Synovitis is a well-known joint disease that causes osteoarthritis (OA). In horses, persistent synovitis associated with orthopedic conditions, such as fractures, can secondarily damage the articular cartilage and causes persistent OA,1–3 the onset of which leads to recurrent lameness and poor athletic performance.1,2 The direct and indirect medical costs associated with OA are $3,000 to $15,000/y per affected horse in the US alone, resulting in shortened equine career spans.2,4,5 Therefore, an effective treatment for persistent synovitis is needed.
Recently, platelet-rich plasma (PRP) or its derivative, termed platelet lysate (PL), has been injected into joints with OA, and many favorable results have been reported in both human and veterinary medicine.6–9 Platelet-rich plasma is a concentrated platelet solution in plasma derived from autologous whole blood. Platelets in PRP contain various therapeutic ingredients, including PDGF-BB and TGF-β1.10 Platelet lysate is produced by disrupting the platelets by repeated freeze-thaw cycles. The abovementioned components that promote various healing processes around the site of administration are more abundant in PL than in PRP supernatant.8,10,11 In equine medicine, therapy with PRP or PL has been used in various orthopedic conditions. There have been some reports that PRP administration promotes tissue repair,12–14 but the anti-inflammatory effect of PRP is still controversial.15–17
To validate the anti-inflammatory effect of PRP on synovitis in vivo, an administration test must be conducted in a reproducible synovitis model. In horses, the arthritis induced by monoiodoacetic acid (MIA) IA injection lasts for 1 month. Therefore, the MIA-induced arthritis model is considered suitable for investigating persistent synovitis in this species.18–20
Here, we aimed to clarify the anti-inflammatory effect of PL on equine persistent synovitis by using a model of persistent synovitis induced by MIA. We hypothesized that multiple IA administration of PL would reduce the levels of inflammatory biomarkers in the MIA model and attenuate the persistent synovitis.
Methods
Animals
We selected and used 6 clinically healthy Thoroughbreds on the basis of the results of general clinical and gait evaluations as well as radiographic and ultrasonographic examinations of the carpal joints (3 males, 1 female, and 2 geldings; age, 4.3 ± 2.3 years; weight, 496.8 ± 31.1 kg; mean ± SD). The Animal Welfare and Ethics Committee of the Equine Research Institute of the Japan Racing Association approved all of our experimental procedures (authorization No. 21-6). All procedures were performed under sedation with medetomidine hydrochloride (5 μg/kg, IV), and prophylactic penicillin was administered IM in the neck after arthrocentesis. The horses were confined to stall rest during the study period.
Preparation of PL
Autologous PRP was prepared 1 week before administration by using a double-spin method.21 Whole-blood samples (70 mL) were obtained from the jugular vein by using a disposable polypropylene syringe containing 10% sodium citrate anticoagulant. Equal amounts of blood (10 mL) were dispensed into 7 polypropylene tubes and centrifuged at 400 X g for 7 minutes at 4 °C. The plasma fraction in each tube was transferred into another polypropylene tube and centrifuged at 2,000 X g for 7 minutes at 4 °C. The supernatant was then discarded, leaving 1 mL at the bottom of each tube, and the pellet was resuspended in the remaining supernatant to prepare PRP. The concentrations of platelets and leucocytes in the PRP were determined by using an automated blood-cell counter (thinka CB-1010; ARKRAY Co Ltd Inc). To prepare PL, the final PRP was cryopreserved at −30 °C, completely thawed at room temperature the day before administration, frozen again at −30 °C overnight, and thawed again at room temperature just before administration in order to activate the platelets and release growth factors into the supernatant.11 Thereafter, the PL was centrifuged at 10,000 X g for 5 minutes at 4 °C, and the supernatant was injected into the joint or used for growth factor analysis by ELISA (PDGF-BB, Quantikine Human PDGF-BB ELISA DBB00; TGF-β1, Quantikine Human TGF-β1 ELISA DB100B; R&D Systems). Although these kits are designed to test human samples, they have been validated for use in horses.11,14,22,23 The concentrations of these proteins were quantified within 3 months of preparation, during which time they are considered to be unaffected by cryopreservation.24
Platelet lysate administration in MIA model and sampling
A simple schema of the experiment is presented in Figure 1. After we had collected synovial fluid (2 mL) via aseptic arthrocentesis, synovitis was induced by administering MIA (0.18 mg/kg body weight) dissolved in 2 mL of saline (0.9% NaCl) solution into both antebrachiocarpal joints of each horse. On days 23, 30, and 37, PL (2 mL) was injected into 1 joint (PL group), and 2 mL of saline was injected into the contralateral joint (saline group). Carpal circumference was measured, and synovial fluid was collected just before PL or saline administration.
