Equine asthma is a heterogeneous disease in which affected animals react excessively to a vast array of inhaled antigens, including fungal spores, pollens, organic dusts, and endotoxins.1,2 When horses with severe asthma (SEA) are exposed to those airborne particles, mainly through hay feeding, airflow obstruction, neutrophilic airway inflammation, and bronchial wall remodeling occur.3 Among the structural alterations of the bronchial wall, the remodeling of the airway smooth muscle (ASM), including an increase in its mass, is particularly deleterious given its major role in bronchospasm and bronchial lumen narrowing. The ASM thickening arises from muscle hypertrophy and hyperplasia in SEA,4 but the molecular mechanisms responsible for the hyperproliferation of these cells are insufficiently understood. Airway inflammation is the main probable cause of bronchial remodeling, and the degree of neutrophilic inflammation is associated with poorer lung function in SEA.5
Similarly, SEA in humans is often coupled with airway neutrophilia,6 an inflammatory subset associated with several negative clinical outcomes,7 including persistent fixed airway obstruction.8 Equine and human asthma similarities include hyperplasia as the main mechanism responsible for ASM thickening.3,9,10 Elucidating pathways involved in ASM proliferation and in the relationships between inflammatory and structural cells could contribute to a better understanding of asthma pathogenesis and to the development of alternative therapies for human and equine patients.
Neutrophils might act as key components of airway dysfunction through the release of various mediators, including extracellular vesicles (EVs). These nanoscale membrane-derived particles are lipid bilayer structures enriched in proteins, DNA, lipids, and RNA, including microRNA (miR).11 miRs are noncoding short single-stranded RNAs that modulate cell differentiation and proliferation by regulating gene expression posttranscriptionally through the degradation of mRNA or repression of translation.12 Consequently, the internalization of neutrophil EVs and their functional cargo by airway recipient cells could contribute to airway remodeling, including extracellular matrix destruction13 and, importantly, ASM proliferation.14–16 Therefore, the expression of miR related to asthma pathogenesis and smooth muscle remodeling17 was studied in neutrophil-derived exosomes, the smallest form of EVs, collected from horses affected by SEA and healthy animals. More precisely, miRs previously shown to alter ASM biology, including cellular proliferation and production of inflammatory molecules,18–24 were specifically selected. The objectives of this study were to evaluate the expression of these miRs from neutrophil-derived exosomes in SEA and to determine if differentially expressed miRs could modulate ASM biology. Exploring the roles of exosomal miR is warranted as these molecules have the potential to serve as biomarkers for asthma diagnosis and represent a hope for future targeted biological therapy.
Methods
Animals, selection criteria, and exposure protocol
All experimental procedures were performed in accordance with the Canadian Council for Animal Care guidelines and were approved by the Animal Care Committee of the Faculty of Veterinary Medicine of the Université de Montréal (Rech-1324) on October 11, 2016. The datasets generated in the current study are available in the UdeM Dataverse repository, (https://doi.org/10.5683/SP3/9AANYK).
Twelve adult horses (10 mares and 2 castrated males) were studied, including 6 horses with SEA that were part of a research herd and 6 healthy mares that were part of the Université de Montréal teaching herd. The horses affected by SEA had a history of recurrent episodes of respiratory distress upon natural antigenic exposure (hay feeding and stabling), and their disease was confirmed before the inclusion in the research herd by assessing the development of airway obstruction (pulmonary resistance > 1 cm H2O/L/s) and pulmonary inflammation (increased proportion of neutrophils [≥ 25%] in bronchoalveolar lavage fluid) after exposure to hay.25 The control horses had no history of respiratory disease despite hay being the primary component of their diet and did not develop airway neutrophilia or abnormal lung function when stabled and fed hay in previous experiments. Before sampling collection, all horses were antigen exposed by being stabled and fed hay for 1 month, as these conditions are consistent triggers of disease exacerbation in asthmatic horses. Part of the lung function data from horses with SEA had been previously published26 as these horses were included in a randomized controlled clinical trial after the antigenic exposure. The control mares remained free of respiratory signs, but lung function and bronchoalveolar lavage fluid data were not collected in this study.
