Introduction
Pancreatic islet neoplasm (insulinoma) is the most common endocrine tumor of the pancreas in dogs.1 Islet cell neoplasms are typically composed of functional neuroendocrine cells with hyperinsulinemia as a characteristic finding when insulinoma is present. In naturally occurring insulinoma, secretion is autonomous and independent of normal physiologic regulation. Importantly, insulin secretion by insulinoma is not inhibited by hypoglycemia.2 The molecular characteristics of canine insulinoma have been explored in recent investigations that sought to identify differences in the gene expression profiles between the primary tumor and its metastases3 and to evaluate molecular markers for prognosis.4,5 Less is known about the molecular pathways that underlie functional endocrine aspects of canine insulinoma, such as the mechanisms that lead to excess insulin secretion and impaired cellular response to hypoglycemia.
Studies6,7,8,9 investigating insulin secretion and β-cell metabolism in vitro have frequently used insulin-secreting cell lines derived from pancreatic tissue or insulinoma. Most available cell lines are of rodent (mouse, rat, or hamster) origin and are derived from simian virus 40–transformed islet β cells or radiation-induced insulinoma.6,7 Glucose responsiveness and insulin secretion capacity of the established islet cell lines differ substantially.7 Unfortunately, few of the available cell lines have an insulin secretory response that mimics the normal response of β cells to glucose stimulation.6,7 Furthermore, data derived from rodent cell lines must be applied cautiously, as molecular mechanisms of insulin synthesis and secretion vary among rodents, human beings, and other species.7 A need for functional human β cells prompted development of insulin-secreting cells derived from human tissue.8,9 A canine insulinoma cell line (INS-H1) has also been developed but has not been extensively studied.8,10 In particular, there is no information about the functional capacity of the INS-H1 cell line and the ability of these cells to produce and secrete insulin. The functional capacity of naturally occurring insulinomas led to the hypothesis that these tumors are a useful means to investigate cellular and molecular pathways of canine insulin secretion. The purpose of the study reported here was to develop a technique for isolation and culture of canine insulinoma cells and to assess the functional capacity of cultured canine insulinoma cells to synthesize and secrete insulin.
Materials and Methods
Insulinoma samples
Tumors (n = 4) used for experiments were obtained by surgical resection performed for treatment and diagnostic purposes in (3) or necropsy of (1) dogs that had hyperinsulinemic hypoglycemia in the absence of exogenous insulin administration and clinical signs compatible with insulinoma. The tumors were all located in the pancreas, and each was confirmed to be an insulinoma by histologic examination. For gene expression experiments, grossly normal (nontumor) pancreatic tissue that had been removed along with the resected tumor was available from 3 of these 4 dogs.
RNA isolation and qRT-PCR assay
Samples obtained from insulinoma (n = 4) and adjacent normal pancreatic tissue from the same dog when available (3) were snap frozen in liquid nitrogen and stored at −80°C until use. Tissue was disrupted by grinding it in liquid nitrogen with a mortar and pestle followed by column homogenization.a Total RNA was isolated from homogenized samples with a commercial kit,b and a reverse transcription enzyme kitc was used to generate cDNA in accordance with the manufacturer's instructions. After preparation, cDNA was stored at −20°C for ≤ 3 months until used in experiments.
Quantification of target genes in insulinoma and normal pancreatic tissues was performed with primer pairs for canine GCK (sense, GGCTGGAGACCCACGA; antisense, CTTGGTCCAATTGAGGAGGAT) and HK1 (sense, GAGATGAAGAATGGCCTCTCC; antisense, AGATCCAGGGCAATGAAATC) that were optimized for use with qRT-PCR assays. The qRT-PCR assay was completed with a commercial kit.d Each sample was run in duplicate along with 2 negative controls (1 that lacked reverse transcriptase and 1 that lacked a DNA template). The amplification protocol was as follows: 95°C for 15 minutes, followed by 45 cycles of 94°C for 15 seconds, 59°C for 30 seconds, and 72°C for 30 seconds. A 7-point standard curve for each target gene included with each run allowed for quantitation. Amplified targets were confirmed by melting curve analysis. As an additional control to ensure the correct targets were amplified, qRT-PCR products were separated by agarose gel electrophoresis and sequenced with the Sanger method to confirm the expected size and identity of each product. Target gene expression in insulinoma tissue and normal pancreatic tissue was normalized to total RNA expression (mRNA copies/ng RNA) and represented as an expression ratio (insulinoma-to-normal pancreatic tissue) for dogs that had normal tissue available.