Schema of the study design. Synovitis was induced in both carpi by IA administration of monoiodoacetic acid (MIA) on day 0. On day 23, measurement of carpal circumference, synovial fluid sampling, and drug administration were performed and then repeated weekly. The horses were euthanized and synovial fluid collected on day 44. PL = Platelet lysate.
Citation: American Journal of Veterinary Research 85, 11; 10.2460/ajvr.24.03.0090
On day 44, the horses were euthanized by using sodium thiopental and suxamethonium chloride hydrate under sedation. Synovium was collected for histological and gene expression analyses. Synovial fluid was also collected by arthrocentesis immediately after euthanasia.
The concentration of leucocytes in the collected synovial fluid was determined by using a blood-cell counter (thinka CB-1010; ARKRAY Co Ltd Inc). The LDH level was measured by using a biochemical analyzer (DRI-CHEM NX500V; FUJIFILM Corp), and the concentrations of tumor necrosis factor-α (TNF-α) and TGF-β1 were measured by using ELISA kits (TNF-α, Equine Duoset ELISA DY1814; R&D Systems). The rate of change in these values from day 23 to each succeeding timepoint (change ratio) was calculated and used to compare concentrations between the PL and saline groups.
Carpal circumference
Carpal circumference was measured at the level of the distal end of the radius, by using a tape measure. The measurement of carpal circumference was performed blindly by 2 clinical equine veterinarians. The amount of change was compared by subtracting the value at day 23 from the value at each timepoint.
Histological examination
Synovial tissues for histological analysis were fixed in 4% paraformaldehyde phosphate buffer solution at 4 °C for 72 hours. This was followed by paraffin block preparation. Serial 3-µm sections were obtained from each block and stained with H&E. In addition, tartrate-resistant acid phosphatase staining was performed to identify osteoclasts. The number of tartrate-resistant acid phosphatase–positive cells in synovial tissue was counted and compared.
Gene expression analysis
Expression levels of inflammation-related genes in synovial tissues were quantified by real-time reverse transcription PCR. The collected synovial tissue was immediately frozen in liquid nitrogen and cryopreserved at −80 °C until mRNA extraction by using an isolation kit (NucleoSpin RNA Plus; MACHEREY-NAGEL GmbH & Co KG). Extracted mRNA (0.2 μg) was used to synthesize cDNA by using a cDNA synthesis kit (iScript gDNA Clear cDNA Synthesis Kit; Bio-Rad Laboratories Inc). This was then analyzed by a real-time reverse transcription PCR system (LightCycler 480 II; Roche Diagnostics). The amplification program included an initial denaturation step at 95 °C for 10 minutes, followed by 45 cycles of denaturation at 95 °C for 10 seconds and annealing/extension at 60 °C for 30 seconds. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) mRNA levels were used as an internal control. Each mRNA sample was normalized to GAPDH by subtracting the cycle threshold (Ct) value of GAPDH from the Ct value of the target gene (ΔCt).
The following gene expression levels were quantified: matrix metalloproteinase-13 (MMP13), a disintegrin and metalloproteinase with thrombospondin motifs 4, receptor activator of nuclear factor κ-Β ligand (RANKL), and collagen type I α2 chain (Col1a2). Equine-specific primers and probes were synthesized by FASMAC Inc (Table 1).
