Macrorhabdus ornithogaster (MO) is a pathogenic yeast that is associated with morbidity and mortality in both wild and captive birds.1–7 Budgerigars (Melopsittacus undulatus) are a commonly affected species, making this an important disease of both client-owned birds and zoological collections.4 Macrorhabdus ornithogaster has been documented as a major cause of morbidity and mortality in zoo-housed budgerigars.6,8 Additionally, MO can affect other psittacines, passerines, poultry, and waterfowl worldwide.2–4,9,10
Macrorhabdus ornithogaster is transmitted via the fecal-oral route and colonizes the proventricular isthmus, or gastric intermediate zone, of the avian stomach.4 Clinical signs include regurgitation, diarrhea, weight loss, and, often, sudden death.3,4,6,9 Histologic changes can include proventricular inflammation, mucosal hyperplasia, and glandular dysplasia.5 An association between MO infection and proventricular adenocarcinoma has also been documented.5
Variable fecal shedding makes antemortem MO diagnosis challenging. The most commonly reported antemortem diagnostic is the microscopic examination of feces, including direct wet mounts, Gram stain, Romanowsky stain, macrosuspension techniques, and mini-FLOTAC techniques.1,3,4,7,9,11,12 However, these microscopic techniques have limitations. Intact MO organisms are needed for microscopic diagnosis, and these organisms may not always be apparent in samples subjected to suboptimal handling conditions. Intermittent shedding can also preclude visualization of organisms in infected birds.7 Additionally, debris and large, filamentous, gram-positive bacteria can be mistaken for MO, and this organism does not always stain or fix well to slides.3,4,13
To help combat these challenges, PCR of cloacal swabs and feces has recently been utilized. There are many advantages to PCR: it can detect MO from a small amount of DNA, it does not require an intact organism for diagnosis, and it has increased diagnostic sensitivity compared to microscopic fecal examination.3,7 In one study,7 conventional PCR of cloacal swabs from MO-infected budgerigars was 2.38 times more likely to diagnose MO than fecal Gram stain.
The 18S rRNA and domain D1/D2 regions of this organism were initially used to identify MO phylogenetically as a yeast.14 Conventional PCR has been performed using nested and seminested PCR methods for amplifying this D1/D2 region, 18S rRNA, internal transcribed spacer, and intergenic spacer 1 regions in Japanese pet bird feces.15 Fecal PCR can have limitations, including bacterial DNA degradation and fecal inhibitors16; however, this diagnostic has the potential to provide an easy, noninvasive way to test birds for MO, especially in large aviary settings.
In addition to microscopic and molecular diagnostics, MO culture has also been performed but is challenging due to specific and fastidious growth requirements.17 Efforts to culture MO on traditional fungal media have been unsuccessful, but MO has been cultured successfully using specific media and under certain environmental conditions in a microaerophilic environment.17 According to the literature, there are no current studies indicating that MO has been maintained in culture or that extensive antifungal susceptibility testing has been performed. In fact, no private laboratory nor the American Type Culture Collection (ATCC) has an available MO culture. The inability to maintain a sustainable culture has limited research into pathogenesis, antifungal susceptibility, and phylogenetic diversity.
Due to high rates of avian morbidity and mortality in some facilities, effective treatment options for MO are needed. Commonly used treatments include amphotericin B (via oral gavage or in drinking water), sodium benzoate (via drinking water), and nystatin (via drinking water).4 However, these have shown limited success, with recrudescence of shedding after treatment cessation.4,9,11,12,18–20 Due to the current challenges with MO treatment, there is a critical need for antifungal susceptibility testing to guide targeted treatment of this pathogen.
Given the broad avian taxonomic range in which MO has been identified, the challenges with diagnosis, and inconsistent treatment results, our specific goals were to (1) develop and validate a quantitative PCR (qPCR) assay to quantify MO DNA in feces and (2) reproducibly culture MO to guide antifungal susceptibility testing. We hypothesized that we could (1) develop and validate a qPCR assay for detection of MO in budgerigar feces and (2) culture MO from infected budgerigars to eventually perform antifungal sensitivity testing.
