Reduced ribonucleotide reductase RRM2 subunit expression increases DNA damage and mitochondria dysfunction in woody breast chickens

Majid Shakeri USDA-ARS, U.S. National Poultry Research Center, Athens, GA

Search for other papers by Majid Shakeri in
Current site
Google Scholar
PubMed
Close
 PhD
,
Janghan Choi USDA-ARS, U.S. National Poultry Research Center, Athens, GA

Search for other papers by Janghan Choi in
Current site
Google Scholar
PubMed
Close
 PhD
,
Caitlin Harris USDA-ARS, U.S. National Poultry Research Center, Athens, GA

Search for other papers by Caitlin Harris in
Current site
Google Scholar
PubMed
Close
 PhD
,
Richard Jeff Buhr USDA-ARS, U.S. National Poultry Research Center, Athens, GA

Search for other papers by Richard Jeff Buhr in
Current site
Google Scholar
PubMed
Close
 PhD
,
Byungwhi Kong USDA-ARS, U.S. National Poultry Research Center, Athens, GA

Search for other papers by Byungwhi Kong in
Current site
Google Scholar
PubMed
Close
 PhD
,
Hong Zhuang USDA-ARS, U.S. National Poultry Research Center, Athens, GA

Search for other papers by Hong Zhuang in
Current site
Google Scholar
PubMed
Close
 PhD
, and
Brian Bowker USDA-ARS, U.S. National Poultry Research Center, Athens, GA

Search for other papers by Brian Bowker in
Current site
Google Scholar
PubMed
Close
 PhD

Click on author name to view affiliation information

Abstract

OBJECTIVE

The aim of this study was to investigate the roles of ribonucleotide reductase subunit M2 (RRM2; subunit of ribonucleotide reductase) in severe woody breast (WB) and normal breast muscles.

ANIMALS

40 8-week-old male Ross-708 broiler chickens.

METHODS

Quantitative PCR was performed to determine gene expression, and commercial ELISA/assay kits were used to obtain several enzymatic activities.

RESULTS

Results showed that RRM2 activity (P = .0002) and RRM2 (P = .05) and hydroxymethylbilane synthase expression (impaired oxygen transport and metabolism, P = .002) were reduced in WB, while caveolin-3 (defected membrane integrity, P = .09), endoglin (increased fibrosis, P = .06), and secreted protein acidic rich in cysteine (metabolic dysregulation, P = .09) expression tended to increase in WB. WB tended to have increased levels of homocysteine (P = .06), aspartate aminotransferase mitochondria (P = .02), pyruvate kinase (P = .04), DNA damage (P = .06), creatine kinase (P = .05), and triglyceride (P = .002) but decreased ATPase activity (P = .01), all indicating mitochondria dysfunction and tissue damage.

CLINICAL RELEVANCE

In this study, differences in various enzyme activities and increased DNA damage suggest that RRM2-mediated mitochondrial abnormalities may play a role in WB myopathy.

Abstract

OBJECTIVE

The aim of this study was to investigate the roles of ribonucleotide reductase subunit M2 (RRM2; subunit of ribonucleotide reductase) in severe woody breast (WB) and normal breast muscles.

ANIMALS

40 8-week-old male Ross-708 broiler chickens.

METHODS

Quantitative PCR was performed to determine gene expression, and commercial ELISA/assay kits were used to obtain several enzymatic activities.

RESULTS

Results showed that RRM2 activity (P = .0002) and RRM2 (P = .05) and hydroxymethylbilane synthase expression (impaired oxygen transport and metabolism, P = .002) were reduced in WB, while caveolin-3 (defected membrane integrity, P = .09), endoglin (increased fibrosis, P = .06), and secreted protein acidic rich in cysteine (metabolic dysregulation, P = .09) expression tended to increase in WB. WB tended to have increased levels of homocysteine (P = .06), aspartate aminotransferase mitochondria (P = .02), pyruvate kinase (P = .04), DNA damage (P = .06), creatine kinase (P = .05), and triglyceride (P = .002) but decreased ATPase activity (P = .01), all indicating mitochondria dysfunction and tissue damage.

CLINICAL RELEVANCE

In this study, differences in various enzyme activities and increased DNA damage suggest that RRM2-mediated mitochondrial abnormalities may play a role in WB myopathy.