Neutrophil isolation and culture
After a 40-minute sedimentation of EDTA anticoagulated blood (160 mL/horse) at room temperature, the plasma-rich layer was collected for isolation of peripheral blood neutrophils by density gradient centrifugation using Ficoll-Paque (Ficoll-Paque PREMIUM 1084; GE Healthcare Bio-Sciences Corp) according to the manufacturer's instructions and as previously described.14,16 Cells were counted and viability was assessed using a fluorescence automatic cell counter (ADAM Cell Counter; Montreal-Biotech Inc). Cytospin slides were prepared and stained with Protocol Hema 3 (Fisher) for differential counting of 400 cells to assess neutrophil purity. The purity and viability of neutrophils were 99.1 ± 0.8% and 98.2 ± 0.7%, respectively (mean ± SD), and were deemed adequate to pursue cell culture. Neutrophils (3 X 108 cells/condition) were suspended at 5 X 106 cells/mL in the RPMI 1640 culture medium supplemented with 10% heat-inactivated low-endotoxin and EV-free FBS, 2 mM l-glutamine, 100 U/mL penicillin, and 100 µg/mL streptomycin and cultured in 6-well plates (nontreated plastic) for 18 hours in a CO2 incubator at 37 °C. Supernatants were then kept at −20 °C until the isolation of RNA in exosomal extracts (ExoRNA).
ExoRNA isolation
The RNA from neutrophil exosomes was extracted from the culture supernatant (25 mL) using membrane affinity columns. The first step of centrifugation was performed at 3,000 X g with the Centricon Centrifugal Filter (Millipore; 10 KDa) device and then at 4,000 X g for 25 minutes to concentrate the preparation before exoRNA isolation with the exoRNeasy Kit (Qiagen). The concentration and purity of RNA were evaluated by spectrophotometry (all samples with the 260/280 absorbance ratio > 1.8 and mean and SEM of 2.1 ± 0.1).
miR screening
This investigation focused on the differential regulation of exosomal miRs previously shown to be involved in the biology of ASM cells and in asthma. More specifically, miRs implicated in the modulation of ASM proliferation (miR-21,18,19 miR-143,20 and miR-14521), contraction (miR-2522 and miR-13327), hypertrophy (miR-2628), migration (miR-2118 and miR-14521), gene expression of proinflammatory mediators (miR-25,22 miR-146,23 and miR-15524) and myofibroblast differentiation (let-729) were studied. Reverse transcription and quantitative PCR (qPCR) were performed using TaqMan MicroRNA Assays (Invitrogen) designed specifically for each miR of interest following the manufacturer's instructions (Table 1). Assays were based on human miR sequences, as they were identical to those found in horses (miRbase Sequence Database and Registry; miRbase.org; accessed in November 2016).30 Quantitative PCR was performed by monitoring the increase of fluorescence of FAM dye in real time with the CFX96 Touch Real-Time PCR Detection System (Bio-Rad). The relative amount of target miR was calculated using the comparative delta cycle threshold (ΔCt) method, with the CFX Manager Software (Bio-Rad) using miR-199a as the reference miR, as its expression was stable in the various samples (in the neutrophil exosomes of asthmatic and control horses). The Ct is the number of cycles required for the fluorescence to reach a specific level of detection and is negatively correlated with the amount of nucleic acid present in the sample. In the ΔCt normalization method, the Ct of the reference gene is subtracted from the Ct of the tested gene within each sample31; thus, a lower value represents a higher expression of the gene of interest. All qPCR reactions were performed in duplicate.
Sequences of microRNA assays in equine neutrophil exosomes.
microRNA | Sequence 5'–3' |
---|---|
hsa-miR-21-5p | UAGCUUAUCAGACUGAUGUUGA |
hsa-miR-25-3p | CAUUGCACUUGUCUCGGUCUGA |
hsa-miR-26a-5p | UUCAAGUAAUCCAGGAUAGGCU |
hsa-miR-133a-3p | UUUGGUCCCCUUCAACCAGCUG |
hsa-miR-143-3p | UGAGAUGAAGCACUGUAGCUC |
hsa-miR-145-5p | GUCCAGUUUUCCCAGGAAUCCCU |
hsa-miR-146a-5p | UGAGAACUGAAUUCCAUGGGUU |
hsa-miR-155-5p | UUAAUGCUAAUCGUGAUAGGGGU |
let-7 family | GAGGUAGUAGGUUGUAUAGUU |
hsa-miR-199a-5p | CCCAGUGUUCAGACUACCUGUUC |
Only miR-21 was differentially expressed in horses with SEA compared to controls. Therefore, specific effects of this miR on ASM biology were evaluated in the next experiments, namely the alteration of selected gene expression18 and cellular proliferation.18,19
ASM cell isolation
Bronchial tissues were collected from horses' lungs from a slaughterhouse where death was caused by a gunshot to the head followed by exsanguination. ASM cells were isolated by enzymatic digestion of bronchial tissue, as previously described.32 Experiments were conducted with 6 different lung donors.