Methods
Animals
Brookfield Zoo Chicago houses a colony of over 600 budgerigars. Within this collection, MO is suspected to be one of the leading causes of morbidity and mortality based upon the presence of the organism during necropsy evaluations. Birds are housed in an indoor, climate-controlled aviary with access to natural lighting. Birds are fed a 50:50 mixture of a pelleted diet (NuZu Budgie Maintenance Diet; Anderson Feed Company) and a seed-based diet (Kaytee Supreme Canary & Finch; Kaytee Products Inc), and water is offered free choice. Cuttlebone is provided as a calcium source. Since 2018, sodium benzoate (Sodium Benzoate, NF 500 g; Medisca) at 1 g/L has been added to the water daily for 6 months out of the year (February, March, April, August, September, and October) based upon in vitro and in vivo studies3,21 indicating reduced growth of MO and reduced flock mortality with this treatment. The enclosures are routinely disinfected with 2.5% sodium hypochlorite solution. Birds are managed as a flock, but animal care staff isolate clinically abnormal individuals within the aviary without direct contact with other birds. All birds receive a physical examination by a veterinarian annually. Due to the flock size, necropsies are performed on approximately 10% of mortalities. This research was approved by the University of Illinois IACUC #22192 and the Brookfield Zoo Chicago IACUC & Biological Research Review Committee.
Sample collection, conventional PCR, and sequencing
Fifty-four samples consisting of pooled fecal samples, individual fecal samples, and individual cloacal swabs were opportunistically collected from apparently healthy budgerigars. Fecal cytology was performed to screen for positive MO samples. Deoxyribonucleic acid was extracted from these samples as well as from pure MO culture material using a commercially available kit following the manufacturer's instructions (QIAmp DNA Mini Kit; Qiagen). A 1-hour incubation at 37 °C with 300 U of lyticase (Lyticase; Sigma-Aldrich Inc) was performed before the lysis step in order to break down the fungal cell wall. The concentration and purity of the resulting DNA samples were determined using a spectrophotometer (Nanodrop Spectrophotometer; Thermo Fisher Scientific).
Conventional PCR was performed targeting a conserved region of the MO 18S rRNA, intergenic spacer, and the D1/D2 hypervariable region as previously described.15 Polymerase chain reaction products were sequenced in both directions using a commercial company (ACGT Inc). Sequences were trimmed of primers and compared to known MO sequences available in GenBank using nucleotide Basic Local Alignment Search Tool (BLASTn).
Quantitative PCR development and validation
The linearized plasmid stock was then diluted to a concentration of 4.00 X 108 target copies/μL using sterile water. Following this, nine 10-fold serial dilutions were made from 4.00 X 107 to 4.00 X 10−1 target copies/μL. Dilutions from 4.00 X 106 to 4.00 X 10−1 target copies/μL, corresponding to 1.00 X 107 to 1.00 X 100 target copies/reaction (2.5 μL of each plasmid dilution was used per qPCR reaction) were used to generate the standard curve to evaluate primer-probe performance.
Five sense and antisense TaqMan primer-probes were designed targeting MO rRNA segments (Table 1). All reactions (25 μL) were run in triplicate on a QuantStudio 3 (Thermo Fisher Scientific) in a 96-well reaction plate (ABI MicroAmp Optical 96-Well Reaction Plate; Thermo Fisher Scientific) sealed with clear adhesive film (ABI MicroAmp Optical Adhesive Film; Thermo Fisher Scientific). Each reaction contained 12.5 μL of TaqMan platinum PCR Supermix-UDG with ROX (Invitrogen), 1.25 μL of 20X TaqMan primer-probe, 2.5 μL plasmid dilution, nontemplate control or sample, and water to a final volume of 25 μL. Cycling parameters were as follows: 1 cycle at 50 °C for 2 minutes followed by 95 °C for 10 minutes, then 40 cycles at 95 °C for 15 seconds and 60 °C for 60 seconds, and a final cycle of 72 °C for 10 minutes. The results were analyzed using associated software (QuantStudio Design & Analysis Software, version 1.5.2; Applied Biosystems). Assay performance was evaluated using published guidelines.22
TaqMan primer-probe sequences targeting 18S rRNA of Macrorhabdus ornithogaster (MO).