Globally, demand for poultry meat as an inexpensive and healthier source of protein has increased dramatically and is expected to increase even further in the future compared to other meats (USDA-ERS, August 2022). To meet this demand, broiler chickens have been successfully selected for fast growth and high breast meat yield. However, along with these positive gains in production efficiency have come some unintended consequences such as the emergence of woody breast (WB) myopathy. The myopathy negatively affects the quality of the breast meat resulting in economic losses to the industry due to undesirable meat appearance and texture.1

It has been found that WB myopathy results in muscle fiber degeneration and fibrosis and reduces protein content and oxygen levels in the muscles leading to oxidative distress.2,3 Furthermore, the WB has diminished blood supply to muscle1 leading to greater muscle tissue damage. To date, several nutritional and management strategies have been examined to prevent WB myopathy but still the exact cause of the condition is unknown, making it difficult to develop effective mitigation strategies. Several studies4 have suggested that genetic solutions are required as the myopathy is believed to be caused by the culmination of genetic alterations derived from selective breeding.

With regards to the WB myopathy, a major area of research interest has been with mitochondria function5 and energy production (ATP).6 Mitochondrial abnormalities are responsible for several disorders in muscle.7 Adverse impacts on oxidative phosphorylation lead to decreases in cellular ATP production.7 We previously observed that WB meat has higher connective tissue content, reduced expression of several genes related to mitochondrial function, and increased reactive oxygen species (ROS).8 For the first time, our previous study reported differences in ribonucleotide reductase (RNR) activity in WB meat, an enzyme involved in DNA synthesis, mitochondrial function, and ATP production.8

RNR (2 subunits: ribonucleotide reductase subunit M2 and M2 [RRM1 and RRM2]) is an enzyme that plays an important role in the synthesis and replication of nuclear DNA and mitochondria DNA (mtDNA)9 and nucleic acid metabolism.10,11 Lower expression of RRM2 is associated with higher ROS and reductions in mtDNA content and mitochondrial proteins leading to impaired ATP production in tissues11,12 and cellular functions.13 Thus, RRM2 is critical for ATP production, and alterations in its expression/function may lead to aberrant DNA replication, decreased mitochondria function, and increased cell lethality.14 Except for our previous study8 showing that WB meat exhibited lowered RRM2 expression, and increased mitochondria abnormalities and ROS, there are no available data relating RNR activity and the WB condition. As there is limited information regarding RRM2 function in WB, in addition to measuring RRM2 expression/activity investigations into other genes/enzymes or proteins related to mitochondria function are needed to understand the underlying mechanisms involved. Therefore, the aim of this study was to further investigate the role of RNR activity, the expression of the RRM2 subunit, and the associated pathways related to mitochondria function and ATP production in WB muscles.

Methods

Animal ethics

Broilers for this study were handled according to an animal use protocol approved by the Institutional Animal Care and Use Committee at the US National Poultry Research Center, Athens, GA (protocol No. USNPRC-2024-07).

Samples

In total, 40 8-week-old male Ross-708 chickens fed with a common commercial-type diet were selected from a local research farm (University of Georgia, Athens, GA). All birds were in good health with no apparent adverse symptoms. All birds were fasted for approximately 8 hours before they were transported to the US National Poultry Research Center (Athens, GA) and slaughtered via standard electrical stunning (15-V pulse DC at 500 Hz for 10 seconds) and exsanguination (severing both carotid arteries and jugular veins at the base of the head) procedures. Approximately 3 mL of blood was collected from the neck cut to obtain plasma. All breast muscles (pectoralis) were assessed for the occurrence and severity of the WB condition immediately after bleeding based on a previously published method.8 Eight severe WB and 8 normal breast muscles (N) were chosen for conducting molecular and biochemical assays. Muscle samples from the ventral (skin) surface and inner (sternal) portion on the cranial end of the pectoralis were collected < 15 min postmortem and immediately flash frozen with liquid nitrogen and stored at −80 °C until use.

Biochemical assays

RRM2 (MyBioSource), chicken aspartate aminotransferase mitochondria activity (AST) (Abbexa), and pyruvate kinase activity (Abcam), were measured using commercial kits based on the manufacturer's instructions. Briefly, approximately 10 mg (for AST assay), 50 mg (for pyruvate kinase activity assay), or 100 mg (for RRM2) of the muscle was homogenized in cool PBS (for AST and RRM2) or assay pyruvate kinase buffer provided by the manufacturer to obtain supernatant. The obtained supernatant, serial standards, and reagents were prepared and loaded onto a 96-well plate based on the manufacturer's protocol. The absorbance was measured at 450 (AST and RRM2) and 570 nm, respectively, using a microplate reader (Bio-Rad).

ATPase and creatine kinase activities, DNA damage, and triglyceride concentration were measured in muscle samples using commercially available kits (Abcam). Chicken claudin-1 concentrations were measured in both muscle and plasma samples using a commercially available kit (MyBioSource). Homocysteine concentration was measured in plasma samples using a commercially available kit (Abbexa). For these assays, approximately 10 to 40 mg of muscle or 100 µL of plasma was prepared in buffers according to the protocols provided by the manufacturer. The obtained supernatant/plasma, serial standards, and reagents were prepared and loaded onto 96-well plates based on the manufacturer's protocols. The absorbance was measured at 450 to 650 nm using a microplate reader (Bio-Rad). All biochemical assays were completed in duplicate.