Primer and probe sequences used for real-time PCR.
| Target gene | Primer sequence (5'–3') | Probe (5'–3') | |
|---|---|---|---|
| GAPDH | F | AAGCTTGTCATCAACGGAAAG | CATCACCA |
| R | TTGATGTTGGCGGGATCT | ||
| MMP13 | F | ACACCAGACAAATGCGATCC | TTGATGCC |
| R | TTGTTTCTCCTCGAAGACTGG | ||
| ADAMTS4 | F | TGTGGGCACTGTGTGTGAC | GGAGGATG |
| R | GCAGTGAAGGCAGACTGGA | ||
| RANKL | F | CTTCAGGAGACCTCGCTACG | GCTGATGG |
| R | TTGGGATTTTGATGCTGGTT | ||
| Col1a2 | F | CTGGAGAGCCTGGTACTGCT | CCTCCTGG |
| R | CGCCGAGAAGACCTTGAG |
ADAMTS4 = A disintegrin and metalloproteinase with thrombospondin motifs 4. Col1a2 = Collagen type I α2 chain. GAPDH = Glyceraldehyde-3-phosphate dehydrogenase. MMP13 = Matrix metalloproteinase 13. RANKL = Receptor activator of nuclear factor κ-Β ligand.
Statistical analyses
The numbers of osteoclasts and the values of each biomarker (leucocytes, LDH, TNF-α, and TGF-β1) on day 23 were compared by using paired t tests. The other values obtained were compared between the PL and saline groups by using the Wilcoxon signed-rank test.
Analyses were performed by using a Microsoft Excel Macro software product (Excel TOKEI, version 7.0; ESUMI Co Ltd). Statistical significance was set at the 95% level (P < .05).
Results
Platelet-rich plasma components and growth factor concentrations in PL
In the PRP, the platelet count was 721.0 ± 147.1 X 109/L (mean ± SD), and the leucocyte count was 1.0 ± 1.6 X 109/L. The platelet and leucocyte concentrations in the PRP were, respectively, 7.6 ± 2.7 and 0.1 ± 0.2 times higher than those in whole blood. The concentrations of growth factors in the PL were quantified 51.2 ± 26.0 days after PRP creation. The PL contained 4.7 ± 2.8 ng/mL PDGF-BB and 16.7 ± 4.6 ng/mL TGF-β1.
Inflammatory biomarkers in synovial fluid
The values of each biomarker on day 23 were as follows: leucocytes, saline 1.3 ± 1.0 X 109/L, PL 1.1 ± 0.9 X 109/L (mean ± SD); LDH, saline 1,062.3 ± 521.8 U/L, PL 1,153.5 ± 566.9 U/L; TNF-α, saline 86.1 ± 79.2 ng/mL, PL 198.6 ± 304.1 ng/mL; and TGF-β1, saline 4.3 ± 1.4 ng/mL, PL 5.0 ± 1.3 ng/mL (Table 2). No significant differences were found between the 2 groups with regard to these values. On day 44, the LDH ratio was significantly lower in the PL group than in the saline group (Figure 2). However, the leucocyte, TNF-α, and TGF-β1 ratios did not differ between the 2 groups throughout the experimental period.
Mean ± SD inflammatory biomarker measurements in synovial fluid.
| Variable | Group | Day 23 | Day 30 | Day 37 | Day 44 |
|---|---|---|---|---|---|
| Leucocytes | Saline | 1.3 ± 1.0 | 1.9 ± 1.3 | 1.3 ± 0.8 | 1.5 ± 1.0 |
| (X109/L) | PL | 1.1 ± 0.9 | 2.0 ± 2.1 | 1.5 ± 1.1 | 1.8 ± 0.8 |
| LDH | Saline | 1,062.3 ± 521.8 | 1,160.8 ± 456.0 | 1,165.8 ± 514.9 | 1,335.2 ± 655.7 |
| (U/L) | PL | 1,153.5 ± 566.9 | 1,220.7 ± 613.6 | 1,024.5 ± 452.2 | 959.8 ± 416.0 |
| TNF-α | Saline | 86.1 ± 79.2 | 79.6 ± 86.9 | 95.1 ± 151.2 | 72.4 ± 81.0 |
| (ng/mL) | PL | 198.6 ± 304.1 | 131.6 ± 154.6 | 115.0 ± 138.5 | 86.6 ± 80.4 |
| TGF-β1 | Saline | 4.3 ± 1.4 | 5.0 ± 2.6 | 4.9 ± 2.6 | 4.4 ± 2.3 |
| (ng/mL) | PL | 5.0 ± 1.3 | 6.2 ± 2.4 | 5.8 ± 3.8 | 8.5 ± 7.7 |
PL = Platelet lysate. TNF-α = Tumor necrosis factor-α
Ratio of change, from day 23 to each timepoint, in the concentrations of inflammatory biomarkers in synovial fluid (n = 6). PL = Platelet lysate. TNF-α = Tumor necrosis factor-α. *Represents significant difference between saline group and PL group (P < .05).
