statistics, version 20.0, IBM Corp, Armonk, NY.
References
1. Caforio ALP, Pankuweit S, Arbustini E, et al. Current state of knowledge on aetiology, diagnosis, management, and therapy of myocarditis: a position statement of the European Society of Cardiology Working Group on Myocardial and Pericardial Diseases. Eur Heart J 2013;34:2636–2648.
2. Cooper LT, Baughman KL, Feldman AM, et al. The role of endomyocardial biopsy in the management of cardiovascular disease: a scientific statement from the American Heart Association, the American College of Cardiology, and the European Society of Cardiology. Circulation 2007;116:2216–2233.
3. Kühl U, Pauschinger M, Seeberg B, et al. Viral persistence in the myocardium is associated with progressive cardiac dysfunction. Circulation 2005;112:1965–1970.
4. Maxson TR, Meurs KM, Lehmkuhl LB, et al. Polymerase chain reaction analysis for viruses in paraffin-embedded myocardium from dogs with dilated cardiomyopathy or myocarditis. Am J Vet Res 2001;62:130–135.
5. Kaneshige T, Mda N, Nakao S, et al. Complete atrioventricular block associated with lymphocytic myocarditis of the atrioventricular node in two young adult dogs. J Comp Pathol 2007;137:146–150.
6. Janus I, Noszczyk-Nowak A, Nowak M, et al. Myocarditis in dogs: etiology, clinical and histopathological features (11 cases: 2007–2013). Ir Vet J 2014;67:28–35.
7. Costagliola A, Piegari G, Otrocka-Domagala I, et al. Immunopathological features of canine myocarditis associated with Leishmania infantum infection. Biomed Res Int 2016;2016: 8016186.
8. Santilli RA, Battaia S, Perego M, et al. Bartonella-associated inflammatory cardiomyopathy in a dog. J Vet Cardiol 2017;19:74–81.
9. Martínez-Hernández L, Casamian-Sorrosal D, Barrera-Chacón R, et al. Comparison of myocardial damage among dogs at different stages of clinical leishmaniasis and dogs with idiopathic chronic kidney disease. Vet J 2017;221:1–5.
10. Santilli RA, Perego M, Tursi M, et al. Role of right endomyocardial biopsy to characterize unexplained myocardial and rhythm disorders in the dog. J Vet Intern Med 2016;30:369–370.
11. Ford J, McEndaffer L, Renshaw R, et al. Parvovirus infection is associated with myocarditis and myocardial fibrosis in young dogs. Vet Pathol 2017;54:964–971.
12. Ponikowski P, Voors AA, Anker SD, et al. 2016 ESC Guidelines for the diagnosis and treatment of acute and chronic heart failure: the Task Force for the diagnosis and treatment of acute and chronic heart failure of the European Society of Cardiology (ESC). Developed with the special contribution of the Heart Failure Association (HFA) of the ESC. Eur J Heart Fail 2016;18:891–975.
13. Ardehali H, Qasim A, Cappola T, et al. Endomyocardial biopsy plays a role in diagnosing patients with unexplained cardiomyopathy. Am Heart J 2004;147:919–923.
14. Caforio ALP, Calabrese F, Angelini A, et al. A prospective study of biopsy-proven myocarditis: prognostic relevance of clinical and aetiopathogenetic features at diagnosis. Eur Heart J 2007;28:1326–1333.
15. Kindermann I, Barth C, Mahfoud F, et al. Update on myocarditis. J Am Coll Cardiol 2012;59:779–792.
16. Schultheiss HP, Kühl U. Overview on chronic viral cardiomyopathy/chronic myocarditis. Ernst Schering Res Found Workshop 2006;55:3–18.
17. McEntee K, Flandre T, Dessy C, et al. Metabolic and structural abnormalities in dogs with early left ventricular dysfunction induced by incessant tachycardia. Am J Vet Res 2001;62:889–894.
18. Keene BW, Kittleson ME, Atkins CE, et al. Modified transvenous endomyocardial biopsy technique in dogs. Am J Vet Res 1990;51:1769–1772.
19. Aretz HT, Billingham ME, Edwards WD, et al. Myocarditis. A histopathologic definition and classification. Am J Cardiovasc Pathol 1987;1:3–14.
20. Homan WL, Limper L, Verlaan M, et al. Comparison of the internal transcribed spacer, ITS 1, from Toxoplasma gondii isolates and Neospora caninum. Parasitol Res 1997;83:285–289.