Isolation and culture of insulinoma cells
Two insulinomas were not large enough to use for cell culture experiments and were used only for qRT-PCR assays. Two insulinomas yielded enough tissue to process for qRT-PCR assays and cell culture experiments. Immediately after surgical excision, a portion of each insulinoma (approx 1/6 of the total estimated tumor volume) was placed in ice-cold sterile PBS solution prior to being prepared for culture. The tissue was minced with a sterile razor blade, and a single-cell suspension was made by passing the minced tissue through a sterile, fine stainless steel mesh into a Petri dish containing cold PBS solution. A sterile glass pestle was used to gently force larger pieces of tissue through the cell sieve. The contents of the Petri dish were transferred to a 50-mL conical tube and centrifuged at 200 × g for 5 minutes to pellet cells. The supernatant was poured off, and the pellet was washed 3 times in PBS solution. After the final wash, the pelleted cells were resuspended in RPMI 1640 medium (containing 10mM glucose) supplemented with 10% fetal bovine serum and antimicrobials (penicillin [100 U/mL] and streptomycin [100 μg/mL]). The same RPMI solution was used throughout the culture experiments.
An aliquot of the cell suspension was examined immediately after isolation by use of an inverted tissue culture microscopee to confirm yield and estimate cell quality; morphological assessment of cells in culture was performed daily afterward. An eyepiece micrometer was used to estimate cell and cell cluster diameters. The cell suspension was dispensed on 6- and 12-well noncoated or collagen-coated plastic plates. Each well of the 6-well plates received 1 mL of cell suspension and 2 mL of fresh RPMI medium; each well of the 12-well plates received 0.5 mL of cell suspension and 1 mL of fresh RPMI medium. At least two 6-well plates (1 coated and 1 uncoated) and two 12-well plates (1 coated and 1 uncoated) were prepared from each insulinoma, although the number of wells on each plate inoculated varied. All plates were incubated with an environment of 95% air and 5% CO2 at 37°C (time 0 for cell culture experiments). After 48 hours of incubation, the medium was aspirated by pipetting and replaced with fresh RPMI. Subsequently, plates containing adherent cells were maintained at 37°C in culture, with medium changes performed every 48 hours until it was determined that cells were no longer viable or unlikely to proliferate. When samples were collected for insulin measurements, the RPMI medium was removed, immediately placed in 1.5-mL plastic tubes, and frozen at −80°C until use in an insulin assay.
Cytologic slide preparation and immunohistochemical testing
After 48 hours, 2 weeks, and 10 weeks of incubation at 37°C, the contents of 4 wells (48-hour time point) or 2 wells (2- and 10-week time points) from uncoated plates containing isolated insulinoma cells were separately collected for cytologic slide preparation and analysis. Aliquots of insulinoma cell suspensions (200 μL) were placed into individual wells of a purpose-designed cytocentrifuge.f The samples were spun at 55.3 × g for 3 minutes onto a glass slide. Slides were air-dried for ≥ 4 hours prior to fixation and immunohistochemical staining for insulin.