| Primer-probe name | Forward primer sequence (5' to 3') | Reverse primer sequence (5' to 3') | Probe sequence (5' to 3') | Product size |
|---|---|---|---|---|
| MO_SUMO1 | CTTAGACGTTCTGGGCTGCA | TGTGTACAAAGGGCAGGGAC | CGCGCGCTACACTGACTAAGCCA | 195 bp |
| MO_SUMO_3 | GGGATCGGGTGGAGTTTAAATAG | TTTCAGCCTTGCGACCATAC | AGACGCACTCGGGACCTTAAGAGA | 94 bp |
| MO_ITS_148 | TGCCCTATCAACTTTCGATGG | GTCAGGATTGGGTAATTTGCG | CCTTGGATGTGGTAGCCGTTTCTCA | 148 bp |
| MO_D1D2_73 | TGAAGAGTCGAGTTGTTTGGG | CTCGCCAATATTTAGCTTTAGATGG | AATGCAGCTCTAAGTGGGTGGTAAACTC | 73 bp |
| MO_ITS_97 | CCAGGTCCGGACACAATAAG | ACAAATCACTCCACCAACTAAGA | TTTGTGGGTGGTGGTGCATGG | 97 bp |
D1D2 = D1/D2 hypervariable region. ITS = Internal transcribed spacer. SUM = Small ubiquitin-like modifier.
The product size is listed by the number of bp.
To assess analytical specificity, qPCR was performed using DNA samples from pure cultures of Cryptococcus neoformans (from a Cercopithecus sp clinical sample cultured at the University of Illinois Veterinary Diagnostic Laboratory and verified by 18S rRNA sequencing), Aspergillus fumigatus (from a Tursiops sp bronchial wash cultured at the University of Illinois Veterinary Diagnostic Laboratory and verified by Matrix-Assisted Laser Desorption Ionization–Time of Flight), Fusarium spp (from an environmental sample cultured at the University of Illinois Veterinary Diagnostic Laboratory and verified by Matrix-Assisted Laser Desorption Ionization–Time of Flight), Candida albicans (ATCC 10231), Bacteroides fragilis (ATCC 25285), and Fusobacterium nucleatum (ATCC 25586). Exclusivity was further evaluated by testing skin-swab DNA from an American toad (Anaxyrus americanus) that was qPCR positive for Batrachochytrium dendrobatidis and a timber rattlesnake (Crotalus horridus) that was qPCR positive for Ophidiomyces ophidiicola. To determine the limit of detection and assess intra-assay variability, 10-fold plasmid dilutions corresponding to 1.00 X 107 to 1.00 X 100 copies/reaction were assayed using 6 technical replicates/plasmid dilution and nontemplate control. Interassay variability was assessed using 6 technical replicates of each standard curve dilution and nontemplate control across 2 separate runs. The mean cycle threshold, SD, and coefficient of variation (CV) of each MO plasmid dilution were used to assess inter- and intraassay variability.
Efficiency curves were performed using DNA extracted from MO-negative budgerigar fecal DNA samples spiked with plasmid dilutions (4.00 X 106 to 4.00 X 10−1 target copies/μL, corresponding to 107 to 100 copies/reaction). These were used to determine whether assay performance was impacted by budgerigar fecal sample matrix. Budgerigar samples used in efficiency curves were presumed negative for MO based on negative fecal cytology and negative conventional PCR testing as described above.
Fungal culture
Samples of the gastrointestinal tract were collected opportunistically from budgerigars euthanized due to chronic medical conditions or for population health management decisions. No bird was specifically euthanized for the purposes of this study. During necropsy, fecal or cloacal cytology was performed to assess for the presence of MO. The gastrointestinal tract from esophagus to cloaca was removed from cytology-positive birds. Additionally, feces were opportunistically collected from healthy and ill budgerigars and submitted to the same lab. Samples were transported at room temperature to the University of Illinois Veterinary Diagnostic Laboratory. Upon arrival, a second cytology was performed on the proventricular-ventricular isthmus and feces to assess for the presence of MO following transport.