miR-21 transfection
The miRs were synthesized by Thermo Fisher Scientific Inc (ID miR-21: 000397; miR Mimic Negative Control: 4464058). Isolated ASM cells (0.25 X 105 for 24-well plate or 14,000 cells for proliferation assay) were first transfected with 30 pmol of each miR using Hiperfect reagent (Qiagen) according to the manufacturer's recommendations. In some experiments, ASM cells were stimulated with lipopolysaccharide (LPS) from Escherichia coli 0:111B4 (100 ng/mL; Sigma-Aldrich) 24 hours after the transfection for 24 hours. ASM cells were studied quiescent and while stimulated with LPS, as inhalation of this omnipresent bacterial fragment leads to airway obstruction and contributes to neutrophilic inflammation in both human and equine asthmatics.1,33–35 Cell extracts were kept in TriZol Reagent (Invitrogen) until RNA extraction.
ASM gene expression analysis
The expression of selected genes previously shown to be modulated by miR-21 and potentially involved in smooth muscle remodeling was evaluated by qPCR. More specifically, the expression of the proinflammatory cytokine C-X-C chemokine ligand 8 (CXCL-8) and of the major inflammatory transcription factor nuclear factor-kappa B (NF-κB) were evaluated as both are regulated by miR-2136,37 and induce ASM proliferation.38,39 The expression of 2 tumor-suppressor genes also regulated by miR-21 was studied due to their reported association with cell-cycle regulation and asthma [programmed cell death 4 (PDCD4)40–42 and phosphatase and tensin homolog deleted on chromosome 10 (PTEN)].18,42 Total RNA extraction was performed on transfected cell extracts prepared using the RNeasy Mini Kit (Qiagen). Three hundred nanograms of total RNA was reverse transcribed using 200 U/μL Superscript III with 40 U/μL RNaseOUT Recombinant Ribonuclease Inhibitor and Oligo(dt) Primer (final concentration of 2.5 μM; all from Invitrogen). Samples were reverse transcribed and purified in duplicate. Quantitative PCR was performed using the Rotor-Gene RG3000 (Corbett Research) with the QuantiTect SYBR Green PCR Kit (Qiagen) according to the manufacturer's instructions, with minor modifications. Briefly, 2 μL of cDNA template was added to obtain a 20-μL final reaction volume containing 0.5 μM forward and reverse primers. Amplification conditions included a denaturation step of 10 minutes at 95 °C followed by 45 cycles of denaturation, annealing and elongation steps, and 1 melting curve. The concentration of each target gene cDNA was calculated relative to its standard curve and then normalized with the reference gene ribosomal protein L9. Primers were designed based on the predicted equine sequence to span exon-intron boundaries and to prevent amplification of genomic DNA (Table 2). PDCD4 primers were designed to amplify the 4 predicted equine mRNA isoforms. Each primer set generated only 1 PCR product, and the identity and integrity of these products were confirmed by sequencing. Samples were run in duplicate with negative controls.
Sequences of primer pairs used for the airway smooth muscle gene expression analysis.
Target | Primer sequence (5'–3') |
---|---|
PDCD4 | F: GCAGCTCTAGCCTGTACA |
R: CTCCTAGAGCACCACAGTT | |
PTEN | F: CTTTGAGTTCCCTCAGCCGT |
R: AGGTTTCCTCTGGTCCTGGT | |
NF-κB | F: ACTTTGAAGGCTGTACCCAGT |
R: CACCAGCAGATCTAGGCACTC | |
CXCL-8 | F: CTTTCTGCAGCTCTGTGTGAAG |
R: GCAGACCTCAGCTCCGTTGAC | |
RPL9 | F: TCTCAGCAATCAGACCGTCG |
R: TGTCAACTCGGAGCCTCTTC |
CXCL-8 = C-X-C chemokine ligand 8. F = Forward. NF-κB = Nuclear factor-kappa B. PDCD4 = Programmed cell death 4. PTEN = Phosphatase and tensin homolog deleted on chromosome 10. R = Reverse. RPL9 = Ribosomal protein L9.