Quantitative real-time reverse transcription PCR

Total RNA was extracted from frozen muscle tissues using Trizol reagent (Thermo Fisher Scientific) and an RNeasy Mini Kit (Qiagen). The Agilent Tape-Station system was used to confirm the quality of extracted RNA (RINe > 8 for all samples). Quantitative real-time PCR was performed with SYBR Green (Bio-Rad) to measure gene expression (Table 1). The mRNA expression was normalized with 18S rRNA expression using the 2−ΔΔCt method to calculate fold change.

Table 1

Forward and reverse primers for real-time PCR amplification.

Target Forward Reverse
CAV-3 CGTTGTAAAGGTGGATTTCGAGG ACCAGTACTTGCTGACGGTG
ENG TCCTCATCCACACTGACGCC TGCACTTCCAGGGACTGAGC
HMBS ACTAGTTCACTTCGGCGAGC CTCAGGAGCTGACCTATGCG
SPARC GTATGAGCGCGATGAGGACA GTGGGACAGGTACCCATCAA
RRM2 TTAGTGAGTGTGTATGCTCCCC ACCAAAAGTCAAGGCACGCT
18S TCCCCTCCCGTTACTTGGAT GCGCTCGTCGGCATGTA

CAV-3 = Caveolin-3. ENG = Endoglin. HMBS = Hydroxymethylbilane synthase. SPARC = Secreted protein acidic and rich in cysteine. RRM2 = Ribonucleotide reductase regulatory subunit M2. 18S = Housekeeping gene.

Statistical analysis

The obtained data were analyzed using t test analysis (version 9.5.1; GraphPad Prism). Results were considered significant at P ≤ .05. Tendency (.05 < P < .1) was also presented. Mean values are given as mean ± SE.

Results

Quantitative real-time PCR

Compared to normal muscle, WB decreased the expression of RRM2 (N vs WB, 1.06 vs 0.69, P = .05) and hydroxymethylbilane synthase (HMBS; 0.86 vs 0.55, P = .002). It also tended to increase the expression of caveolin-3 (CAV-3; 1.41 vs 3.86, P = .09), endoglin (ENG; 1.11 vs 1.76, P = .06), and secreted protein acidic and rich in cysteine (SPARC; 1.04 vs 1.75, P = .09) (Figure 1).

Figure 1
Figure 1

Changes in gene expression (fold change) for severe woody (WB) and normal (N) breast muscles. Ribonucleotide reductase regulatory subunit M2 (RRM2; A) and hydroxymethylbilane synthase (HMBS; B) decreased for WB, while caveolin-3 (CAV-3; C), endoglin (ENG; D), and secreted protein acidic and rich in cysteine (SPARC; E) tended to increase for WB.

Citation: American Journal of Veterinary Research 85, 4; 10.2460/ajvr.23.12.0283

Biochemical assays

Compared to normal muscle, WB reduced RRM2 in muscle tissues (4.25 vs 2.73 ng/mL, P = .002). It also tended to increase homocysteine levels in plasma compared to normal (0.87 vs 1.32 ng/mL, P = .06), while no significant changes in claudin-1 levels in plasma (2.43 vs 2.75 ng/mL) or muscle (4.20 vs 4.26 ng/mL) tissue were observed (Figure 2).

Figure 2
Figure 2

Changes in ribonucleotide reductase regulatory subunit M2 (RRM2; A), homocysteine (B), and claudin-1 levels in plasma (C) and muscle (D) for severe woody (WB) and normal (N) breast muscles. Ribonucleotide reductase regulatory subunit M2 (RRM2) decreased for WB. Homocysteine increased for WB in plasma while no changes in claudin-1 level in muscle or plasma were observed. The concentration of claudin-1 was greater in muscle compared to plasma (P < .05).

Citation: American Journal of Veterinary Research 85, 4; 10.2460/ajvr.23.12.0283

In muscle tissues, WB increased creatine kinase activity (3.21 vs 8.97 nmol/min/mL, P = .05), pyruvate kinase activity (2.69 vs 7.88 nmol/mL, P = .04), triglyceride concentration (2.13 vs 7.2 nmol/μL, P = .002), DNA damage (1.7 vs 2.38 apurinic/apyrimidinic sites per 105 bp, P = .06), and AST activity (941 vs 1,232 pg/mL, P = .02) but reduced ATPase activity (0.56 vs 0.41 nmol/min/μL, P = .01) (Figure 3).