A fungal culture was performed using a modified approach from a previously reported protocol.17 Samples were plated with Basal Media Eagle (Gibco) or chicken serum media (MilliporeSigma), 20% fetal bovine serum (Gibco), 5% sucrose (Thermo Fisher Scientific), and hydrochloric acid (MP Biomedicals) until pH 3 to 4 and incubated at 42 °C in a GENbag microaerophilic bag (bioMérieux Industry). Following initial negative culture attempts, an antibiotic cocktail consisting of 100 U/mL penicillin (Sigma-Aldrich Inc), 100 µg/mL streptomycin (Sigma-Aldrich Inc), and 25 µg/mL chloramphenicol (Sigma-Aldrich Inc) was added to the culture media. Positive growth was indicated by observing the long (50 to 120 µm) rod to branched yeast appearance under the microscopic examination. Any samples exhibiting positive growth were confirmed as MO using conventional PCR and sequencing followed by qPCR as described above.
Results
Quantitative PCR development
Conventional PCR produced a 223-bp sequence (100% homologous to LC647654.1) that was utilized in positive control development. Primer probe MO_SUMO_3, targeting a 94-bp segment with the 223-bp product, was the only 1 of the 5 candidate primer-probes that successfully amplified MO and failed to amplify nontarget fungal DNA (Table 1). The MO_SUMO_3 qPCR assay performed with high efficiency (slope = −3.355; R2 = 0.999; efficiency = 98.622) that was unchanged in the presence of budgerigar fecal DNA (slope = −3.381; R2 = 0.996; efficiency = 97.577). Intra-assay CV ranged from 0.29% to 1.97% (Table 2). Interassay CV ranged from 0.33% to 2.62%. The dynamic range was 107 to 101 target copies/reaction. The limit of detection was 101 target copies, although 100 (1) copy/reaction was detected intermittently.
Intra- and interassay variability for MO quantitative PCR assay.
| Intra-assay | Interassay | ||||||
|---|---|---|---|---|---|---|---|
| DNA copy No. | Ct mean | Ct SD | CV (%) | DNA copy No. | Ct mean | Ct SD | CV (%) |
| NTC | Und | Und | NA | NTC | Und | Und | NA |
| 1 | 37.97 | 0.746 | 1.97 | 1 | 37.66 | 0.99 | 2.63 |
| 10 | 35.56 | 0.321 | 0.90 | 10 | 35.92 | 0.72 | 2.00 |
| 100 | 32.51 | 0.111 | 0.34 | 100 | 32.54 | 0.11 | 0.33 |
| 1,000 | 29.34 | 0.131 | 0.45 | 1,000 | 29.39 | 0.12 | 0.40 |
| 10,000 | 25.72 | 0.079 | 0.31 | 10,000 | 25.78 | 0.10 | 0.38 |
| 100,000 | 22.52 | 0.080 | 0.36 | 100,000 | 22.55 | 0.08 | 0.34 |
| 1,000,000 | 18.97 | 0.108 | 0.57 | 1,000,000 | 19.04 | 0.11 | 0.57 |
| 1,000,000 | 15.51 | 0.045 | 0.29 | 1,000,000 | 15.56 | 0.08 | 0.50 |
Ct = Cycle threshold. CV = Coefficient of variation. N/A = Not applicable. NTC = No template control. Und = Undetermined.
The numbers of DNA copies are paired with corresponding mean Ct, SD, and CV.
Fungal culture
Fungal culture was attempted on a total of 15 biological specimens with organisms resembling MO on fecal cytology. This included 10 pooled fecal samples, 1 individual fecal sample, and 4 proventricular-ventricular samples. Despite the presence of organisms consistent with MO on Gram stain, none of the 10 pooled fecal samples from various budgerigar holding areas successfully grew MO.
Positive MO growth was first seen from a proventricular-ventricular isthmus sample and a fecal sample from the same individual bird. Macroscopically, growth appeared as white, 0.5-to-1-mm clusters on the media. Growth was observed molecularly and confirmed via sequencing and MO_SUMO_3 qPCR. However, the fecal culture stopped propagating 2 weeks after sample collection and died before sensitivity testing could be performed. The proventricular-ventricular sample lasted 1 to 2 weeks longer than the fecal culture, but it ultimately died after 4 to 5 weeks. Following this positive culture, MO was also successfully cultured and molecularly verified (conventional PCR with sequencing and MO_SUMO_3 qPCR) from 3 more proventricular-ventricular samples, each from different birds.