Prior to insulin detection, slides were fixed by immersion in cold phosphate-buffered 4% paraformaldehyde solution for 24 hours. After fixing, slides were washed with PBS solution and incubated for 10 minutes in PBS solution containing 50mM glycine. The cell preparations were pretreated with protease 1 for 2 minutes at room temperature (approx 20°C). Slides were then incubated with PBS containing 3% bovine serum albumin for 1 hour to block nonspecific binding sites. After blocking, slides were washed with PBS solution, guinea pig anti–porcine insulin primary IgG antibodyg was applied (1:50 dilution in PBS solution for 32 minutes), and 3,3′-diaminobenzi-dine was used as the chromogen. Negative controls consisted of insulinoma cells that underwent the same protocol, except that water was substituted for the primary antibody. As a positive control, routinely fixed and histologically normal, sectioned pancreatic tissue obtained at necropsy of a healthy dog underwent immunohistochemical staining in the same manner as the cell preparations.
Insulin secretion assay
Insulin secretion was determined by measuring insulin content of culture medium removed from the wells of plates at 3, 4, 5, and 10 weeks after isolation and initial plating of insulinoma cells. The minimum interval after isolation and plating was selected to allow cells time to attach and become established in culture prior to the assays. Samples of culture medium (which had been added to the wells 48 hours earlier) were taken from all wells (n = 4/insulinoma) for insulin measurement by ELISA.
An ultrasensitive mouse insulin ELISA kith was used for insulin determination. This assay was chosen because it is quantitative for very low insulin concentrations and because the anti-mouse insulin antibody cross-reacts with porcine insulin,11 which has an amino acid sequence that is identical to canine insulin. Samples were prepared and insulin assays were performed according to the manufacturer's instructions. Briefly, 5 μL of sample (culture medium) and 75 μL of enzyme conjugate solution were added to each test well of a 96-well precoated ELISA plate and incubated on an orbital shaker at approximately 700 cycles/min for 2 hours at room temperature, then the plate was washed 6 times with the wash buffer supplied with the kit. After the final wash and complete removal of wash buffer, 100 μL of substrate was added to each well and allowed to incubate for 30 minutes at room temperature. Then, 100 μL of a stop solution was added to each well, and the plate was placed on a shaker for approximately 5 seconds to ensure adequate mixing. Absorbance was measured at 450 nm with a spectrophotometer. Linearity was assessed with 3 concentrations of a single sample (undiluted, 1:1 dilution, and 1:4 dilution). A 7-point calibration curve was performed with prepared insulin standards provided with the insulin assay kit along with each assay of unknown samples. The range of concentrations determined by the standard curve was 0.025 to 6.9 ng/L. For each assay, all calibration and unknown samples were analyzed in duplicate, and the results from both wells were averaged for reporting.
Results
GCK and HK 1 expression
The mRNA of GCK and HK1 was detected in all insulinomas (n = 4) and in normal pancreatic tissue that was concurrently harvested (3; Table 1). Direct comparison of GCK and HK1 expression by insulinoma and normal pancreatic tissue was possible for 3 of the 4 dogs. The HK1 expression levels in these 2 tissue types were roughly equivalent for all 3 dogs as assessed by insulinoma-to-normal pancreatic tissue expression ratios of 0.85, 1.10, and 0.42 (mean ratio, 0.79). In comparison, GCK expression differed substantially between the 2 tissue types (mean insulin-oma-to-normal pancreatic tissue ratio, 15.2) and was more variable, with ratios of 1.9, 1.4, and 42.3 for the 3 dogs.
Expression of GCK and HK1 mRNA (copies/100 ng total RNA) in insulinomas from 4 dogs and concurrently collected grossly normal pancreatic tissue from the same dogs in a study to develop a technique for isolation and culture of canine insulinoma cells and assess expression of cellular HKs as well as expression and secretion of insulin from these cells in vitro.
| Dog No. | GCK | HK1 | ||||
|---|---|---|---|---|---|---|
| Insulinoma | Normal pancreatic tissue | Insulinoma-to-normal pancreatic tissue ratio | Insulinoma | Normal pancreatic tissue | Insulinoma-to-normal pancreatic tissue ratio | |
| 1 | 23,248 | 12,102 | 1.9 | 14,738 | 17,269 | 0.85 |
| 2 | 622 | 445 | 1.4 | 15,155 | 13,803 | 1.1 |
| 3 | 404,179 | 9,550 | 42.3 | 15,768 | 37,616 | 0.42 |
| 4 | 17,912 | — | — | 23,344 | — | — |
Normal pancreatic tissue was not available for 1 dog.