Citation: American Journal of Veterinary Research 85, 11; 10.2460/ajvr.24.03.0090
Carpal circumference
The carpal circumference measurements at each timepoint were as follows (mean ± SD): day 23, saline 33.8 ± 1.2 cm, PL 34.1 ± 1.2 cm; day 30, saline 33.6 ± 1.3 cm, PL 33.8 ± 1.5 cm; and day 37, saline 33.6 ± 1.1 cm, PL 33.8 ± 1.2 cm. The amounts of change from the baseline were as follows (median and range): day 30, saline −0.3 cm (−1.1 to 0.9 cm), PL −0.05 cm (−1.1 to 0.1 cm) and day 37, saline −0.25 cm (−0.7 to 0.5 cm), PL −0.3 cm (−0.6 to 0 cm). There was no difference in the amount of change in carpal joint circumference between the 2 groups.
Histological examination
Hypervascularization and inflammatory cell infiltration were observed in the synovium of both groups. Gross loss of synovial villi, subintimal hyperplasia, fibrosis, and osteoclasts in the intima were also observed. However, there was no clear difference in synovial findings between the PL group and the saline group. Moreover, there was no statistical difference between the 2 groups in the number of osteoclasts present in the synovial intima (Figure 3; Table 3).
Histological findings in the synovium 44 days after the induction of synovitis by monoiodoacetic acid. Osteoclasts were found in the synovial intima in both the PL group and the saline group (red frame, white arrow, and arrowhead). A—Low-power field image; H&E staining; 40X magnification; scale bar = 300 µm. B—High-power-field image of the red frame region; H&E staining; 400X magnification; scale bar = 30 µm. C—Tartrate-resistant acid phosphatase staining; 400X magnification; scale bar = 30 µm. D—There was no difference in the number of osteoclasts found in the synovial intima between the 2 groups on day 44 (n = 6). PL = Platelet lysate.
Citation: American Journal of Veterinary Research 85, 11; 10.2460/ajvr.24.03.0090
Numbers of osteoclasts present in the synovial intima on day 44 (mean ± SE).
| Group | Osteoclasts |
|---|---|
| Saline | 5.0 ± 2.8 |
| PL | 8.2 ± 5.2 |
PL = Platelet lysate.
Gene expression in synovium
Comparison of the expression levels of MMP13, a disintegrin and metalloproteinase with thrombospondin motifs 4, receptor activator of nuclear factor κ-Β ligand, and Col1a2 revealed that there were no statistical differences between the 2 groups on day 44 (Figure 4; Table 4).
Gene expression of inflammatory biomarkers in synovium on day 44 (n = 6). No difference was found between the 2 groups. ADAMTS4 = A disintegrin and metalloproteinase with thrombospondin motifs 4. Col1a2 = Collagen type I α2 chain. GAPDH = Glyceraldehyde-3-phosphate dehydrogenase. MMP13 = Matrix metalloproteinase 13. PL = Platelet lysate. RANKL = Receptor activator of nuclear factor κ-Β ligand.