21. Woodall CJ, Maclaren LJ, Watt NJ. Differential levels of mRNAs for cytokines, the interleukin-2 receptor and class II DR/DQ genes in ovine interstitial pneumonia induced by maedi visna virus infection. Vet Pathol 1997;34:204–211.
22. Kühl U, Pauschinger M, Noutsias M, et al. High prevalence of viral genomes and multiple viral infections in the myocardium of adults with “idiopathic” left ventricular dysfunction. Circulation 2005;111:887–893.
23. Nowalany-Kozielska E, Kozieł M, Domal-Kwiatkowska D, et al. Clinical significance of viral genome persistence in the myocardium of patients with dilated cardiomyopathy. Intervirology 2015;58:350–356.
24. Kirkewood BR, Sterne JA. Essential medical statistics. 2nd ed. Hoboken, NJ: Wiley-Blackwell, 2003;420–421.
25. Bursac Z, Gauss CH, Williams DK, et al. Purposeful selection of variables in logistic regression. Source Code Biol Med 2008;3:17.
26. Day MJ, Horzinek MC, Schultz RD, et al. WSAVA guidelines for the vaccination of dogs and cats. J Small Anim Pract 2016;57:E1–E45.
27. Breitschwerdt EB, Atkins CE, Brown TT, et al. Bartonella vinsonii subsp berkhoffii and related members of the alpha subdivision of the Proteobacteria in dogs with cardiac arrhythmias, endocarditis, or myocarditis. J Clin Microbiol 1999;37:3618–3626.
28. Lang K, Sigusch HH, Börner A, et al. Minimal myocardial lesions caused by endomyocardial biopsy can be detected by a commercially available cardiac troponin-T enzyme-linked immunosorbent assay. Eur J Clin Invest 1996;26:451–453.
29. Robinson WF, Robinson NA. The cardiovascular system. In: Maxie MG, ed. Pathology of domestic animals. 6th ed. St Louis: Elsevier Saunders, 2016;1–100.
30. Kimura Y, Fukushima R, Hirakawa A, et al. Epidemiological and clinical features of the endomyocardial form of restrictive cardiomyopathy in cats: a review of 41 cases. J Vet Med Sci 2016;78:781–784.
31. Guedes PMM, Veloso VM, Afonso LCC, et al. Development of chronic cardiomyopathy in canine Chagas disease correlates with high IFN-gamma, TNF-alpha, and low IL-10 production during the acute infection phase. Vet Immunol Immunopathol 2009;130:43–52.
32. Santilli RA, Porteiro Vazquez DM, Vezzosi T, et al. Long-term intrinsic rhythm evaluation in dogs with atrioventricular block. J Vet Intern Med 2016;30:58–62.
33. Alexander LK, Keene BW, Yount BL, et al. ECG changes after rabbit coronavirus infection. J Electrocardiol 1999;32:21–32.
34. Sousa MG, Carareto R, Silva JG, et al. Assessment of the electrocardiogram in dogs with visceral leishmaniasis. Pesqui Vet Bras 2013;33:643–647.
35. Patterson DF, Detweiler DK, Hubben K, et al. Spontaneous abnormal cardiac arrhythmias and conduction disturbances in the dog. A clinical and pathologic study of 3,000 dogs. Am J Vet Res 1961;22:355–369.
36. Calabrese F, Basso C, Carturan E, et al. Arrhythmogenic right ventricular cardiomyopathy/dysplasia: is there a role for viruses? Cardiovasc Pathol 2006;15:11–17.
37. Chimenti C, Frustaci A. Contribution and risks of left ventricular endomyocardial biopsy in patients with cardiomyopathies: a retrospective study over a 28-year period. Circulation 2013;128:1531–1541.
38. Begieneman MP, Emmens RW, Rijvers L, et al. Ventricular myocarditis coincides with atrial myocarditis in patients. Cardiovasc Pathol 2016;25:141–148.
39. Ukena C, Mahfoud F, Kindermann I, et al. Prognostic electrocardiographic parameters in patients with suspected myocarditis. Eur J Heart Fail 2011;13:398–405.
40. Deckers JW, Hare JM, Baughman KL. Complications of transvenous right ventricular endomyocardial biopsy in adult patients with cardiomyopathy: a seven-year survey of 546 consecutive diagnostic procedures in a tertiary referral center. J Am Coll Cardiol 1992;19:43–47.
41. Hu RL, Huang G, Qiu W, et al. Detection and differentiation of CAV-1 and CAV-2 by polymerase chain reaction. Vet Res Commun 2001;25:77–84.
42. Erles K, Dubovi EJ, Brooks HW, et al. Study of viruses associated with canine infectious respiratory disease. J Clin Microbiol 2004;42:4524–4529.