— = Not applicable.
Isolation and culture of insulinoma cells
On morphological assessment, freshly isolated cells from the 2 insulinomas used for cell culture were round, and the cytoplasm had a granular appearance (Figure 1). Single cells and small clusters of 2 to 20 cells were observed in all preparations, and some wells contained an abundant amount of noncellular debris. Single-cell diameter was approximately 10 μm, and clusters of cells ranged from 20 to 100 μm in diameter. Single cells and cell clusters adhered to the bottom of culture wells overnight and remained attached for a culture period of 10 weeks; after this time, experiments were discontinued on the basis of visual examination of the cultures. Individual cells and cell clusters did not flatten following attachment, and the rounded shape was retained over the entire 10-week culture period. The morphological characteristics and growth patterns were similar for insulinoma cells cultured in collagencoated and uncoated plastic wells. Cells with microscopic characteristics of fibroblasts were observed after several days and became established in culture alongside insulinoma cells within 4 weeks after isolation and initial culture. Once established in culture, insulinoma cells survived but did not appear to proliferate over the course of the 10-week observation period. Single cells and cell clusters were present at all times throughout culture, although subjectively, the total number of surviving cells declined over time. The size and morphological features of insulinoma cells maintained in culture up to the end of the observation period appeared similar to those of freshly isolated cells.
Representative photomicrographs of canine insulinoma cells in culture. The single cells measured approximately 10 μm, and cell clusters ranged from 20 to 100 μm in diameter. A—Immediately after plating, single cells (arrowheads) and clusters of cells (arrows) are present. The cells are detached from the wells. B—After 4 weeks in culture, insulinoma cells are growing singly or in clusters. Fibroblasts (arrow) have become established. Insulinoma cell growth has stabilized, with cells proliferating slowly if at all. C—Single cells (arrowhead), cell clusters (solid arrow), and fibroblasts (open arrow) are present after 8 weeks in culture. D—A cluster of insulinoma cells after 10 weeks in culture (arrow). Bar = 100 μm.
Citation: American Journal of Veterinary Research 82, 2; 10.2460/ajvr.82.2.110
Insulin expression and secretion by insulinoma cells
Insulin-positive cells were observed in all preparations examined after 48 hours of insulinoma cell culture (Figure 2). The same pattern and distribution of insulin were observed in insulinoma cells that were cultured for 2 and 10 weeks (not shown). In single cells, a punctate pattern of staining was observed within the cytoplasm. The intracellular staining pattern was consistent with insulin localization in cytosolic granules. In some preparations, extra-cellular granular material that tested positive for insulin by staining was observed. These extracellular granules were similar in size to the cytosolic granules observed in intact cells, suggesting that the material was released from disrupted cells during the centrifugation process to create slide preparations. No intra-cellular or extracellular material that tested positive for insulin was observed in negative control samples with the primary antibody omitted. Insulin-positive cells were detected only within islets of Langerhans in the normal canine pancreas tissue, which was used as the positive control.
Representative photomicrographs depicting the results of immunohistochemical analysis for insulin expression in isolated canine insulinoma cells after 48 hours of culture. A and B—Insulin content (indicated by red stain) varies among individual insulinoma cells (arrowheads). Intact insulinoma cells approximately 10 μm in diameter are enlarged after processing with the cytocentrifuge. Extracellular material stained red likely represents insulin released when cells were disrupted during the process of slide preparation. C—Negative control for the assay. No intra- or extracellular insulin staining is evident. D—Positive control for the assay (normal pancreatic tissue from a healthy dog). Insulin staining is evident, consistent with insulin production within islet β cells. Immunohistochemical stain with H&E counterstain.
