Chronic kidney disease is common in aged domestic cats, with prevalence estimates ranging up to 30% to 50%.1,2 Histologically, CKD in cats is characterized by tubulointerstitial fibrosis,3 a finding that is strongly correlated with functional impairment.4,5
Our research group recently described an in vivo experimental model in which cats underwent transient unilateral renal ischemia to induce chronic renal fibrosis, interstitial inflammation, and tubular atrophy.6,7 Cats with naturally occurring CKD have similar lesions3,8; therefore, the results of those experimental studies6,7 are consistent with the accumulating evidence that renal hypoxia has a critical role in the intrinsic progression of CKD.9–11
An increase in the expression of hypoxia-induced mediators of fibrosis is associated with CKD in non-feline species.10,11 Unfortunately, the molecular pathways associated with renal fibrosis in cats are poorly described. The hypoxia-inducible factor family plays a major role in the regulation of adaptive responses to renal hypoxia.12,13 Although the role of HIF-1α in CKD has not been fully elucidated, it has been proposed as a critical factor for the development of renal fibrosis under hypoxic conditions and subsequent renal failure in mice.14 Transforming growth factor-β115 as well as MMPs and their tissue inhibitors16,17 appears to be involved in CKD through modulation of ECM composition. Cats with naturally occurring CKD have an increase in urinary TGF-β1 concentration,18 but expression of MMPs and TIMPs in cats with renal disease has not been characterized. Vascular endothelial growth factor, a proliferative, survival, and trophic factor for endothelial cells, is also strongly stimulated by hypoxia19; however, the limited data available for cats with naturally occurring CKD provide conflicting results regarding the role of VEGF-A in the pathogenesis of the disease.20,a
The objective of the study reported here was to characterize the gene transcription of profibrotic mediators in renal tissues of cats with experimentally induced CKD relative to that in healthy control cats. We hypothesized that transcript levels of profibrotic mediators in renal tissues would be greater in cats with CKD than in healthy cats and that transcript levels of profibrotic mediators would be positively correlated with severity of histologic changes in diseased kidneys.
Materials and Methods
Tissue specimens
Banked renal tissue specimens obtained from cats with experimentally induced CKD (RI group) and cats without evidence of kidney disease (control group) were used for the study. The RI group consisted of renal specimens obtained from 6 purpose-bred spayed female cats of a previous study.6 The cats of that study6 were anesthetized and underwent a midline laparotomy during which the renal artery and vein of the right kidney (ischemic kidney) were occluded for 90 minutes while the vessels of the left kidney (contralateral kidney) were left undisturbed. The cats were monitored for 6 months after surgery and then euthanized.6 Both kidneys were harvested during necropsy and subsequently banked for future use. The control group consisted of right kidney specimens obtained from 8 clinically normal purpose-bred sexually intact female mixed-breed cats that were enrolled in terminal studies unrelated to the study reported here. Procedures for all previous studies were reviewed and approved by the University of Georgia Institutional Animal Care and Use Committee. The study reported here was exempt from institutional animal care and use committee review because only banked tissue specimens were used; no live animals were involved in the study.
Renal function assessment
Renal function data were obtained from previous studies for both study groups. For the cats of the RI group, glomerular filtration rate; SUN and serum creatinine concentrations; USG; and the urine protein-to-creatinine concentration ratio were monitored throughout the previous study,6 and biochemical data were obtained on 2 occasions within 4 days of euthanasia. Mean values were used for the present study. For the cats of the control group, an abbreviated serum biochemical profile (only variables associated with renal function), urinalysis, and calculation of the urine protein-to-creatinine concentration ratio were performed the day of euthanasia. Tissues evaluated in the present study were obtained from cats deemed to have normal renal function and structure on the basis of results of the serum biochemical profile and urinalysis (serum creatinine concentration, < 1.6 mg/dL; USG, > 1.035; and urine protein-to-creatinine concentration ratio, ≤ 0.2) and histologic evaluation of renal specimens. All clinicopathologic analyses were performed by the College of Veterinary Medicine Clinical Pathology Laboratory at the University of Georgia.