Discussion
The high prevalence and associated morbidity and mortality of MO in managed budgerigar flocks emphasizes the critical need for reliable diagnostics and therapeutics for this pathogen. Our goal was to fill this need by (1) developing an analytically sensitive and specific qPCR assay to aid in diagnosis and clinical monitoring and (2) refining culture methodologies necessary to identify successful treatment options. Quantitative PCR assays are rapid to perform and tend to be more sensitive than conventional PCR while also allowing for the quantification of pathogen DNA, which may serve as a proxy for estimating pathogen burden.23 Assay validation is key to ensuring high analytical sensitivity, specificity, and reproducibility for pathogen testing. The World Organization of Animal Health has proposed guidelines for validating infectious disease diagnostics in wildlife, with this MO qPCR assay fulfilling all criteria (analytical sensitivity, specificity, and reproducibility) for stage 1 validation.24 Further studies are needed to compare the sensitivity and specificity of this qPCR assay with other utilized diagnostic methods as well as to proceed with diagnostic sensitivity and specificity testing for stage 2 validation.
This validated qPCR assay for detecting MO in budgerigar feces will provide clinicians with an analytically sensitive antemortem diagnostic for detecting this pathogen. Since microscopic testing requires intact MO organisms for detection,7 an assay that only requires as few as 10 copies of MO DNA for detection would greatly benefit both diagnostic and therapeutic monitoring. However, there are still some limitations to this test. For instance, some fungal organisms have repeating DNA segments in their genomes25,26; thus, 10 copies may represent a single MO organism or several organisms. Repetitive DNA segments are more common in Zygomycota fungi, whereas Ascomycota fungi (such as MO) tend to have a lower percentage of repetitive DNA segments in their genomes.25 Despite this, clinicians should still consider the possibility of repetitive gene segments when interpreting the quantitative results of this assay. Additionally, we have not yet compared MO qPCR copy number to the degree of clinical signs or histologic changes. A positive fecal or cloacal swab qPCR indicates that there is MO DNA but not the extent of disease. We recommend that clinicians interpret positive qPCR results in light of clinical presentation and other diagnostic findings.
In addition to developing and validating an MO qPCR, we were able to successfully culture MO from infected budgerigars by modifying a previously established protocol.17 Macrorhabdus ornithogaster growth requires an acidic pH and a strict microaerophilic environment, similar to the previous culture study.17 While the cultures could not be maintained for more than 5 weeks to perform antifungal susceptibility testing, we identified important advances in culture technique that will aid future investigations into susceptibility testing. Postmortem proventricular-ventricular samples appear to be more reliable than feces for detection, although MO was successfully cultured from 1 individual fecal sample following the addition of antibiotics to the growth media. It is possible that the more acidic environment within the gastrointestinal tract may be more suitable for MO growth as it grows best at an acidic pH. A larger sample size would be needed to statistically compare the reliability of different sampling sites for successful MO culture.
There were several challenges encountered prior to growing a positive culture. The presence of other microorganisms and debris in feces appear to hinder MO growth, which can be especially challenging for an organism with strict growth requirements, such as an acidic pH and a strict microaerophilic environment.17 The low-oxygen environment needed for optimal MO growth provides a unique challenge for culturing this organism, but we found that the use of a microaerophilic bag appears suitable for the initial growth of this organism. Artificial media (Basal Media Eagle) was used initially, which did propagate MO, but it was suspected that chicken serum (a natural media) would lead to a longer-lived culture. However, long-term growth was insufficient with this equipment, and future studies should evaluate a more permanent microaerophilic chamber or different media.
Given the organism's fastidious growth requirements, qPCR is a more reliable and quicker antemortem diagnostic approach for MO than culture, but the success in culturing MO will prove beneficial to advancing MO treatment. Several treatments have been attempted for MO, including nystatin, amphotericin B, fluconazole, and sodium and potassium benzoate4,9,11,12,20,21; however, there is no currently published antifungal susceptibility testing for MO. A maintained culture is critical for performing this testing, and improving the culture technique to allow future drug sensitivity testing is clinically valuable. This information will be crucial in guiding clinicians to the best treatment options for affected birds.