Citation: American Journal of Veterinary Research 82, 2; 10.2460/ajvr.82.2.110
Insulin was detected in medium collected from all individual wells assayed 3, 4, and 5 weeks after culture initiation for both insulinomas; results of duplicate testing for 1 culture well/insulinoma are shown (Figure 3). Total insulin content of wells was not distinguishable from the background at 10 weeks (not shown). The total amount of insulin secreted into the medium appeared to differ most between the 2 insulinoma preparations at the 3-week time point. At subsequent time points, changes in the total amount of insulin detected in each well also varied between the 2 insulinoma preparations, with a decrease for one and an increase for the other between weeks 3 and 4 and a decrease for both between weeks 4 and 5. A dilution assay performed by use of medium from 1 well revealed a linear decrease in absorbance with successive dilutions, indicating a specific interaction between anti-insulin antibody and canine insulin.
Insulin secretion measured by ELISA at predetermined time points during culture of cells isolated from 2 insulinomas (each from a different dog [represented by different bar colors]). Each bar represents total insulin content of a single culture well at the time point indicated. Inset—A dilution assay performed with 3 concentrations of 1 sample (undiluted, 1:1 dilution, and 1:4 dilution) at the 4-week time point revealed a linear decrease in absorbance, consistent with a specific antibody interaction with the target (insulin). ABS = Absorbance.
Citation: American Journal of Veterinary Research 82, 2; 10.2460/ajvr.82.2.110
Discussion
In the present study, cells from 2 naturally occurring canine insulinomas cultured in vivo retained the ability to synthesize insulin for up to 10 weeks with detectable insulin secretion for ≥ 5 but < 10 weeks. Although just a small portion of each resected insulinoma was available for cell isolation experiments, viable cells were produced with the described protocol. The single cells and cell clusters obtained were cultivated for up to 10 weeks with standard techniques and a commercial cell medium. Frequent microscopic evaluation of cells during culture indicated that single and clustered cells adhered to the bottom of culture wells regardless of the available substrate (uncoated or collagen-coated plastic). The cell propagation or growth rate was not quantified, but the results of visual inspections were consistent with little or no cell replication during the 10-week culture period. Subculture of the insulinoma cells was not attempted because cells did not become confluent in any of the preparations.
Our results indicated that cultured insulinoma cells had the ability to synthesize and secrete insulin. Primary human insulinoma cells reportedly lack insulin secretion (but retain insulin synthesis) immediately after isolation but regain glucose-stimulated insulin secretion with successive passages.12 In canine insulinoma cells of the present study, insulin was detected in cytoplasmic granules by immunohistochemistry 48 hours after isolation. Insulin was detected in cell-free medium beginning with the first assessment of this characteristic 3 weeks after the initiation of cell cultures, suggesting insulin secretion at this time point. Because earlier time points were not assessed, it remains unknown whether insulin secretion by canine insulinoma cells is suppressed immediately after isolation and initial culture. Insulin secretion by 1 of the 2 insulinomas evaluated was lowest at the 3-week time point and was substantially increased at subsequent time points. It was possible that the observed lag in insulin secretion by those cells reflected early suppression and subsequent recovery of insulin secretory capacity after several weeks in culture, as reported for human insulinoma cells.12 Microscopic examination revealed attached, presumably viable insulinoma cells remaining in culture wells for up to 10 weeks. However, the insulin content in the medium of cultured cells generally decreased between weeks 4 and 5 for both insulinomas evaluated and was non-detectable at 10 weeks. Cell counts per well were not evaluated, but subjective observations indicated that the number of adhered cells and cell clusters was progressively smaller over the 10-week culture period. Cell loss during culture medium changes was possible. However, the cells were not subjected to detachment treatments (eg, collagenase or mechanical scraping) during the exchange procedure, and care was taken to minimize removal of viable cells during the frequent medium exchanges. The available data did not allow an investigation into the cause for the decline in insulin secretion. Progressive cell death or loss of otherwise viable cells likely played a major role, although decreases attributable to loss of cellular function (ie, reduced insulin synthesis or secretion) could have contributed to this.
