A sudden onset of extreme dysgalactia in gilts and sows in a 1,000-head farrow-to-wean herd in Wisconsin was observed in December 2009. Up to 100% of all sows and gilts farrowing in January were affected, continuing through March 2010. Preweaning mortality rate increased from 6% to 26% at its peak. All sows that farrowed during that time had normal udder development. Colostrum was available to the newborn pigs; however, within 12 to 24 hours after parturition, sows stopped producing milk, resulting in piglet starvation. This commercial sow farm consisted of 2 sites (A and B) approximately 5 miles apart. All bred females begin gestation in pens of 10 to 12 sows and gilts at site A. Halfway through gestation (approx 57 days), 10% of the pregnant females were taken to site B to farrow. After weaning their piglets, these sows were returned to site A. The dysgalactia was observed at both farms.
Feed samples for gestation and lactation diets were sent to the University of Missouri, Columbia, Mo. They were negative for ergotamine, aflatoxin, ochratoxin, and zearalenone. Vomitoxin was found at 1.54 and 2.05 μg/g in lactation and gestation feed, respectively. Vomitoxin at > 1 μg/g in the feed is considered a potential problem.1 The sows had a normal appetite, and changing sources of grain for feed had no effect. Water nipples were evaluated and found to be adequate, with sows drinking normally. Stray voltage was also ruled out. The sows were not febrile.
Piglets from affected litters were observed nudging and massaging the sow udders in an attempt to stimulate milk production and the milk-ejection reflex. Attempts to squeeze milk from the teat were also unsuccessful. Administering 20 U of oxytocin to sows produced milk in the udder but only for a few minutes. Udders were not warm to the touch and did not appear sore or congested. Individual animal treatment of affected farrowing sows with ceftiofur at 5.0 mg/kg (2.27 mg/lb) did not have any effect on the milk production of the sows.
During the last 2 weeks of February, sows in all stages of breeding and lactation received a pulse medication of chlortetracycline at 22 mg/kg/d (10 mg/lb/d) fed for 14 days in gestation and lactation ration diets to address any potentially subclinical coliform mastitis caused by Escherichia coli or Klebsiella spp. Groups of sows farrowing within the next 5 weeks had few problems with dysgalactia. In sows farrowing > 5 weeks after chlortetracycline treatment, dysgalactia was again observed, suggesting timing of the chlortetracycline treatment was a factor.
Within days after the recurrence of dysgalactia, the herd was reevaluated and 30 whole blood samples in EDTA were taken and sent to the Iowa State University veterinary diagnostic laboratory to specifically evaluate for the presence of Mycoplasma suis by PCR assay and acridine orange–stained blood smears. A published real-time PCR assay for M suis2 was adapted to a single probea assay with the following primers and probes: forward primer, TCAAGACTCTCCTCACTCTGACCT; reverse primer, TTCCTACAACTACAGGAGCAGCTG; and probe, FAM-AAGAGCTAGAGCAGCTGCTGGATCAA-BHQ. For 9 of 10 sows or gilts at 50 to 60 days of gestation, test results were negative for M suis. For 10 of 10 clinically normal–appearing piglets, test results were negative. For 3 of 3 sows that produced unaffected litters, test results were negative, but 4 of 4 sows with affected litters had positive results on PCR assay for M suis. Additionally, 2 of 3 samples from sows that had farrowed within the last 24 hours were found to be positive for M suis. One of these sows with positive results developed dysgalactia, but the other did not. Poor lactation in sows acutely infected with porcine reproductive and respiratory syndrome virus can occur, although serum from the same 30 animals had negative test results on porcine reproductive and respiratory syndrome virus–specific PCR assay. Heart, lung, liver, kidney, spleen, jejunum, cecum, and colon samples from 3 euthanized piglets from affected liters were submitted to the veterinary diagnostic laboratory at Iowa State University. Clostridium perfringens type A was the only pathogenic agent identified by routine culture. Histologic testing revealed acute nectrotizing and suppurative enteritis in the 3 pigs associated with the presence of robust rod-shaped organisms in close association with villus ghosts that was attributed to the C perfringens infection. The lungs were congested, but the livers, spleens, hearts, and kidneys were unremarkable. Overt diarrhea was not seen in these piglets.