Citation: American Journal of Veterinary Research 85, 11; 10.2460/ajvr.24.03.0090
Gene expression in synovium on day 44.
| ΔCt | ||||
|---|---|---|---|---|
| Target gene | Group | Median | IQR | Range |
| MMP13 | Saline | −8.8 | −10.0 to −7.7 | −11.2 to −6.5 |
| PL | −9.0 | −9.4 to −8.5 | −10.1 to −6.6 | |
| ADAMTS4 | Saline | −9.2 | −9.9 to −8.1 | −11.4 to −7.6 |
| PL | −8.8 | −9.2 to −8.3 | −9.7 to −8.1 | |
| RANKL | Saline | −10.0 | −10.8 to −9.0 | −11.7 to −8.6 |
| PL | −10.2 | −10.4 to −9.5 | −11.6 to −9.3 | |
| Col1a2 | Saline | 5.2 | 4.8 to 5.5 | 4.3 to 5.7 |
| PL | 5.1 | 4.6 to 5.8 | 3.7 to 6.4 |
IQR values presented are in the 25th to 75th percentile range.
Ct = Cycle threshold. PL = Platelet lysate. ADAMTS4 = A disintegrin and metalloproteinase with thrombospondin motifs 4. Col1a2 = Collagen type I α2 chain. MMP13 = Matrix metalloproteinase 13. RANKL = Receptor activator of nuclear factor κ-Β ligand.
Each mRNA sample was normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) by subtracting the Ct value of GAPDH from the Ct value of the target gene (ΔCt).
Discussion
A persistent synovitis model with good reproducibility can be easily produced by IA administration of a fixed amount of MIA.20 By administration testing using this model, we found that PL had no clear anti-inflammatory effect in horses in this model of synovitis.
Human clinical studies7 have reported that multiple IA administration of activated PRP improves joint pain in the long term. In horses, IA administration of an autologous hemoderivative (with almost the same amount of TGF-β1 as in our study) 3 times at 2-week intervals to horses with naturally occurring persistent arthritis alleviated the inflammation.25 In these studies, the platelets in the PRP were subjected to an activation procedure to release growth factors before administration as was done in our study. However, their results seem to be quite different from ours. In these studies, anti-inflammatory effects were evaluated only by using the scores obtained from clinical examinations, and the outcomes lacked objectivity. Moreover, there was no control in the latter experiment. To the best of our knowledge, no study has yet evaluated the anti-inflammatory effect of PRP (or PL) histologically and biochemically by comparison with a control group in an equine synovitis model. Because of the complexity and heterogeneity of naturally occurring OA, there is concern about the variability in the results of administration tests in horses with OA.26 Therefore, we expected that the results of our PL administration testing in a synovitis model with a highly reproducible pathological condition would provide important information for investigating the effects of PL on naturally occurring OA.
We began administering the treatments to the model 3 weeks after synovitis induction, and the synovial samples were harvested 6 weeks after induction. In our previous study,20 we showed that arthritis is established 2 weeks after induction by MIA. In MIA-induced arthritis, swelling and heat remain for more than 1 month after induction, whereas mild pain and lameness disappear by 1 week after induction.20 The clinical signs of all of our models 3 weeks after MIA were similar to those in a previously demonstrated MIA-induced persistent synovitis model. Moreover, the values of biomarkers in the synovial fluid 3 weeks after induction (day 23) were similar to those previously reported.20 On the basis of these facts, we consider that MIA models similar to those previously reported were reproducibly established in all horses. In this model, persistent chronic synovitis, which is also seen in naturally occurring chronic arthritis, can be maintained for up to 6 weeks after induction by MIA.20 Therefore, we observed the progress of the arthritis until 6 weeks after induction (ie, 3 weeks after the start of PL administration).
We administered PL 3 times at 1-week intervals. Platelet lysate is produced by activating PRP, and the high concentrations of growth factors and cytokines in the solution are believed to have an immediate effect at the site of administration.23 However, the growth factors and cytokines released into the joint from PL have short lifespans.27,28 Therefore, we consider that multiple doses at regular intervals are effective in PL therapy. On the other hand, the inflammatory response associated with arthrocentesis lasts for about a week.20 Therefore, the administration interval was set to 1 week so that the results would not be affected by this inflammation.