Figure 3
Figure 3

Changes in biochemical parameters of severe woody (WB) and normal (N) breast muscles. WB increased creatine kinase (A), pyruvate kinase (B), triglyceride (C), DNA damage (D), and AST mitochondria (E) but reduced ATPase (F) compared to N. AP = Apurinic/apyrimidinic.

Citation: American Journal of Veterinary Research 85, 4; 10.2460/ajvr.23.12.0283

Discussion

The main findings of the current and our previous study8 suggested that reduced expression of the RRM2 in WB potentially resulted in DNA damage, mitochondria dysfunction, and decreased ATP production in the affected muscle. RRM2 is essential for the synthesis, replication, and repair of DNA,9,10,15 improves mtDNA content and mitochondrial proteins, and lowers ROS production.12,16 Availability of RRM2 is important for normal cellular functioning and reducing tissue damage (Figure 4).11,17

Figure 4
Figure 4

Reduced ribonucleotide reductase regulatory subunit M2 (RRM2) expression increases DNA damage and mitochondria abnormalities including impairing mitochondria DNA (mtDNA) leading to higher reactive oxygen species (ROS) and oxidative damages.

Citation: American Journal of Veterinary Research 85, 4; 10.2460/ajvr.23.12.0283

The results of the current study also suggested that reduction of RRM2 expression in WB caused higher inflammation as evidenced by higher levels of triglyceride, an indicator of higher cellular distress. It has been reported that hypoxia and endoplasmic reticulum distress are present in the WB.18 Any sort of distress impairs immune response and increases tissue damage. It has been reported that mitochondria dysfunction causes lipid metabolism disorders and triglyceride accumulation.19 Furthermore, it is possible that higher homocysteine concentration accelerated WB condition by stimulating ROS levels in muscle tissues,20 which could be also linked to mitochondria abnormalities. Mitochondria have the ability to remove/reduce ROS in the body; therefore, increased ROS in WB is another sign of mitochondria dysfunction.21 Additionally, several other factors that were altered in this study have been related to inflammation and mitochondria dysfunction such as creatine kinase, pyruvate kinase, CAV-3, SPARC, ENG, HMBS, and ATPase. Brief information shows the links between RRM2 and analyzed parameters (Table 2).

Table 2

Parameters analyzed in normal and woody breast (WB) muscle samples.

Parameter Location Known functions
RRM2 All tissues Reduces apoptosis, DNA damage, and mitochondrial dysfunction
AST Mitochondria Reduces oxidative distress
Pyruvate kinase Tricarboxylic acid cycle and mitochondria Glycolysis, generates ATP, and regulates cell metabolism
Triglyceride Mitochondria Source of energy, mitochondrial cytopathy
ATPase Mitochondria Source of energy, mitochondrial membrane drives ATP synthesis
Creatine kinase Mitochondria Provides energy to maintain cellular energy homeostasis
DNA damage All cells including mitochondria Develop, survive, and reproduce cells
Claudin-1 Tight junctions and mitochondria Increased claudin-1 expression in cells with mitochondrial defects leads to high tumor cell invasiveness
CAV-3 Skeleton muscle cells and mitochondria Regulator of mitochondrial homeostasis
ENG Cell surfaces Transforms growth factor-β receptor in endothelial cells; angiogenesis controls by mitochondria
HMBS All tissues Production of heme and mitochondria; increases mitochondria dysfunction if not available
SPARC All tissues Metabolism, tissue regeneration, and functional homeostasis
Homocysteine Methylation cycle and mitochondria Induces mitochondrial dysfunction

AST = Aspartate aminotransferase. CAV-3 = Caveolin-3. ENG = Endoglin. HMBS = Hydroxymethylbilane synthase. SPARC = Secreted protein acidic and rich in cysteine. RRM2 = Ribonucleotide reductase regulatory subunit M2.

CAV-3 (overexpressed in this study) is a gene that makes a protein called caveolin-3. It is associated with mitochondrial membrane structure, cell respiratory function, and generation of ROS.22 However, overexpression of CAV-3 damages muscle tissue by impairing membrane integrity and intracellular myofibril alignment.23 Loss of this barrier function can lead to compromised cellular homeostasis followed by cell death. In the current study, in WB, we observed increased triglyceride levels, which is an effect of higher inflammation in tissues.24 Greater pyruvate kinase activity levels may result from mitochondrial dysfunction.25 In the hypoxic condition when oxygen is limited or when blood supply is disrupted, the body temporarily converts pyruvate into lactate, which allows glucose breakdown and increases ATP production.2628 However, it has been reported that pyruvate kinase increases when birds are under stress, indicating that the muscles of broilers under stress produce more pyruvate to convert to lactate for providing ATP.29 It has been reported that hypoxia and endoplasmic reticulum stress are present in the WB.18 High creatine kinase activity may indicate muscle breakdown and damage,30 and it is a potential biomarker to predict WB in vivo.31 Collectively, alterations to the aforementioned genes and proteins may impair ATP production and increase damage to tissues.