In conclusion, we developed and analytically validated a TaqMan qPCR assay for MO detection. This assay performed with appropriate efficiency and specificity while also maintaining low inter- and intra-assay variability and detecting as few as 10 MO target copies/reaction. Macrorhabdus ornithogaster culture is possible, but further research is needed for culture maintenance and future antifungal susceptibility testing. This novel validated assay plus the culture results have provided diagnostic advancements for the improved detection and, hopefully, improved treatment of MO in affected budgerigars.
Acknowledgments
The authors would like to thank the Brookfield Zoo Chicago Wild Encounters Team as well as Amber Simmons, Maris Daleo, and Kaitlin Moorhead from the Wildlife Epidemiology Lab for their support of and assistance with sample collection and diagnostic development.
Disclosures
The authors have nothing to disclose. No AI-assisted technologies were used in the composition of this manuscript.
Funding
Funds for this project were provided by the Wild Animal Health Fund, the Avian Scientific Advisory Group/Conservation and Research Grant, and the Association of Avian Veterinarians.
ORCID
D. M. Lang https://orcid.org/0000-0002-8776-4446
References
- 1.↑
Baron HR, Stevenson BC, Phalen DN. Comparison of in-clinic diagnostic methods for Macrorhabdus ornithogaster. J Avian Med Surg. 2021;35(1):37–44. doi:10.1647/1082-6742-35.1.37
- 2.↑
Lanzarot P, Blanco JL, Alvarez-Perez S, Abad C, Cutuli MT, Garcia ME. Prolonged fecal shedding of ‘megabacteria’ (Macrorhabdus ornithogaster) by clinically healthy canaries (Serinus canaria). Med Mycol. 2013;51(8):888–891. doi:10.3109/13693786.2013.813652
- 3.↑
Phalen D. Update on the diagnosis and management of Macrorhabdus ornithogaster (formerly megabacteria) in avian patients. Vet Clin North Am Exot Animal Pract. 2014;17(2):203–210. doi:10.1016/j.cvex.2014.01.005
- 4.↑
Phalen D. Macrorhabdosis. In: Speer BL, ed. Current Therapy in Avian Medicine and Surgery. Elsevier; 2016:78–82.
- 5.↑
Powers LV, Mitchell MA, Garner MM. Macrorhabdus ornithogaster infection and spontaneous proventricular adenocarcinoma in budgerigars (Melopsittacus undulatus). Vet Pathol. 2019;56(3):486–493. doi:10.1177/0300985818823773
- 6.↑
Reed K, Anderson K, Wolf K. Mortality trends for budgerigars (Melopsittacus undulatus) housed in a walk-through aviary in a zoo in North America, 2009-2019. J Zoo Wildl Med. 2021;52(4):1143–1148.
- 7.↑
Sullivan PJ, Ramsay EC, Greenacre CB, Cushing AC, Zhu X, Jones MP. Comparison of two methods for determining prevalence of Macrorhabdus ornithogaster in a flock of captive budgerigars (Melopsittacus undulatus). J Avian Med Surg. 2017;31(2):128–131. doi:10.1647/2016-213
- 8.↑
Wildmann AK, Cushing AC, Pfisterer BR, Sula MM. Retrospective review of morbidity and mortality in a population of captive budgerigars (Melopsittacus undulates). J Zoo Wild Med. 2022;53(2):443–441. doi:10.1638/2020-0227
- 9.↑
Phalen D. Diagnosis and management of Macrorhabdus ornithogaster (formerly megabacteria). Vet Clin North Am Exot Animal Pract. 2005;8(2):299–306. doi:10.1016/j.cvex.2004.12.002
- 10.↑
Robino P, Ferrocino I, Rossi G, et al. Changes in gut bacterial communities in canaries infected by Macrorhabdus ornithogaster. Avian Pathol. 2019;48(2):111–120. doi:10.1080/03079457.2018.1553294
- 11.↑
Baron HM, Leung KCL, Stevenson BC, Gonzalez MS, Phalen DN. Evidence of amphotericin B resistance in Macrorhabdus ornithogaster in Australian cage-birds. Med Mycol. 2019;57(4):421–428. doi:10.1093/mmy/myy062