Tissue handling and processing
Both kidneys were harvested and evaluated from cats of the RI group, whereas only the right kidney was evaluated from cats of the control group. Kidneys were harvested through a midline incision immediately after euthanasia and confirmation of death. Each harvested kidney was longitudinally sectioned. A fourth to half of each kidney was minced and placed in RNA stabilization solution,b and the remaining portion was placed in neutral-buffered 10% formalin. Thus, equal proportions of the renal cortex, medulla, and corticomedullary junction were maintained for each specimen. The specimens placed in RNA stabilization solution were incubated overnight (approx 18 to 24 hours) at 4°C, after which the specimens were removed from the solution, homogenized by use of a mortar and pestle, divided into 30-mg aliquots, and stored at −80°C until analysis.
Reverse transcription quantitative PCR assay
From each 30-mg tissue homogenate sample, total RNA was extracted by use of a commercially available RNA extraction kitc and quantified with a spectrophotometer.d Integrity of the isolated RNA was confirmed by visualization of 18S and 28S ribosomal bands on 1.2% agarose gels followed by analysis with a bioanalyzer system.e
For each sample, 1 μg of RNA was treated with deoxyribonucleaseg and reverse transcribed with a cDNA reaction master mix.g Quantification was performed in 20-μL-volume reactions. Each reaction contained 10 μL of SYBR green supermix,h 5 pmol of each primer (Appendix 1), and 9 μL of the reverse-transcribed cDNA sample at a 1:40 dilution. Thermal cycling conditionsi consisted of an activation step at 95°C for 30 seconds followed by 36 amplification cycles (denaturation at 95°C for 15 seconds and annealing and extensions at 60°C for 30 seconds) and a melting-curve step (temperature was increased by 0.5°C every 5 seconds between 60°C and 95°C). All reactions were performed in triplicate, and the mean transcript levels for each gene were calculated and used for all further analyses. For each plate, there were 3 control wells with no template (no-template controls) and 1 control well with no reverse transcriptase (no–reverse transcriptase control) for each test sample. All samples were analyzed in one 96-well plate, and each gene was analyzed in 1 run in accordance with the sample maximization method.25 A standard sample was analyzed in triplicate with GAPDH primers in each plate and used as an inter-run control for the entire gene study.
Transcript levels of the target genes HIF-1α, MMP-2, MMP-7, MMP-9, TGF-β1, TIMP-1, and VEGF-A were normalized to those of 3 reference genes (GAPDH, RPS7, and ABL) with commercially available softwarej that uses a previously validated algorithmk as described.26 Reference genes were selected on the basis of primer efficiency, stability value (M value < 0.5), and coefficient of variance (< 0.25) when tested in a complete set of the experiment's samples. Following normalization, transcript levels for each target gene were scaled to those of the lowest sample.
Gene-specific primers were selected from previously reported studies,21–24 when available, or designed with a bioinformatic search tooll as described27 (Appendix 1). Primer efficiencies were calculated by use of the Pfaffl method on the basis of standard curves performed with serial dilutions of cDNA (factor of 2; n = 3 replicates) with a starting dilution of 1:20. Quantitative PCR products were confirmed on 1.2% agarose gels. Amplicons were cloned into a vector systemm and sequenced bidirectionally by chain termination.n Resulting sequences were confirmed against the feline genome through a bioinformatic search tool.l
Histologic evaluation
Formalin-fixed tissue specimens were embedded in paraffin. From each paraffin-embedded specimen, 3-μm-thick sections were cut and stained with Masson trichrome, H&E, and periodic acid–Schiff (with a hematoxylin counterstain) stains. For each specimen, the extent of renal fibrosis (Masson trichrome–stained sections), inflammation (H&E-stained sections), and tubular atrophy (periodic acid–Schiff–stained sections) was assessed concurrently by 2 board-certified veterinary pathologists (CAB and DRR), as described.6 Briefly, for each slide, 10 consecutive 20X fields were examined for both the cortex and corticomedullary junction. Each field was assigned a histologic score determined by both pathologists on a scale of 0 (no abnormalities present) to 3 (severe abnormalities present; Appendix 2). Photomicrographs of feline renal tissue specimens with each histologic score for inflammation and tubular atrophy are available elsewhere,6 and those for fibrosis are available as a supplement to the present report (Supplementary Figure S1, available at avmajournals.avma.org/doi/suppl/10.2460/ajvr.81.2.180). For each abnormality (inflammation, tubular atrophy, and fibrosis), the mean for the 20 numeric histologic scores (10 cortical and 10 corticomedullary fields) was calculated for each kidney and used for analysis purposes.