Mechanisms that regulate insulin secretion by insulinomas are not well understood. An investigation of solute carrier family 2A–facilitated GLUT (also described as GLUT) proteins in human patients with insulinomas showed that these tumors have high expression of the low apparent affinity GLUT1 transporter along with low or undetectable expression of the GLUT2 isoform.13 However, in light of a subsequent study14 showing that normal human pancreatic β cells have a similar GLUT expression pattern, altered GLUT expression seems less likely to be an important mechanism for excess insulin secretion by insulinomas. Results of a more recent investigation15 of human patients suggest that the secretory pathways responsible for insulin release remain largely intact in insulinomas, although some important differences in insulin secretion patterns among tumors have been noted. A cell line derived from a human insulinoma was found to have a glucose-responsive increase in insulin production and mRNAs that encode GLUT proteins, and glucose-induced insulin secretion was shown to be intact.12 Similar results were reported for cultured human insulinomas.15 Less is known about insulinoma in dogs. However, a previous report16 indicates that canine insulinomas express a subunit of the ATP-sensitive potassium channel involved in insulin secretion (potassium inwardly rectifying channel, subfamily J, and member 11) and that, together with the present study results that showed canine insulinomas express GCK mRNA and contain insulin within cytoplasmic granules, canine insulinomas, like human insulinomas, retain essential molecular pathways responsible for glucose-mediated insulin release.
In human medicine, morphometric analysis shows that insulinomas have proportionally less insulin content and fewer insulin-containing cells than normal pancreatic tissue,15 suggesting that the amount of insulin released per cell must be proportionally greater in insulinomas. Although similar morphometric analysis has not been completed for canine insulinomas, it is clear that the balance of GCK and HK1 expression may have important ramifications for insulin secretion from these tumors. The HK family of metabolic enzymes, which includes GCK (also called HK IV) and HK1, is widely expressed by mammalian cells in which they initiate glucose metabolism.
Glucokinase catalyzes the first step in cellular glucose metabolism and has unique structural and kinetic properties that allow it to act as a so-called glucose sensor in specialized cells where it is expressed. The low affinity of GCK for glucose permits the enzyme activity to respond incrementally over the physiologic range of glucose concentrations. In pancreatic β cells, GCK expression is essential for normal sensing of glucose, and GCK defects produce abnormal insulin secretion.17,18 The overexpression of GCK may be responsible in part for excessive insulin secretion that occurs in some forms of congenital hyperinsulinemia.15
Overexpression of GCK by β cells is a possible mechanism that could result in greater insulin release by insulinoma. When a range of GCK protein overexpression (3- to 8-fold, compared with the baseline value) was induced in cells of the INS-1 (rat insulinoma) cell line, glucose responsiveness and metabolism and insulin secretion were incrementally increased.19 Compared with normal β cells, β cells with increased GCK activity have enhanced insulin sensitivity, and the maximal insulin secretion rate is reached at a lower glucose concentration. Overexpression of GCK by a naturally occurring feline insulinoma has been previously reported20; in that investigation, the GCK:HK1 mRNA ratio in tumor tissue was 21.5-fold that of normal pancreatic tissue from the same cat.20 Results of the present study revealed an apparent overexpression of GCK relative to HK1 (each assessed as mRNA copies/100 ng total RNA) in insulinoma tissue, compared with normal pancreatic tissue from the same dogs; these results varied substantially (primarily owing to GCK expression ratios ranging from 1.4 to 42.3) among the 3 dogs for which paired samples were available. It is possible that the apparently higher rate of GCK expression in insulinomas reflected a predominance of cells with a β-cell phenotype, compared with normal pancreatic tissue, which is expected to be composed of a mixed cell population of endocrine and exocrine phenotypes.