The PL administered in our study contained the maximum amount of effective growth factors as a result of activation by the double freeze-thawing process.11 Nevertheless, there were no changes in clinical signs, gene expression in the synovial tissue, or histological findings in the synovium—known characteristic indices of the persistent synovitis produced by MIA.20 In particular, PL was unable to suppress the expression of MMP13 and Col1a2, which are highly expressed in the synovium in naturally occurring chronic OA.29,30 These results support those of previously reported experiments by Rikkers et al17 using human chondrocytes. Given these results, it is clear that PL does not have a strong effect in alleviating inflammation. However, 1 week after the third dose of PL, LDH levels were significantly lower in the PL group than in the control group. LDH is commonly used as a marker of inflammation because it is found in many tissues and it leaks from the tissues during inflammation.31 It is possible that the PL protected the tissues around the administration site. There have been several reports of the tissue-repair and protective effects of PRP on articular cartilage.32,33 However, it was not possible for us to determine whether the protected tissue was the joint capsule, the cartilage, or some other tissue. Further studies are needed to determine the tissue-protective effects of PRP or PL. Furthermore, a limitation of our study was that we administered only 3 doses of PL; it is possible that giving more doses may have had an anti-inflammatory effect.
It should be noted that our study had a few other possible limitations. We had expected to produce PLs with growth factor concentrations that were a little higher as in previous reports (ie, 7.0 ng/mL of PDGF-BB and 20.0 ng/mL of TGF-β1).13 If these growth factor concentrations had been as previously reported, the results we obtained might have been different. Moreover, we used 2 mL of PL per dose, and it is possible that administration of more PL could have alleviated the inflammation. Using a combination of fresh, unfrozen PRP and slow-release materials may also have provided an anti-inflammatory effect. However, high-dose administration or the use of novel dosing methods may alter the IA environment, such as the internal pressure or osmotic pressure. Safety considerations therefore need to be taken into account regarding dosage issues.
A further limitation is the relatively small sample size. We used the minimum number of animals required for nonparametric statistical analysis, with due consideration of animal welfare issues, and this may have contributed to a weakening of the statistical power. In addition, experiments using arthritis models have consistently encountered difficulties in accurately replicating the pathophysiology of naturally occurring OA, including the problem of the degree of inflammation in the model being produced.34 It is possible that our results are characteristic of those that occur in the MIA model and may have differed if another model of inflammation had been used; this is also a potential limitation of our experiment.
In conclusion, multiple IA administration of PL does not exert anti-inflammatory effects on the equine persistent synovitis induced by MIA. Although our results suggest that PL does not have a direct anti-inflammatory effect, it is possible that inflammation at the site of administration may have decreased as a result of the tissue-repair and protective effects of PL. Further research is warranted to clarify the effects of PL and PRP on arthritis.
Acknowledgments
None reported.
Disclosures
The authors have nothing to disclose. No AI-assisted technologies were used in the generation of this manuscript.
Funding
The research was funded by the authors’ departments.
References
- 1.↑
McIlwraith CW, Frisbie DD, Kawcak CE. The horse as a model of naturally occurring osteoarthritis. Bone Joint Res. 2012;1(11):297–309. doi:10.1302/2046-3758.111.2000132
- 2.↑
Ribitsch I, Oreff GL, Jenner F. Regenerative medicine for equine musculoskeletal diseases. Animals (Basel). 2021;11(1):234. doi:10.3390/ani11010234
- 3.↑
McIlwraith CW. Traumatic arthritis and posttraumatic osteoarthritis in the horse. In: McIlwraith CW, Frisbie DD, Kawcak CE, van Weeren PR, eds. Joint Disease in the Horse. 2nd ed. Elsevier Inc; 2012:33–48.
- 4.↑
Oke SL, McIlwraith CW. Review of the economic impact of osteoarthritis and oral joint-health supplements in horses. Am Assoc Equine Pract. 2010;10:12–16.