Our current data and a previous study32 indicated that possibly there is a limited supply of oxygen to muscle tissue for WB and that this can be explained by increased homocysteine levels for this group, indicating higher damage to blood vessel walls and reduced HMBS.33 HMBS plays an important role in the production of heme, which is a protein involved in oxygen transport, storage, and metabolism.34 Furthermore, severe HMBS deficiency causes mitochondria dysfunction.35 Homocysteine is a sulfur-containing amino acid formed during the metabolism of methionine to cysteine.36 Increased homocysteine concentrations are linked to greater mtDNA damage.37

Increased SPARC expression in this study may indicate possible mitochondria dysfunction and liver injuries38 in WB. SPARC is essential for cellular functions such as proliferation39 indicating its role in muscle function.40 However, altering the expression of SPARC is associated with tumor growth and aggressiveness39 and mitochondria function.41 Therefore, increased expression of SPARC in WB may indicate greater muscle damage.42

ENG forms a complex with growth factors and other proteins and is involved in the development of blood vessels.43 However, when ENG increases, it could be a sign of loss of cystic fibrosis transmembrane conductance regulator, which functions to help maintain the balance of salt and water in organ tissues.44 It has been reported that there is a possible functional link between mitochondria defects,45 higher fibrosis,46 and lower cystic fibrosis transmembrane conductance regulator expression.46 Greater fibrosis was observed in WB tissue.8

Therefore, lowered expression of RRM2 potentially increased DNA damage and impaired mitochondrial function11,47,48 leading to excessive ROS and tissue damage in WB muscle by altering cellular metabolism and respiration49 resulting in impaired ATP production as we observed in this study.

The results of the current study suggest that lowered expression of RRM2 is a potential factor in the expression of the WB condition in broilers. Decreased RRM2 expression appeared to have major impacts on cell and DNA health and mitochondrial function. Biochemical data in this study suggest that in muscles affected with the WB myopathy impaired mitochondrial function, increased ROS, and reduced blood and oxygen supply may lead to increased hypoxia and oxidative distress in the tissue. Although our knowledge is still limited about the involvement of RRM2 in WB muscle development, this study and our previously published study8 suggest that increasing expression and/or increasing enzymatic activity of RRM2 in the breast muscle could be a potential solution to reduce the incidence and severity of the WB myopathy by improving enzyme activities related to mitochondrial function for protecting muscle cells from hypoxic, oxidative damage to nuclear and mtDNAs.

Acknowledgments

We thank our lab technicians for their support and Dr. Hung-Yueh Yeh for the use of his lab equipment.

Disclosures

All authors have read and agreed to the published version of the manuscript. The authors declare no conflict of interest.

Mention of trade names or commercial products in this publication is solely for the purpose of providing specific information and does not imply recommendation or endorsement by the USDA. USDA is an equal opportunity provider and employer.

No AI-assisted technologies were used in the generation of this manuscript.

Funding

This research was supported in part by an appointment to the Agricultural Research Service (ARS) Research Participation Program administered by the Oak Ridge Institute for Science and Education (ORISE) through an interagency agreement between the US Department of Energy (DOE) and the USDA. ORISE is managed by Oak Ridge Associated University (ORAU) under DOE contract No. DE-SC0014664. All opinions expressed in this paper are the authors' and do not necessarily reflect the policies and views of USDA, DOE, or ORAU/ORISE.

References

  • 1.

    Maharjan P, Hilton K, Weil J, et al. Characterizing woody breast myopathy in a meat broiler line by heat production, microbiota, and plasma metabolites. Front Vet Sci. 2020;6:497. doi:10.3389/fvets.2019.00497

    • Search Google Scholar
    • Export Citation
  • 2.

    Kuttappan V, Hargis B, Owens C. White striping and woody breast myopathies in the modern poultry industry: a review. Poult Sci. 2016;95(11):27242733. doi:10.3382/ps/pew216

    • Search Google Scholar
    • Export Citation
  • 3.

    Greene E, Flees J, Dadgar S, et al. Quantum blue reduces the severity of woody breast myopathy via modulation of oxygen homeostasis-related genes in broiler chickens. Front Physiol. 2019;10:1251. doi:10.3389/fphys.2019.01251

    • Search Google Scholar
    • Export Citation
  • 4.