Insulinoma cell expression of HK1 is another possible mechanism to explain excessive insulin secretion by insulinoma tissue. The HK1 catalyzes the same biochemical step, but its kinetic properties have important differences from those of GCK. Unlike GCK, HK1 has high glucose affinity and maximal phosphorylation activity in the presence of a low glucose concentration. As a result, glucose metabolism in HK1-expressing cells is maximally activated when the glucose concentration approximates normoglycemia (approx 5mM). In healthy animals, HK1 has a much broader tissue expression profile than GCK, and its role is that of a constituitive enzyme responsible for regulating basal glucose metabolism in most tissues. Notably, HK1 is absent from normal β cells.15,21 In the present study, HK1 mRNA was detected in each of the 4 insulinomas examined. Hexokinase 1 mRNA is not expected to be found in insulinomas if the tumor cells retain a β-cell phenotype. However, a subset of human insulinomas that expresses HK1 rather than GCK and has maximal insulin secretion in response to very low glucose concentrations has been described.15 It is possible that HK1 expression in these canine insulinomas represents a similar situation. However, unlike the canine insulinomas in our study that expressed both HK1 and GCK, GCK expression was completely undetectable in the human insulinomas that had HK1 expression.15 Although great care was taken to trim attached tissue from insulinomas prior to processing, contamination from normal pancreatic tissue could have explained the presence of HK1 in the insulinoma samples. However, because the relative amounts of HK1 expression in insulinoma versus normal pancreatic tissue were similar in the 3 sample sets for which the comparison was possible, it appeared most likely that nonendocrine cell types in both tissues were sources for HK1 mRNA.
Our results showed that naturally occurring canine insulinoma cells can be maintained in vitro for use in functional studies. However, because the results were obtained with tumor tissue from only 4 dogs and cells were cultured from only 2 of the 4 tumors, caution is warranted before extrapolating these findings as characteristics of canine insulinomas in general. Because the sample size was small, we restricted ourselves to reporting the results without statistical analysis because of the high possibility that a type 2 statistical error would be encountered. Access to insulinoma tissue for in vitro experiments is hindered by the low incidence of naturally occurring insulinomas in dogs, the need for surgery to obtain the tissue, and the limited amount of fresh sample that remains after histologic testing. The highlighted problems of sample size and tissue acquisition are not unique to studies of canine insulinomas, as the largest study15 to date of functional aspects of human insulinoma analyzed only 10 tumors. Given the inherent limitations of in vitro investigations of canine insulinomas, our results may best serve to define functional pathways of interest and to provide a basis for further investigation in the future.
Although the available data were consistent with GCK overexpression as a cause for excessive insulin release by canine insulinoma, additional investigations are warranted to elucidate patterns of HK expression by canine insulinomas and to define the role of GCK overexpression in glucose sensitivity and insulin secretion pathways of canine insulinoma cells. Other metabolic consequences of GCK overexpression, including increased rates of glucose uptake and glucose phosphorylation, have not been documented in canine insulinoma but should be a focus of future studies.
Acknowledgments
Supported by the Department of Clinical Sciences, College of Veterinary Medicine, Kansas State University. The authors declare that there were no conflicts of interest.
Presented in abstract form at the 26th Annual Forum of the American College of Veterinary Internal Medicine, San Antonio, Tex, 2008.
Abbreviations
| GCK | Glucokinase |
| GLUT | Glucose transporter |
| HK | Hexokinase |
| qRT-PCR | Quantitative reverse transcriptase PCR |
Footnotes
Qiashredder column, Qiagen, Carlsbad, Calif.
RNeasy Micro Kit, Qiagen, Carlsbad, Calif.
Omniscript Reverse Transcription Kit, Qiagen, Carlsbad, Calif.
QuantiTect SYBR Green PCR Kit, Qiagen, Carlsbad, Calif.
Nikon TS 100, Nikon Instruments Inc, Melville, NY.
Shandon Cytospin 2, ThermoFisher Scientific, Waltham, Mass.
Agilent Dako, Santa Clara, Calif.
Mouse Ultrasensitive ELISA, ALPCO Diagnostics, Salem, NH.
References
- 1. ↑
Goutal CM, Brugmann BL, Ryan KA. Insulinoma in dogs: a review. J Am Anim Hosp Assoc 2012;48:151–163.