- 5.↑
Estrada McDermott J, Pezzanite L, Goodrich L, et al. Role of innate immunity in initiation and progression of osteoarthritis, with emphasis on horses. Animals (Basel). 2021;11(11):3247. doi:10.3390/ani11113247
- 6.↑
Filardo G, Kon E, Roffi A, Di Matteo B, Merli ML, Marcacci M. Platelet-rich plasma: why intra-articular? A systematic review of preclinical studies and clinical evidence on PRP for joint degeneration. Knee Surg Sports Traumatol Arthrosc. 2015;23(9):2459–2474. doi:10.1007/s00167-013-2743-1
- 7.↑
Shen L, Yuan T, Chen S, Xie X, Zhang C. The temporal effect of platelet-rich plasma on pain and physical function in the treatment of knee osteoarthritis: systematic review and meta-analysis of randomized controlled trials. J Orthop Surg Res. 2017;12(1):16. doi:10.1186/s13018-017-0521-3
- 8.↑
Tambella AM, Martin S, Cantalamessa A, Serri E, Attili AR. Platelet-rich plasma and other hemocomponents in veterinary regenerative medicine. Wounds. 2018;30(11):329–336.
- 9.↑
Tyrnenopoulou P, Diakakis N, Karayannopoulou M, Savvas I, Koliakos G. Evaluation of intra-articular injection of autologous platelet lysate (PL) in horses with osteoarthritis of the distal interphalangeal joint. Vet Q. 2016;36(2):56–62. doi:10.1080/01652176.2016.1141257
- 10.↑
Everts PA, Knape JT, Weibrich G, et al. Platelet-rich plasma and platelet gel: a review. J Extra Corpor Technol. 2006;38(2):174–187. doi:10.1051/ject/200638174
- 11.↑
Fukuda K, Kuroda T, Tamura N, Mita H, Kasashima Y. Optimal activation methods for maximizing the concentrations of platelet-derived growth factor-BB and transforming growth factor-β1 in equine platelet-rich plasma. J Vet Med Sci. 2020;82(10):1472–1479. doi:10.1292/jvms.20-0167
- 12.↑
Iacopetti I, Perazzi A, Ferrari V, Busetto R. Application of platelet-rich gel to enhance wound healing in the horse: a case report. J Equine Vet Sci. 2012;32(3):123–128. doi:10.1016/j.jevs.2011.08.012
- 13.↑
Fukuda K, Kuroda T, Tamura N, Mita H, Miyata H, Kasashima Y. Platelet lysate enhances equine skeletal muscle regeneration in a bupivacaine-induced muscle injury model. J Equine Vet Sci. 2022;112:103892. doi:10.1016/j.jevs.2022.103892
- 14.↑
Bosch G, van Schie HT, de Groot MW, et al. Effects of platelet-rich plasma on the quality of repair of mechanically induced core lesions in equine superficial digital flexor tendons: a placebo-controlled experimental study. J Orthop Res. 2010;28(2):211–217. doi:10.1002/jor.20980
- 15.↑
Gilbertie JM, Long JM, Schubert AG, Berglund AK, Schaer TP, Schnabel LV. Pooled platelet-rich plasma lysate therapy increases synoviocyte proliferation and hyaluronic acid production while protecting chondrocytes from synoviocyte-derived inflammatory mediators. Front Vet Sci. 2018;5:150. doi:10.3389/fvets.2018.00150
- 16.
Perrone G, Lastra Y, González C, et al. Treatment with platelet lysate inhibits proteases of synovial fluid in equines with osteoarthritis. J Equine Vet Sci. 2020;88:102952. doi:10.1016/j.jevs.2020.102952
- 17.↑
Rikkers M, Dijkstra K, Terhaard BF, et al. Platelet-rich plasma does not inhibit inflammation or promote regeneration in human osteoarthritic chondrocytes in vitro despite increased proliferation. Cartilage. 2021;13(suppl 2):991S–1003S. doi:10.1177/1947603520961162
- 18.↑
Gustafson SB, Trotter GW, Norrdin RW, Wrigley RH, Lamar C. Evaluation of intra-articularly administered sodium monoiodoacetate-induced chemical injury to articular cartilage of horses. Am J Vet Res. 1992;53(7):1193–1202. doi:10.2460/ajvr.1992.53.7.1193
- 19.