    Bailey RA, Watson KA, Bilgili S, Avendano S. The genetic basis of pectoralis major myopathies in modern broiler chicken lines. Poult Sci. 2015;94(12):28702879. doi:10.3382/ps/pev304

    • Search Google Scholar
    • Export Citation
  • 5.

    Hisasaga C Jr. Assessing the Accuracy of a Woody Breast Identification Technique and Evaluating the Association between Mitochondria Values to Woody Breast Severity. California State University; 2021.

    • Search Google Scholar
    • Export Citation
  • 6.

    Li B, Dong X, Puolanne E, Ertbjerg P. Effect of wooden breast degree on lipid and protein oxidation and citrate synthase activity of chicken pectoralis major muscle. LWT. 2022;154:112884. doi:10.1016/j.lwt.2021.112884

    • Search Google Scholar
    • Export Citation
  • 7.

    Khan NA, Govindaraj P, Meena AK, Thangaraj K. Mitochondrial disorders: challenges in diagnosis & treatment. Indian J Med Res. 2015;141(1):13. doi:10.4103/0971-5916.154489

    • Search Google Scholar
    • Export Citation
  • 8.

    Shakeri M, Kong B, Zhuang H, Bowker B. Potential role of ribonucleotide reductase enzyme in mitochondria function and woody breast condition in broiler chickens. Animals. 2023;13(12):2038. doi:10.3390/ani13122038

    • Search Google Scholar
    • Export Citation
  • 9.

    Torrents E. Ribonucleotide reductases: essential enzymes for bacterial life. Front Cell Infect Microbiol. 2014;4:52. doi:10.3389/fcimb.2014.00052

    • Search Google Scholar
    • Export Citation
  • 10.

    Chen G, Luo Y, Warncke K, et al. Acetylation regulates ribonucleotide reductase activity and cancer cell growth. Nat Commun. 2019;10(1):3213. doi:10.1038/s41467-019-11214-9

    • Search Google Scholar
    • Export Citation
  • 11.

    Shakeri M, Berisha D, Martinson A, Davis J, Moussavi-Harami F. Ribonucleotide reductase mediated regulation of mitochondrial activity in the adult heart. Biophys J. 2022;121(3):396a397a. doi:10.1016/j.bpj.2021.11.781

    • Search Google Scholar
    • Export Citation
  • 12.

    Fumagalli M, Ronchi D, Bedeschi MF, et al. A novel RRM2B mutation associated with mitochondrial DNA depletion syndrome. Mol Genet Metab Rep. 2022;32:100887. doi:10.1016/j.ymgmr.2022.100887

    • Search Google Scholar
    • Export Citation
  • 13.

    Lax NZ, Turnbull DM, Reeve AK. Mitochondrial mutations: newly discovered players in neuronal degeneration. Neuroscientist. 2011;17(6):645658. doi:10.1177/1073858410385469

    • Search Google Scholar
    • Export Citation
  • 14.

    Tran P, Wanrooij PH, Lorenzon P, et al. De novo dNTP production is essential for normal postnatal murine heart development. J Biol Chem. 2019;294(44):1588915897. doi:10.1074/jbc.RA119.009492

    • Search Google Scholar
    • Export Citation
  • 15.

    Taricani L, Shanahan F, Malinao M-C, Beaumont M, Parry D. A functional approach reveals a genetic and physical interaction between ribonucleotide reductase and CHK1 in mammalian cells. PLoS One. 2014;9(11):e111714. doi:10.1371/journal.pone.0111714

    • Search Google Scholar
    • Export Citation
  • 16.

    Mah V, Alavi M, Márquez-Garbán DC, et al. Ribonucleotide reductase subunit M2 predicts survival in subgroups of patients with non-small cell lung carcinoma: effects of gender and smoking status. PLoS One. 2015;10(5):e0127600. doi:10.1371/journal.pone.0127600

    • Search Google Scholar
    • Export Citation
  • 17.

    Zuo Z, Zhou Z, Chang Y, et al. Ribonucleotide reductase M2 (RRM2): regulation, function and targeting strategy in human cancer. Genes Dis. 2022;11(1):218233.

    • Search Google Scholar
    • Export Citation
  • 18.

    Greene ES, Maynard C, Mullenix G, Bedford M, Dridi S. Potential role of endoplasmic reticulum stress in broiler woody breast myopathy. Am J Physiol Cell Physiol. 2023;324(3):C679C693. doi:10.1152/ajpcell.00275.2022

    • Search Google Scholar
    • Export Citation
  • 19.

    Vankoningsloo S, Piens M, Lecocq C, et al. Mitochondrial dysfunction induces triglyceride accumulation in 3T3-L1 cells: role of fatty acid β-oxidation and glucose. J Lipid Res. 2005;46(6):11331149. doi:10.1194/jlr.M400464-JLR200

    • Search Google Scholar
    • Export Citation
  • 20.