43. Jensen WA, Fall MZ, Rooney J, et al. Rapid identification and differentiation of Bartonella species using a single-step PCR assay. J Clin Microbiol 2000;38:1717–1722.
44. Rijpkema SG, Molkenboer MJ, Schouls LM, et al. Simultaneous detection and genotyping of three genomic groups of Borrelia burgdorferi sensu lato in Dutch Ixodes ricinus ticks by characterization of the amplified intergenic spacer region between 5S and 23S rRNA genes. J Clin Microbiol 1995;33:3091–3095.
45. Pratelli A, Tempesta M, Greco G, et al. Development of a nested PCR assay for the detection of canine coronavirus. J Virol Methods 1999;80:11–15.
46. Schulze C, Baumgärtner W. Nested polymerase chain reaction and in situ hybridization for diagnosis of canine herpesvirus infection in puppies. Vet Pathol 1998;35:209–217.
47. Kumar M, Nandi S. Development of a SYBR Green based real-time PCR assay for detection and quantitation of canine parvovirus in faecal samples. J Virol Methods 2010;169:198–201.
48. Yi L, Cheng S, Xu H, et al. Development of a combined canine distemper virus specific RT-PCR protocol for the differentiation of infected and vaccinated animals (DIVA) and genetic characterization of the hemagglutinin gene of seven Chinese strains demonstrated in dogs. J Virol Methods 2012;179:281–287.
49. Johnson N, Wakeley PR, Mansfield KL, et al. Assessment of a novel real-time pan-flavivirus RT-polymerase chain reaction. Vector Borne Zoonotic Dis 2010;10:665–671.
50. Di Muccio T, Veronesi F, Antognoni MT, et al. Diagnostic value of conjunctival swab sampling associated with nested PCR for different categories of dogs naturally exposed to Leishmania infantum infection. J Clin Microbiol 2012;50:2651–2659.
Appendix
Primers used for PCR assay, reverse transcriptase PCR assay, or real-time PCR assay to detect pathogens in EMB samples collected from dogs with UMRD or CHD during RV catheterization.
| Purpose | Target gene | Primer sequence (5’ to 3') | Reference |
|---|---|---|---|
| Control extraction | |||
| DNA | GAPDH | F: GTTCCAGTATGATTCCACCC | 20 |
| R: TCCCTCCACGATGCCAAA | |||
| RNA | Na+/K+ ATPase α | F: GCTGACTTGGTCATCTGC | 21 |
| R: AGGTAGGTTTGAGGGGATAC | |||
| Pathogen detection | |||
| Canine adenovirus 1 | E3 | F: CGCGCTGAACATTACTACCTTGTC | 41 |
| R: CCTAGAGCACTTCGTGTCCGCTT | |||
| Canine adenovirus 2 | F | F: TGTCAACAAGGTTTTGTCTTTT | 42 |
| R: TTTTCAAGGGAGGTGCGT | |||
| Bartonella spp | 16S-23S | F: CTTCGTTTCTCTTTCTTCA | 43 |
| R: GGATAAACCGGAAAACCTTC | |||
| Borrelia burgdorferi sensu lato | 26SN1–23SC1 | F: ACCATAGACTCTTATTACTTTGAC | 44 |
| R: TAAGCTGACTAATACTAATTACCC | |||
| Canine coronavirus | M | F: TCCAGATATGTAATGTTCGG | 45 |
| R: TCTGTTGAGTAATCACCAGCT | |||
| Canine herpesvirus 1 | K | F: TGCCGCTTTTATATAGATG | 46 |
| R: AAGCGTTGTAAAAGTTCGT | |||
| Canine parvovirus 2 | VP2 | F: CATTGGGCTTACCACCATTTCCAACC | 47 |
| R: TCAGCTGGTCTCAT | |||
| Canine distemper virus | N | F: GATAAAGCATGTCATTATAGTCCTAA | 48 |
| R: CTTGAGCTTTCGACCCTTC | |||
| West Nile virus | NS5 | F: GCMATHAGGTWCATGTGG | 49 |
| R: GTRTCCCAKCCDGCNGTRTC | |||
| Toxoplasma gondii | ITS | F: TGGCGCGTTCGTGCCCGAAAT | 40 |
| R: TGCAITTYGCTGCGKYCTTC | |||
| Leishmania infantum | kDNA | F: AAAGCGGGCGCGGTGCTG | 50 |
| R: TCCCATCGCAACCTCGGTT |
F = Forward. R = Reverse.