Smooth muscle proliferation assay
Proliferation of the transfected ASM cells was monitored in real time by electrical impedance using the xCELLigence RTCA-DP instrument and E-Plates 16 (ACEA Biosciences Inc), as previously reported.14,16 Briefly, gold electrodes at the bottom of each well measure the electrical impedance generated from cell proliferation, which is reported as a cell index (CI). The ASM cells were first grown at 37 °C in a humidified atmosphere with 5% CO2 and monitored for 24 hours to assess baseline cell proliferation. Cells were then transfected with miR-21 or the Mimic Negative Control 24 hours after the ASM were seeded. LPS was added in some wells as described above 24 hours later. At the end of the culture period (72 hours), the final CI was normalized to the last CI recorded before the time of cell transfection. The rate of cell growth was represented by the slope of the line between the time before cell transfection until 24 hours after the LPS treatment (24 to 72 hours), which was calculated by the XCELLigence software (version 1.2.1; Agilent).
Statistical analysis
Normality of the data was analyzed with Shapiro-Wilk tests and QQ plot visualization. Data were analyzed with unpaired t test (or Mann-Whitney tests if not normally distributed) for miR expression analysis between asthmatic and healthy horses and with paired (or Wilcoxon tests if not normally distributed) for proliferation analysis and for gene expression studies of ASM cells. Statistical analyses were performed using GraphPad Prism software (version 10.1.0). Differences were considered statistically significant at P < .05.
Results
Clinical information
The 6 horses affected with SEA were aged 13.5 ± 3.2 years and weighed 510 ± 57 kg, while the 6 healthy mares were aged 13.5 ± 4.7 years and weighed 518 ± 34 kg (no difference between groups). After the antigenic exposure, all horses with SEA had pulmonary resistance above 1 cm H2O/L/s (mean of 2.2 ± 1.2 cm H2O/L/s), confirming the development of an asthma exacerbation.
Neutrophil exosomal miR content
All selected miRs were detected in exosomal extracts, but only miR-21 was differentially expressed, with a decreased expression in neutrophil exosomes from asthmatic animals compared to controls (Figure 1).
ASM cell gene expression
The miR-21 transfection into ASM cells did not significantly modify the gene expression of CXCL-8, NF-κB, PTEN, and PDCD4 in unstimulated and LPS-treated ASM cells (Figure 2).
ASM cell proliferation
To study the possible contribution of miR-21 to bronchial smooth muscle cell hyperplasia, ASM cell proliferation was assessed in unstimulated and LPS-treated cells. The proliferation of ASM cells transfected with miR-21 was inhibited in the LPS-stimulated condition (P < .05, Figure 3), but not in unstimulated ASM cells.
Discussion
This investigation focused on the differential regulation of exosomal miRs previously shown to be involved in the biology of ASM cells and in asthma in other species. Within the selected miRs, only miR-21 was differentially expressed as it was downregulated in neutrophil exosomes of horses affected by SEA compared to controls. The transfection of miR-21 decreased ASM proliferation of cells stimulated by LPS, suggesting that the low miR-21 level in neutrophil exosomes from asthmatic horses might have a role in promoting ASM hyperproliferation.
Although the miR-21 expression in exosomes of peripheral neutrophils has not been specifically investigated in humans with asthma, there are conflicting reports of its expression in plasma and in pulmonary fluid. Most studies43–45 reported an upregulation of circulating miR-21 in the plasma of asthmatic children and adults, with levels correlating with poor lung function and with the severity of the disease. Others46 observed that miR-21 expression was upregulated in the serum exosomes of moderate to severe asthmatics compared to mild asthmatics but that it was lower in the patients with elevated levels of IL-6, a cytokine associated with higher blood neutrophilia. On the contrary, a lower expression of miR-21 in pulmonary fluid exosomes from human asthmatic patients was reported,47 which is consistent with the downregulation of miR-21 in the peripheral neutrophils in SEA in the current study. Studying the exosomes from equine airway neutrophils would have been relevant as endothelial transmigration of these leukocytes might modify their biological functions,48 and perhaps their cellular content in EVs, but thus far, the isolation of neutrophils from the bronchoalveolar lavage fluid does not reach sufficient purity in the equine species.49
The expression of miR-21 has also been investigated in ASM cells, where it was upregulated in both humans18 and horses with asthma.50 The overall biologic implication of this reported miR-21 overexpression in ASM and the downregulation in neutrophil-derived exosomes in the current study is uncertain. Such an equilibrium may prevent uncontrolled ASM cell hyperproliferation, which could lead to airway occlusion in asthma. Contrary to the decreasing ASM proliferation associated with miR-21 in the current study in horses, the overexpression of miR-21 in human ASM cells leads to hyperproliferation.18,19 This finding suggests that the mRNA target of miR-21 might differ between humans and horses and that its effects cannot be directly compared between these 2 species.