Two weeks later, an additional 20 blood samples were drawn in 1 farrowing room. During the 2-week period prior to sampling, 9 of 20 sows in the farrowing room had been given chlortetracycline applied on top of the lactation feed. Six of 20 samples were positive for M suis. There was no correlation between those receiving chlortetracycline and those that did not; however, all 6 sows with dysgalactia had positive test results for M suis, suggesting that treatment with chlortetracycline after farrowing may have been too late to be effective. The next 3 groups of sows were given chlortetracycline applied on top of the lactation feed (ie, top dressing) at 22 mg/kg/d for 14 days prior to farrowing with no observed effect on the dysgalactia. The 2-week dosing was shifted to 3 weeks prior to farrowing, which did have a positive effect on lactation.
Discussion
Mycoplasma suis affects all ages of pigs. It can cause life-threatening hemolytic anemia and hypoglycemia, either of which can be the cause of acute death. Other animals develop mild chronic anemia.3 Affected piglets may often have general ill thrift. Feeder pigs may develop immune suppression, leading to enhanced disease susceptibility and retarded growth.3 Increases in gestation sow mortality rate can occur as a result of hypoglycemic coma resulting in unexpected deaths. Decreased sow fertility because of failure to return to estrus, decreased lactation after parturition, or both have been attributed to M suis infection.4 Because this organism requires specific testing to be identified and is not commonly considered as a differential diagnosis in these situations, it is potentially currently underdiagnosed in swine production systems.
The sudden outbreak and high incidence of dysgalactia suggest that the herd of the present report was previously naïve to M suis. The source of the organism appears to have been from a new supply of gilts. In September 2009, the newly sourced gilts were bred and comingled in pens with bred sows already in the herd that had weaned piglets. Sows and gilts in pen gestation often fight to determine the dominance hierarchy. During these fights, blood from lacerations on different animals may be mixed. Also, during vaccination of the sows and gilts, the same needle may be used to vaccinate > 1 animal, which could also be a source of transmission of M suis. Other vectors such as insects could also play a role. Evaluation of the source herd for the gilts identified a 27% prevalence of M suis in a group of sows at 50 days of gestation, supporting the likelihood that the M suis originated from this other herd. This herd did not have dysgalactia to the same extent as did animals at sites A and B. Interestingly, animals in gestation in the gilt source herd are fed twice daily and animals at sites A and B are fed once daily, which likely reduces the ability of these animals to counteract the hypoglycemia induced by M suis infection, especially during the stress of farrowing and lactation. Aside from M suis, no other environmental or infectious causes for the dysgalactia were identified, but the contribution of other cofactors that may not have been considered cannot be entirely ruled out. The tissues from the 3 piglets submitted to the diagnostic laboratory for evaluation were found to be infected with C perfringens type A. It is possible that the diarrhea attributed to C perfringens was secondary to the lack of adequate colostrum and nourishment, considering that subsequent batches of piglets born to sows treated with chlortetracycline did not have diarrhea to the same extent, even though this organism was known to be enzootic in the herd.
Prevalence of M suis in the swine industry is currently unknown. It is almost certainly severely underdiagnosed because of the low sensitivity and specificity of diagnostic tools prior to the development of PCR assays, coupled with whole blood, which is rarely included in routine submissions, being the preferred sample type. Once M suis infection is diagnosed in a herd, disease associated with this organism can be managed by strategic placement of antimicrobial treatment and simple management strategies, such as feeding pigs multiple times throughout the day to maintain glucose concentration, which prevents the most severe effects, including hypoglycemic shock, dysgalactia, and acute death, from occurring. It should be noted that strains of M suis have been described that reside intracellularly in RBCs. These strains are inaccessible to antimicrobials and are therefore able to persist within the host.5
TaqMan, Life Technologies, Carlsbad, Calif.
References
1. Pollmann DS, Koch BA, Seitz LM, et al. Deoxynivalenol-contaminated wheat in swine diets. J Anim Sci 1985; 60:239–247.
2. Hoelzle LE, Helbling M, Hoelzle K, et al. First LightCycler realtime PCR assay for the quantitative detection of Mycoplasma suis in clinical samples. J Microbiol Methods 2007; 70:346–354.
3. Hoelzle LE. Haemotrophic mycoplasmas: recent advances in Mycoplasma suis. Vet Microbiol 2008; 130:215–226.
4. Brownback A. Eperythrozoonosis as a cause of infertility in swine. Vet Med Small Anim Clin 1981; 76:375–378.
5. Groebel K, Hoelzle K, Wittenbrink MM, et al. Mycoplasma suis invades porcine erythrocytes. Infect Immun 2009; 77:576–584.