    Wang L, Niu H, Zhang J. Homocysteine induces mitochondrial dysfunction and oxidative stress in myocardial ischemia/reperfusion injury through stimulating ROS production and the ERK1/2 signaling pathway. Exp Ther Med. 2020;20(2):938944. doi:10.3892/etm.2020.8735

    • Search Google Scholar
    • Export Citation
  • 21.

    Czarna M, Jarmuszkiewicz W. Role of mitochondria in reactive oxygen species generation and removal; relevance to signaling and programmed cell death. Postepy Biochem. 2006;52(2):145156.

    • Search Google Scholar
    • Export Citation
  • 22.

    Shah DS, Nisr RB, Stretton C, Krasteva-Christ G, Hundal HS. Caveolin-3 deficiency associated with the dystrophy P104L mutation impairs skeletal muscle mitochondrial form and function. J Cachexia Sarcopenia Muscle. 2020;11(3):838858. doi:10.1002/jcsm.12541

    • Search Google Scholar
    • Export Citation
  • 23.

    Kikuchi T. Caveolin-3: a causative process of chicken muscular dystrophy. Biomolecules. 2020;10(9):1206. doi:10.3390/biom10091206

  • 24.

    Feingold KR, Grunfeld C. The effect of inflammation and infection on lipids and lipoproteins. Endotext, MDText.com, Inc. 2000. Accessed November 20, 2023. https://www.ncbi.nlm.nih.gov/books/NBK326741/

    • Search Google Scholar
    • Export Citation
  • 25.

    Feldman AG, Sokol RJ, Hardison RM, et al. Lactate and lactate: pyruvate ratio in the diagnosis and outcomes of pediatric acute liver failure. J Pediatr. 2017;182:217222. e3. doi:10.1016/j.jpeds.2016.12.031

    • Search Google Scholar
    • Export Citation
  • 26.

    Kolata G. Lactic acid is not muscles' foe, it's fuel. New York Times. May 16, 2006:16.

  • 27.

    Gladden LB. Current trends in lactate metabolism: introduction. Med Sci Sports Exerc. 2008;40(3):475476. doi:10.1249/MSS.0b013e31816154c9

    • Search Google Scholar
    • Export Citation
  • 28.

    Brooks GA, Hashimoto T. Investigation of the lactate shuttle in skeletal muscle mitochondria. J Physiol. 2007;584(2):705. doi:10.1113/jphysiol.2007.142992

    • Search Google Scholar
    • Export Citation
  • 29.

    Zhang Z, Jia G, Zuo J, et al. Effects of constant and cyclic heat stress on muscle metabolism and meat quality of broiler breast fillet and thigh meat. Poult Sci. 2012;91(11):29312937. doi:10.3382/ps.2012-02255

    • Search Google Scholar
    • Export Citation
  • 30.

    Xing T, Xu X, Zhou G, Wang P, Jiang N. The effect of transportation of broilers during summer on the expression of heat shock protein 70, postmortem metabolism and meat quality. J Anim Sci. 2015;93(1):6270. doi:10.2527/jas.2014-7831

    • Search Google Scholar
    • Export Citation
  • 31.

    Kong F, Zhao G, He Z, et al. Serum creatine kinase as a biomarker to predict wooden breast in vivo for chicken breeding. Front Physiol. 2021;12:711711. doi:10.3389/fphys.2021.711711

    • Search Google Scholar
    • Export Citation
  • 32.

    Emami NK, Cauble RN, Dhamad AE, et al. Hypoxia further exacerbates woody breast myopathy in broilers via alteration of satellite cell fate. Poult Sci. 2021;100(7):101167. doi:10.1016/j.psj.2021.101167

    • Search Google Scholar
    • Export Citation
  • 33.

    Wang Y, Zhang J, Patrick K, et al. Hydroxymethylbilane synthase (HMBS) gene-based endogenous internal control for avian species. AMB Express. 2020;10(1):19. doi:10.1186/s13568-019-0926-y

    • Search Google Scholar
    • Export Citation
  • 34.

    Sawicki KT, Chang HC, Ardehali H. Role of heme in cardiovascular physiology and disease. J Am Heart Associ. 2015;4(1):e001138. doi:10.1161/JAHA.114.001138

    • Search Google Scholar
    • Export Citation
  • 35.

    Berger S, Stattmann M, Cicvaric A, et al. Severe hydroxymethylbilane synthase deficiency causes depression-like behavior and mitochondrial dysfunction in a mouse model of homozygous dominant acute intermittent porphyria. Acta Neuropathol Commun. 2020;8(1):117. doi:10.1186/s40478-019-0875-3

    • Search Google Scholar
    • Export Citation
  • 36.