ASM cells were studied quiescent and while stimulated with LPS as it contributes to the development of asthma exacerbation in both human34 and equine asthmatics,33 although it is not a major trigger of the disease on its own. In the current study, the reduced proliferation induced by miR-21 only observed in LPS-stimulated ASM cells is more likely a reflection of low power to detect the same change in quiescent cells rather than a more potent effect of miR-21 in stimulated ASM cells. Indeed, LPS stimulation did not increase equine ASM proliferation in the current experiments, which is consistent with previous results.14 Exploring the effects of miR-21 transfection on equine ASM stimulated with mitogens present in neutrophilic asthma, such as transforming growth factor-β,51 interleukin-17,39 and CXCL-8,38 would be relevant in future studies.
The main limitation of this study is the low number of horses included and cell experiments performed. This could have prevented the detection of a statistically significant effect of LPS on the regulation of CXCL-8 and NF-κB, as it was increased in all cell cultures, as expected based on the literature, but not significantly.52,53 Furthermore, the role of miR-21 on other asthma remodeling features was not evaluated, such as its possible effect on muscle contractility, epithelial-to-mesenchymal transition, and pathological fibrosis.54 Finally, this study evaluated the effects of miR-21 transfection in ASM obtained from nonasthmatic animals. Determining if its actions differ in asthmatic ASM, in which miR-21 is upregulated,50 would be relevant in future investigations.
In conclusion, the downregulation of miR-21 in neutrophil-derived exosomes from asthmatic horses exposed to an antigenic environment could contribute to ASM proliferation in this species.
Acknowledgments
None reported.
Disclosures
The authors have nothing to disclose. No AI-assisted technologies were used in the generation of this manuscript.
Funding
This research was funded by the Canadian Institutes of Health Research (grant No. MOP-102751)
References
- 1.↑
Pirie RS, Collie DD, Dixon PM, McGorum BC. Inhaled endotoxin and organic dust particulates have synergistic proinflammatory effects in equine heaves (organic dust-induced asthma). Clin Exp Allergy. 2003;33(5):676–683. doi:10.1046/j.1365-2222.2003.01640.x
- 2.↑
Bullone M, Murcia RY, Lavoie JP. Environmental heat and airborne pollen concentration are associated with increased asthma severity in horses. Equine Vet J. 2016;48(4):479–484. doi:10.1111/evj.12559
- 3.↑
Bullone M, Lavoie JP. Asthma “of horses and men”—how can equine heaves help us better understand human asthma immunopathology and its functional consequences? Mol Immunol. 2015;66(1):97–105. doi:10.1016/j.molimm.2014.12.005
- 4.↑
Leclere M, Lavoie-Lamoureux A, Gelinas-Lymburner E, David F, Martin JG, Lavoie JP. Effect of antigenic exposure on airway smooth muscle remodeling in an equine model of chronic asthma. Am J Respir Cell Mol Biol. 2011;45(1):181–187. doi:10.1165/rcmb.2010-0300OC
- 5.↑
Mainguy-Seers S, Boivin R, Pourali Dogaheh S, et al. Effects of azithromycin on bronchial remodeling in the natural model of severe neutrophilic asthma in horses. Sci Rep. 2022;12(1):446. doi:10.1038/s41598-021-03955-9
- 6.↑
Ordonez CL, Shaughnessy TE, Matthay MA, Fahy JV. Increased neutrophil numbers and IL-8 levels in airway secretions in acute severe asthma: clinical and biologic significance. Am J Respir Crit Care Med. 2000;161(4):1185–1190. doi:10.1164/ajrccm.161.4.9812061
- 7.↑
Ray A, Kolls JK. Neutrophilic inflammation in asthma and association with disease severity. Trends Immunol. 2017;38(12):942–954. doi:10.1016/j.it.2017.07.003
- 8.↑
Smith BM, Zhao N, Olivenstein R, Lemiere C, Hamid Q, Martin JG. Asthma and fixed airflow obstruction: long-term trajectories suggest distinct endotypes. Clin Exp Allergy. 2021;51(1):39–48. doi:10.1111/cea.13714