Statistical analysis
Data distributions for continuous variables were assessed for normality on the basis of visual examination of histograms and normal Q-Q residual plots. Clinical and demographic data for cats were compared between the RI and control groups by means of Mann-Whitney U tests. For analysis purposes, USG measurements > 1.060 were assigned a value of 1.061.
Normalized gene transcript levels underwent a natural logarithmic transformation to normalize the data for analysis. For each target gene (HIF-1α, MMP-2, MMP-7, MMP-9, TGF-β1, TIMP-1, and VEGF-A), transcript levels were evaluated by use of mixed linear regression. Each model included a fixed effect for kidney group (ischemic, contralateral, or control) and a random effect for cat to account for the fact that both the ischemic and contralateral kidneys were evaluated for cats in the RI group. To account for nonindependence of observations between ischemic and contralateral kidneys, various correlation structures were applied to the data, and the fit of the resulting models was compared by means of the Akaike information criterion. The correlation structure that yielded the lowest Akaike information criterion value was used for all further modeling. The Šídák method was used for post hoc pairwise comparisons when necessary. For ischemic kidneys, the Spearman rank correlation coefficient (rS) was used to evaluate the association between the histologic score for each abnormality (inflammation, tubular atrophy, and fibrosis) and the transcript levels of each target gene. Values of P < 0.05 were considered significant for all analyses. All analyses were performed by use of commercial statistical software.o,p
Results
Cats
Descriptive and clinicopathologic data for cats represented in the RI and control groups were summarized (Table 1). The median age (P = 0.002) and body weight (P = 0.008) for cats of the RI group were significantly greater than those for cats of the control group. The cats of the RI group had a progressive decrease in glomerular filtration rate and increase in serum creatinine concentration during the 6 months after experimental induction of renal ischemia.6
Summary of descriptive and clinicopathologic data for cats with experimentally induced CKD (RI group; n = 6) and healthy control cats (8).
| Variable | RI group | Control group | Laboratory reference interval |
|---|---|---|---|
| Age (d) | 520 (472–588)* | 268 (228–294) | NA |
| Body weight (kg) | 4.72 (3.93–5.35)* | 3.59 (2.29–4.47) | NA |
| Serum creatinine (mg/dL)† | 1.4 (1.3–1.6) | 1.0 (0.8–1.2) | 0.6–1.8 |
| SUN (mg/dL)† | 24 (22–27) | 27 (23–34) | 21–36 |
| USG‡ | 1.056 (1.041–1.059) | 1.055 (1.037–1.061) | — |
| Urine protein-to-creatinine concentration ratio | 0.1 (0.05–0.11)* | 0.14 (0.1–0.2) | < 0.5 |
Values represent the median (range) unless otherwise specified. The 6 cats represented in the RI group were all spayed females, whereas the 8 cats represented in the control group were all sexually intact females. For the cats of the RI group, CKD was induced by occlusion of the renal artery and vein of the right kidney (ischemic kidney) for 90 minutes. The cats were monitored for 6 months after surgery and then euthanized.
Value differs significantly (P < 0.01) from that for the control group.
Calculated on the basis of mean data for 2 measurements obtained within 4 days of euthanasia for each cat in the RI group and for a single measurement obtained the day of euthanasia for each cat in the control group.
USG measurements > 1.060 were assigned a value of 1.061 for analysis purposes.
— = Not established. NA = Not applicable.