    Kumar A, Palfrey HA, Pathak R, Kadowitz PJ, Gettys TW, Murthy SN. The metabolism and significance of homocysteine in nutrition and health. Nutr Metab (Lond). 2017;14(1):112. doi:10.1186/s12986-016-0156-0

    • Search Google Scholar
    • Export Citation
  • 37.

    Kaplan P, Tatarkova Z, Sivonova MK, Racay P, Lehotsky J. Homocysteine and mitochondria in cardiovascular and cerebrovascular systems. Int J Mol Sci. 2020;21(20):7698. doi:10.3390/ijms21207698

    • Search Google Scholar
    • Export Citation
  • 38.

    Mazzolini G, Atorrasagasti C, Onorato A, et al. SPARC expression is associated with hepatic injury in rodents and humans with non-alcoholic fatty liver disease. Sci Rep. 2018;8(1):725. doi:10.1038/s41598-017-18981-9

    • Search Google Scholar
    • Export Citation
  • 39.

    Zhu A, Yuan P, Du F, et al. SPARC overexpression in primary tumors correlates with disease recurrence and overall survival in patients with triple negative breast cancer. Oncotarget. 2016;7(47):76628. doi:10.18632/oncotarget.10532

    • Search Google Scholar
    • Export Citation
  • 40.

    Jørgensen LH, Jepsen PL, Boysen A, et al. SPARC interacts with actin in skeletal muscle in vitro and in vivo. Am J Pathol. 2017;187(2):457474. doi:10.1016/j.ajpath.2016.10.013

    • Search Google Scholar
    • Export Citation
  • 41.

    Melouane A, Carbonell A, Yoshioka M, Puymirat J, St-Amand J. Implication of SPARC in the modulation of the extracellular matrix and mitochondrial function in muscle cells. PLoS One. 2018;13(2):e0192714. doi:10.1371/journal.pone.0192714

    • Search Google Scholar
    • Export Citation
  • 42.

    Jørgensen LH, Petersson SJ, Sellathurai J, et al. Secreted protein acidic and rich in cysteine (SPARC) in human skeletal muscle. J Histochem Cytochem. 2009;57(1):2939. doi:10.1369/jhc.2008.951954

    • Search Google Scholar
    • Export Citation
  • 43.

    Sugden WW, Meissner R, Aegerter-Wilmsen T, et al. Endoglin controls blood vessel diameter through endothelial cell shape changes in response to haemodynamic cues. Nat Cell Biol. 2017;19(6):653665. doi:10.1038/ncb3528

    • Search Google Scholar
    • Export Citation
  • 44.

    Zeng J-W, Zeng X-L, Li F-Y, et al. Cystic fibrosis transmembrane conductance regulator (CFTR) prevents apoptosis induced by hydrogen peroxide in basilar artery smooth muscle cells. Apoptosis. 2014;19:13171329. doi:10.1007/s10495-014-1014-z

    • Search Google Scholar
    • Export Citation
  • 45.

    Favia M, Atlante A. Mitochondria and cystic fibrosis transmembrane conductance regulator dialogue: some news. J Rare Dis Res Treat. 2016;1(1):2329. doi:10.29245/2572-9411/2016/1.1009

    • Search Google Scholar
    • Export Citation
  • 46.

    Cormet-Boyaka E, Di A, Chang SY, et al. CFTR chloride channels are regulated by a SNAP-23/syntaxin 1A complex. Proc Natl Acad Sci U S A. 2002;99(19):1247712482. doi:10.1073/pnas.192203899

    • Search Google Scholar
    • Export Citation
  • 47.

    Brown A, Pan Q, Fan L, et al. Ribonucleotide reductase subunit switching in hepatoblastoma drug response and relapse. Commun Biol. 2023;6(1):249. doi:10.1038/s42003-023-04630-7

    • Search Google Scholar
    • Export Citation
  • 48.

    Wang X, Liu X, Xue L, et al. Ribonucleotide reductase subunit p53R2 regulates mitochondria homeostasis and function in KB and PC-3 cancer cells. Biochem Biophys Res Commun. 2011;410(1):102107. doi:10.1016/j.bbrc.2011.05.114

    • Search Google Scholar
    • Export Citation
  • 49.

    Salnikova D, Orekhova V, Grechko A, et al. Mitochondrial dysfunction in vascular wall cells and its role in atherosclerosis. Int J Mol Sci. 2021;22(16):8990. doi:10.3390/ijms22168990

    • Search Google Scholar
    • Export Citation
All Time Past Year Past 30 Days
Abstract Views 0 0 0
Full Text Views 751 751 98
PDF Downloads 491 491 55
Advertisement