- 9.↑
Elliot JG, Jones RL, Abramson MJ, et al. Distribution of airway smooth muscle remodelling in asthma: relation to airway inflammation. Respirology. 2015;20(1):66–72. doi:10.1111/resp.12384
- 10.↑
James AL, Elliot JG, Jones RL, et al. Airway smooth muscle hypertrophy and hyperplasia in asthma. Am J Respir Crit Care Med. 2012;185(10):1058–1064. doi:10.1164/rccm.201110-1849OC
- 11.↑
Kolonics F, Szeifert V, Timar CI, Ligeti E, Lorincz AM. The functional heterogeneity of neutrophil-derived extracellular vesicles reflects the status of the parent cell. Cells. 2020;9(12):2718. doi:10.3390/cells9122718
- 12.↑
Jonas S, Izaurralde E. Towards a molecular understanding of microRNA-mediated gene silencing. Nat Rev Genet. 2015;16(7):421–433. doi:10.1038/nrg3965
- 13.↑
Genschmer KR, Russell DW, Lal C, et al. Activated PMN exosomes: pathogenic entities causing matrix destruction and disease in the lung. Cell. 2019;176(1–2):113–126. doi:10.1016/j.cell.2018.12.002
- 14.↑
Vargas A, Roux-Dalvai F, Droit A, Lavoie JP. Neutrophil-derived exosomes: a new mechanism contributing to airway smooth muscle remodeling. Am J Respir Cell Mol Biol. 2016;55(3):450–461. doi:10.1165/rcmb.2016-0033OC
- 15.
Zhang XY, Chen ZC, Li N, et al. Exosomal transfer of activated neutrophil-derived lncRNA CRNDE promotes proliferation and migration of airway smooth muscle cells in asthma. Hum Mol Genet. 2021;31(4):638–650.
- 16.↑
Mainguy-Seers S, Beaudry F, Fernandez-Prada C, Martin JG, Lavoie JP. Neutrophil extracellular vesicles and airway smooth muscle proliferation in the natural model of severe asthma in horses. Cells. 2022;11(21):3347. doi:10.3390/cells11213347
- 17.↑
Joshi SR, Comer BS, McLendon JM, Gerthoffer WT. MicroRNA regulation of smooth muscle phenotype. Mol Cell Pharmacol. 2012;4(1):1–16.
- 18.↑
Liu Y, Yang K, Shi H, et al. MiR-21 modulates human airway smooth muscle cell proliferation and migration in asthma through regulation of PTEN expression. Exp Lung Res. 2015;41(10):535–545. doi:10.3109/01902148.2015.1090501
- 19.↑
Sun P, Zhang S, Wu D, Qian Y, Xiao X, Zhang Q. MiR-21 modulates proliferation and apoptosis of human airway smooth muscle cells by regulating autophagy via PARP-1/AMPK/mTOR signalling pathway. Respir Physiol Neurobiol. 2022;301:103891. doi:10.1016/j.resp.2022.103891
- 20.↑
Cheng W, Yan K, Xie LY, et al. MiR-143-3p controls TGF-beta1-induced cell proliferation and extracellular matrix production in airway smooth muscle via negative regulation of the nuclear factor of activated T cells 1. Mol Immunol. 2016;78:133–139. doi:10.1016/j.molimm.2016.09.004
- 21.↑
Liu Y, Sun X, Wu Y, et al. Effects of miRNA-145 on airway smooth muscle cells function. Mol Cell Biochem. 2015;409(1–2):135–143. doi:10.1007/s11010-015-2519-7
- 22.↑
Kuhn AR, Schlauch K, Lao R, Halayko AJ, Gerthoffer WT, Singer CA. MicroRNA expression in human airway smooth muscle cells: role of miR-25 in regulation of airway smooth muscle phenotype. Am J Respir Cell Mol Biol. 2010;42(4):506–513. doi:10.1165/rcmb.2009-0123OC
- 23.↑
Comer BS, Camoretti-Mercado B, Kogut PC, Halayko AJ, Solway J, Gerthoffer WT. MicroRNA-146a and microRNA-146b expression and anti-inflammatory function in human airway smooth muscle. Am J Physiol Lung Cell Mol Physiol. 2014;307(9):L727–L734. doi:10.1152/ajplung.00174.2014
- 24.↑
Comer BS, Camoretti-Mercado B, Kogut PC, Halayko AJ, Solway J, Gerthoffer WT. Cyclooxygenase-2 and microRNA-155 expression are elevated in asthmatic airway smooth muscle cells. Am J Respir Cell Mol Biol. 2015;52(4):438–447. doi:10.1165/rcmb.2014-0129OC
- 25.↑
Couetil LL, Cardwell JM, Gerber V, Lavoie JP, Léguillette R, Richard EA. Inflammatory airway disease of horses–revised consensus statement. J Vet Intern Med. 2016;30(2):503–515. doi:10.1111/jvim.13824