- 12.↑
Baron HR, Stevenson BC, Phalen DN. Inconsistent efficacy of water-soluble amphotericin B for the treatment of Macrorhabdus ornithogaster in a budgerigar (Melopsittacus undulatus) aviary. Aust Vet J. 2020;98(7):333–337. doi:10.1111/avj.12936
- 13.↑
Antinoff N. Diagnosis and treatment options for Megabacteria (Macrorhabdus ornithogaster). J Avian Med Surg. 2004;18(3):189–195. doi:10.1647/1082-6742(2004)018[0189:DATOFM]2.0.CO;2
- 14.↑
Tomaszewski EK, Logan KS, Snowden KF, Kurtzman CP, Phalen DN. Phylogenetic analysis identifies the ‘megabacterium’ of birds as a novel anamorphic ascomycetous yeasts, Macrorhabdus ornithogaster gen. nov., sp. nov. Int J Syst Evol Microbiol. 2003;53(pt 4):1201–1205. doi:10.1099/ijs.0.02514-0
- 15.↑
Kojima A, Osawa N, Oba M, Katayama Y, Omatsu T, Mizutani T. Validation of the usefulness of 26S rDNA D1/D2, internal transcribed space, and intergenic spacer 1 for molecular epidemiological analysis of Macrorhabdus ornithogaster. J Vet Med Sci. 2022;84(2):244–250. doi:10.1292/jvms.21-0576
- 16.↑
Acharya KR, Dhand NK, Whittington RJ, Plain KM. PCR inhibition of a quantitative PCR for detection of Mycobacterium avium subspecies paratuberculosis DNA in feces: diagnostic implications and potential solutions. Front Microbiol. 2017;8:115. doi:10.3389/fmicb.2017.00115
- 17.↑
Hannafusa Y, Bradley A, Tomaszewski EE, Libal MC, Phalen DN. Growth and metabolic characterization of Macrorhabdus ornithogaster. J Vet Diagn Invest. 2007;19(3):256–265. doi:10.1177/104063870701900305
- 18.↑
Poleschinski JM, Straub JU, Schmidt V. Comparison of two treatment modalities and PCR to assess treatment effectiveness in macrorhabdosis. J Avian Med Surg. 2019;33(3):245–250. doi:10.1647/2018-358
- 19.
Ledwoń A, Szeleszczuk P, Czopowicz M. Assessment of the efficacy of amphotericin B for reduction of Macrorhabdus ornithogaster shedding in budgerigars. Med Weter. 2016;72(4):237–239.
- 20.↑
Püstow R, Krautwald-Junghanns ME. The incidence and treatment outcomes of Macrorhabdus ornithogaster infection in budgerigars (Melopsittacus undulatus) in a veterinary clinic. J Avian Med Surg. 2017;31(4):344–350. doi:10.1647/2016-181
- 21.↑
Madani SA, Ghorbani A, Arabkhazaeli F. Successful treatment of macrorhabdosis in budgerigars (Melopsittacus undulatus) using sodium benzoate. J Mycol Res. 2014;1(1):21–27.
- 22.↑
Bustin SA, Benes V, Garson JA, et al. The MIQE guidelines: minimum information for publication of quantitative real-time PCR experiments. Clin Chem. 2009;55(4):611–622. doi:10.1373/clinchem.2008.112797
- 23.↑
Kralik P, Ricci M. A basic guide to real time PCR in microbial diagnostics: definitions, parameters, and everything. Front Microbiol. 2017;8:108. doi:10.3389/fmicb.2017.00108
- 24.↑
Manual of Diagnostic Tests and Vaccines for Terrestrial Animals: principles and methods of validation of diagnostic assays for infectious diseases. World Organisation for Animal Health. 2023. Accessed October 10, 2024. https://www.woah.org/fileadmin/Home/fr/Health_standards/tahm/1.01.06_VALIDATION.pdf
- 25.↑
Levdansky E, Sharon H, Osherov N. Coding fungal tandem repeats as generators of fungal diversity. Fungal Biol Rev. 2008;22(3–4):85–96. doi:10.1016/j.fbr.2008.08.001
- 26.↑
Wöstmeyer J, Kreibich A. Repetitive DNA elements in fungi (Mycota): impact on genomic architecture and evolution. Curr Genet. 2002;41(4):189–198. doi:10.1007/s00294-002-0306-y