- 2. ↑
Hanna AK, Vranic M, Zinman B. Glucose turnover in insulin-oma–a case report. Diabetes Res Clin Pract 1987;3:111–114.
- 3. ↑
Buishand FO, Kirpensteijn J, Jaarsma AA, et al. Gene expression profiling of primary canine insulinomas and their metastases. Vet J 2013;197:192–197.
- 4. ↑
Buishand FO, Kik M, Kirpensteijn J. Evaluation of clinico-pathological criteria and the Ki67 index as prognostic indicators in canine insulinoma. Vet J 2010;185:62–67.
- 5. ↑
Buishand FO, Visser J, Kik M, et al. Evaluation of prognostic indicators using validated canine insulinoma tissue microar-rays. Vet J 2014;201:57–63.
- 6. ↑
McClenaghan NH, Flatt PR. Physiological and pharmacological regulation of insulin release: insights offered through exploitation of insulin-secreting cell lines. Diabetes Obes Metab 1999;1:137–150.
- 7. ↑
Skelin M, Rupnik M, Cencic A. Pancreatic beta cell lines and their applications in diabetes mellitus research. ALTEX 2010;27:105–113.
- 8. ↑
Wagner L, Templ E, Reining G, et al. Culture of human insulinoma cells: development of a neuroendocrine tumor cell- and human pancreatic islet cell-specific monoclonal antibody. J Endocrinol 1998;156:469–476.
- 9. ↑
Scharfmann R, Didiesheim M, Richards P, et al. Mass production of functional human pancreatic β-cells: why and how? Diabetes Obes Metab 2016;18(suppl 1):128–136.
- 10. ↑
Wagner L, Oliyarnyk O, Gartner W, et al. Cloning and expression of secretagogin, a novel neuroendocrine- and pancreatic islet of Langerhans-specific Ca2+-binding protein. J Biol Chem 2000;275:24740–24751.
- 12. ↑
Baroni MG, Cavallo MG, Mark M, et al. Beta-cell gene expression and functional characterisation of the human insulinoma cell line CM. J Endocrinol 1999;161:59–68.
- 13. ↑
Boden G, Murer E, Mozzoli M. Glucose transporter proteins in human insulinoma. Ann Intern Med 1994;121:109–112.
- 14. ↑
De Vos A, Heimberg H, Quartier E, et al. Human and rat beta cells differ in glucose transporter but not in glucokinase gene expression. J Clin Invest 1995;96:2489–2495.
- 15. ↑
Henquin J-C, Nenquin M, Guiot Y, et al. Human insulinomas show distinct patterns of insulin secretion in vitro. Diabetes 2015;64:3543–3553.
- 16. ↑
Donley VR, Hiskett EK, Kidder AC, et al. ATP-sensitive potassium channel (KATP channel) expression in the normal canine pancreas and in canine insulinomas. BMC Vet Res 2005;1:8.
- 17. ↑
Postic C, Shiota M, Magnuson MA. Cell-specific roles of glucokinase in glucose homeostasis. Recent Prog Horm Res 2001;56:195–217.
- 18. ↑
Osbak KK, Colclough K, Saint-Martin C, et al. Update on mutations in glucokinase (GCK), which cause maturity-onset diabetes of the young, permanent neonatal diabetes, and hyperinsulinemic hypoglycemia. Hum Mutat 2009;30:1512–1526.
- 19. ↑
Wang H, Iynedjian PB. Modulation of glucose responsiveness of insulinoma β-cells by graded overexpression of glucokinase. Proc Natl Acad Sci U S A 1997;94:4372–4377.
- 20. ↑
Jackson TC, Debey B, Lindbloom-Hawley S, et al. Cellular and molecular characterization of a feline insulinoma. J Vet Intern Med 2009;23:383–387.
- 21. ↑
Schuit F, Moens K, Heimberg H, et al. Cellular origin of hexokinase in pancreatic islets. J Biol Chem 1999;274:32803–32809.