- 26.↑
Mainguy-Seers S, Picotte K, Lavoie JP. Efficacy of tamoxifen for the treatment of severe equine asthma. J Vet Intern Med. 2018;32(5):1748–1753. doi:10.1111/jvim.15289
- 27.↑
Chiba Y, Tanabe M, Goto K, Sakai H, Misawa M. Down-regulation of miR-133a contributes to up-regulation of Rhoa in bronchial smooth muscle cells. Am J Respir Crit Care Med. 2009;180(8):713–719. doi:10.1164/rccm.200903-0325OC
- 28.↑
Mohamed JS, Lopez MA, Boriek AM. Mechanical stretch up-regulates microRNA-26a and induces human airway smooth muscle hypertrophy by suppressing glycogen synthase kinase-3beta. J Biol Chem. 2010;285(38):29336–29347. doi:10.1074/jbc.M110.101147
- 29.↑
Di T, Yang Y, Fu C, et al. Let-7 mediated airway remodelling in chronic obstructive pulmonary disease via the regulation of IL-6. Eur J Clin Invest. 2021;51(4):e13425. doi:10.1111/eci.13425
- 30.↑
Kozomara A, Birgaoanu M, Griffiths-Jones S. miRBase: from microRNA sequences to function. Nucleic Acids Res. 2019;47(D1):D155–D162. doi:10.1093/nar/gky1141
- 31.↑
Antonov J, Goldstein DR, Oberli A, et al. Reliable gene expression measurements from degraded RNA by quantitative real-time PCR depend on short amplicons and a proper normalization. Lab Invest. 2005;85(8):1040–1050. doi:10.1038/labinvest.3700303
- 32.↑
Vargas A, Peltier A, Dube J, et al. Evaluation of contractile phenotype in airway smooth muscle cells isolated from endobronchial biopsy and tissue specimens from horses. Am J Vet Res. 2017;78(3):359–370. doi:10.2460/ajvr.78.3.359
- 33.↑
Pirie RS, Dixon PM, Collie DD, McGorum BC. Pulmonary and systemic effects of inhaled endotoxin in control and heaves horses. Equine Vet J. 2001;33(3):311–318. doi:10.2746/042516401776249732
- 34.↑
Michel O, Ginanni R, Duchateau J, Vertongen F, Le Bon B, Sergysels R. Domestic endotoxin exposure and clinical severity of asthma. Clin Exp Allergy. 1991;21(4):441–448. doi:10.1111/j.1365-2222.1991.tb01684.x
- 35.↑
Thorne PS, Mendy A, Metwali N, et al. Endotoxin exposure: predictors and prevalence of associated asthma outcomes in the United States. Am J Respir Crit Care Med. 2015;192(11):1287–1297. doi:10.1164/rccm.201502-0251OC
- 36.↑
Kim RY, Sunkara KP, Bracke KR, et al. A microRNA-21-mediated SATB1/S100A9/NF-kappaB axis promotes chronic obstructive pulmonary disease pathogenesis. Sci Transl Med. 2021;13(621):eaav7223. doi:10.1126/scitranslmed.aav7223
- 37.↑
Liu R, Du J, Zhou J, et al. Elevated microRNA-21 is a brake of inflammation involved in the development of nasal polyps. Front Immunol. 2021;12:530488. doi:10.3389/fimmu.2021.530488
- 38.↑
Halwani R, Al-Abri J, Beland M, et al. CC and CXC chemokines induce airway smooth muscle proliferation and survival. J Immunol. 2011;186(7):4156–4163. doi:10.4049/jimmunol.1001210
- 39.↑
Chang Y, Al-Alwan L, Risse PA, et al. Th17-associated cytokines promote human airway smooth muscle cell proliferation. FASEB J. 2012;26(12):5152–5160. doi:10.1096/fj.12-208033
- 40.↑
Lin Y, Liu X, Cheng Y, Yang J, Huo Y, Zhang C. Involvement of microRNAs in hydrogen peroxide-mediated gene regulation and cellular injury response in vascular smooth muscle cells. J Biol Chem. 2009;284(12):7903–7913. doi:10.1074/jbc.M806920200
- 41.↑
Binia A, Van Stiphout N, Liang L, et al. A polymorphism affecting MYB binding within the promoter of the PDCD4 gene is associated with severe asthma in children. Hum Mutat. 2013;34(8):1131–1139. doi:10.1002/humu.22340
- 42.↑
Kwak YG, Song CH, Yi HK, et al. Involvement of PTEN in airway hyperresponsiveness and inflammation in bronchial asthma. J Clin Invest. 2003;111(7):1083–1092. doi:10.1172/JCI16440
- 43.↑
Kang Y, Bai M, Deng L, Fan L, Wang X. MiRNA-21 regulates bronchial epithelial cell proliferation by activating Tgfbeta1/Smad signaling pathway and its correlation with asthma severity in children. Iran J Public Health. 2021;50(10):1973–1982.