Elmesiry A, Seleim M, Cullis-Hill D. Iodoacetate and allogenous cartilage particles as models for arthritis induction in equine. Int J Vet Sci Med. 2014;2(2):142–150. doi:10.1016/j.ijvsm.2014.11.001
- 20.↑
Fukuda K, Mita H, Tamura N, et al. Characteristic inflammatory biomarkers in an equine model of persistent synovitis induced by the intra-articular administration of monoiodoacetic acid. J Equine Vet Sci. 2023;127:104564. doi:10.1016/j.jevs.2023.104564
- 21.↑
Fukuda K, Kuwano A, Kuroda T, et al. Optimal double-spin method for maximizing the concentration of platelets in equine platelet-rich plasma. J Equine Sci. 2020;31(4):105–111. doi:10.1294/jes.31.105
- 22.↑
Textor JA, Tablin F. Activation of equine platelet-rich plasma: comparison of methods and characterization of equine autologous thrombin. Vet Surg. 2012;41(7):784–794. doi:10.1111/j.1532-950X.2012.01016.x
- 23.↑
Textor JA, Norris JW, Tablin F. Effects of preparation method, shear force, and exposure to collagen on release of growth factors from equine platelet-rich plasma. Am J Vet Res. 2011;72(2):271–278. doi:10.2460/ajvr.72.2.271
- 24.↑
McClain AK, McCarrel TM. The effect of four different freezing conditions and time in frozen storage on the concentration of commonly measured growth factors and enzymes in equine platelet-rich plasma over six months. BMC Vet Res. 2019;15(1):292. doi:10.1186/s12917-019-2040-4
- 25.↑
Carmona JU, Arguelles D, Climent F, Prades M. Autologous platelet concentrates as a treatment of horses with osteoarthritis: a preliminary pilot clinical study. J Equine Vet Sci. 2007;27(4):167–170. doi:10.1016/j.jevs.2007.02.007
- 26.↑
Garbin LC, Olver CS. Platelet-rich products and their application to osteoarthritis. J Equine Vet Sci. 2020;86:102820. doi:10.1016/j.jevs.2019.102820
- 27.↑
Moraes AP, Moreira JJ, Brossi PM, Machado TS, Michelacci YM, Baccarin RY. Short- and long-term effects of platelet-rich plasma upon healthy equine joints: clinical and laboratory aspects. Can Vet J. 2015;56(8):831–838.
- 28.↑
Textor JA, Willits NH, Tablin F. Synovial fluid growth factor and cytokine concentrations after intra-articular injection of a platelet-rich product in horses. Vet J. 2013;198(1):217–223. doi:10.1016/j.tvjl.2013.07.020
- 29.↑
Kamm JL, Nixon AJ, Witte TH. Cytokine and catabolic enzyme expression in synovium, synovial fluid and articular cartilage of naturally osteoarthritic equine carpi. Equine Vet J. 2010;42(8):693–699. doi:10.1111/j.2042-3306.2010.00140.x
- 30.↑
Trumble TN, Trotter GW, Oxford JR, et al. Synovial fluid gelatinase concentrations and matrix metalloproteinase and cytokine expression in naturally occurring joint disease in horses. Am J Vet Res. 2001;62(9):1467–1477. doi:10.2460/ajvr.2001.62.1467
- 31.↑
Rejnö S. LDH and LDH isoenzymes of synovial fluid in the horse. Acta Vet Scand. 1976;17(2):178–189. doi:10.1186/BF03547926
- 32.↑
Kwon DR, Park GY, Lee SU. The effects of intra-articular platelet-rich plasma injection according to the severity of collagenase-induced knee osteoarthritis in a rabbit model. Ann Rehabil Med. 2012;36(4):458–465. doi:10.5535/arm.2012.36.4.458
- 33.↑
Patel S, Mishra NP, Chouhan DK, Nahar U, Dhillon MS. Chondroprotective effects of multiple PRP injections in osteoarthritis by apoptosis regulation and increased aggrecan synthesis- immunohistochemistry based Guinea pig study. J Clin Orthop Trauma. 2022;25:101762. doi:10.1016/j.jcot.2022.101762
- 34.↑
Thysen S, Luyten FP, Lories RJ. Targets, models and challenges in osteoarthritis research. Dis Model Mech. 2015;8(1):17–30. doi:10.1242/dmm.016881