- 44.
Hammad Mahmoud Hammad R, Hamed D, Eldosoky M, et al. Plasma microRNA-21, microRNA-146a and IL-13 expression in asthmatic children. Innate Immun. 2018;24(3):171–179. doi:10.1177/1753425918763521
- 45.↑
Soccio P, Moriondo G, Lacedonia D, et al. MiRNA and exosomal miRNA as new biomarkers useful to phenotyping severe asthma. Biomolecules. 2023;13(10):1542. doi:10.3390/biom13101542
- 46.↑
Vazquez-Mera S, Martelo-Vidal L, Miguens-Suarez P, et al. Serum exosome inflamma-miRs are surrogate biomarkers for asthma phenotype and severity. Allergy. 78(1):141–155, 2022. doi:10.1111/all.15480
- 47.↑
Levanen B, Bhakta NR, Paredes PT, et al. Altered microRNA profiles in bronchoalveolar lavage fluid exosomes in asthmatic patients. J Allergy Clin Immunol. 2013;131(3):894–903. doi:10.1016/j.jaci.2012.11.039
- 48.↑
Luo D, McGettrick HM, Stone PC, Rainger GE, Nash GB. The roles of integrins in function of human neutrophils after their migration through endothelium into interstitial matrix. PLoS One. 2015;10(2):e0118593. doi:10.1371/journal.pone.0118593
- 49.↑
Brazil TJ. Pulmonary Neutrophil Recruitment, Activation and Clearance in Equine Chronic Obstructive Pulmonary Disease. Edinburgh, Scotland: The University of Edinburgh, 1999:365.
- 50.↑
Issouf M, Vargas A, Boivin R, Lavoie JP. MicroRNA-221 is overexpressed in the equine asthmatic airway smooth muscle and modulates smooth muscle cell proliferation. Am J Physiol Lung Cell Mol Physiol. 2019;317(6):L748–L757. doi:10.1152/ajplung.00221.2018
- 51.↑
Xie S, Sukkar MB, Issa R, Khorasani NM, Chung KF. Mechanisms of induction of airway smooth muscle hyperplasia by transforming growth factor-β. Am J Physiol Lung Cell Mol Physiol. 2007;293(1):L245–L253. doi:10.1152/ajplung.00068.2007
- 52.↑
Issa R, Sorrentino R, Sukkar MB, Sriskandan S, Chung KF, Mitchell JA. Differential regulation of CCL-11/eotaxin-1 and CXCL-8/IL-8 by gram-positive and gram-negative bacteria in human airway smooth muscle cells. Respir Res. 2008;9(1):30. doi:10.1186/1465-9921-9-30
- 53.↑
Shan X, Hu A, Veler H, et al. Regulation of Toll-like receptor 4-induced proasthmatic changes in airway smooth muscle function by opposing actions of ERK1/2 and p38 MAPK signaling. Am J Physiol Lung Cell Mol Physiol. 2006;291(3):L324–L333. doi:10.1152/ajplung.00056.2006
- 54.↑
Jiang C, Guo Y, Yu H, et al. Pleiotropic microRNA-21 in pulmonary remodeling: novel insights for molecular mechanism and present advancements. Allergy Asthma Clin Immunol. 2019;15:33. doi:10.1186/s13223-019-0345-2