Normalized gene transcript levels
For 1 cat of the RI group, insufficient RNA was extracted from the tissue homogenate of the contralateral kidney for quantification of gene transcript levels; therefore, gene transcription results were available for only 5 contralateral kidneys. Normalized transcript levels of HIF-1a did not differ significantly (P = 0.372) among the 3 kidney groups (control, contralateral, and ischemic; Figure 1). The mean normalized transcript level of MMP-2 for ischemic kidneys was significantly greater than that for the contralateral kidneys (P = 0.008), but the mean normalized transcript levels of MMP-2 for the control kidneys did not differ significantly from that for the contralateral or ischemic kidneys. Mean normalized transcript levels of MMP-7 (P < 0.001) and MMP-9 (P < 0.002) for the ischemic kidneys were significantly greater than those for the contralateral and control kidneys for MMP-7, and for MMP-9, but did not differ significantly between the contralateral and control kidneys. Mean normalized transcript levels of TIMP-1 and VEGF-A did not differ significantly between ischemic and control kidneys. However, for the control kidneys, the mean transcript level of TIMP-1 was significantly (P = 0.011) lower and the mean transcript level of VEGF-A was significantly (P = 0.002) greater, compared with those for the contralateral and ischemic kidneys. The mean normalized transcript level of TGF-b1 for the ischemic kidneys was significantly (P = 0.045) greater than that for the control kidneys but did not differ significantly between the ischemic and contralateral kidneys or between the control and contralateral kidneys.
Dot plots of normalized transcript levels of target genes MMP-2 (A), MMP-7 (B), MMP-9 (C), TIMP-1 (D), TGF-β1 (E), VEGF-A (F), and HIF-1α (G) in renal tissue homogenates obtained from the right kidney of healthy control cats (black dots; n = 8) and from the contralateral (gray dots; 5) and ischemic (white dots; 6) kidneys of cats with experimentally induced CKD. For the 6 cats with experimentally induced CKD, the condition was induced by occlusion of the renal artery and vein of the right kidney (ischemic kidney) for 90 minutes while the vessels of the left kidney (contralateral kidney) remained undisturbed. The cats were monitored for 6 months after surgery and then euthanized. For 1 cat with experimentally induced CKD, insufficient RNA was extracted from the tissue homogenate of the contralateral kidney for quantification of gene transcription; therefore, only 5 cats are represented in the plots for the contralateral kidney group. For each gene, transcript levels were normalized to those of the reference genes GAPDH, RPS7, and ABL. Following normalization, transcript levels for each target gene were scaled to those of the lowest sample; thus, the y-axis scale varies among panels. For each plot, the long horizontal line represents the mean, and the shorter horizontal lines delimit the mean ± SEM. *†Means of plots with different symbols differ significantly (P < 0.05).
Citation: American Journal of Veterinary Research 81, 2; 10.2460/ajvr.81.2.180
Histologic scores
Consistent with study inclusion criteria, all control kidneys were considered histologically normal and assigned a score of 0 for fibrosis, inflammation, and tubular atrophy. All contralateral kidneys were likewise assigned a histologic score of 0 for fibrosis, inflammation, and tubular atrophy except for 1, which had a mean histologic inflammation score of 0.05. Ischemic kidneys had histologic lesions characterized by tubular atrophy and interstitial inflammation and fibrosis as well as variable numbers of obsolescent glomeruli, consistent with the development of atubular glomeruli and subsequent ischemic glomerulosclerosis.6 The median (range) histologic scores for fibrosis, inflammation, and tubular atrophy for the ischemic kidneys were 1.025 (0.3 to 3), 0.3 (0.2 to 1.65), and 1.025 (0.45 to 1.4), respectively (Figure 2).
Dot plots of the mean histologic scores for fibrosis (A), inflammation (B), and tubular atrophy (C) for the control (black circles), contralateral (gray triangles), and ischemic (white diamonds) kidneys described in Figure 1. The mean histologic score could range from 0 (absent) to 3 (severe) for all 3 abnormalities.
Citation: American Journal of Veterinary Research 81, 2; 10.2460/ajvr.81.2.180
Correlation between histologic scores and gene transcript levels for ischemic kidneys
The Spearman rank correlation coefficients calculated to quantify the association between the histologic score for each abnormality assessed and transcript level of each evaluated gene for ischemic kidneys were summarized (Table 2). There was a significant and strong positive correlation between histologic fibrosis score and the transcript level of HIF-1α (rS = 0.94), MMP-2 (rS = 0.94), MMP-7 (rS = 0.88), and TIMP-1 (rS = 0.94). The histologic inflammation and tubular atrophy scores were not significantly correlated with the transcript levels of any of the target genes evaluated.
Spearman rank correlation coefficients calculated to quantify the association between the mean histologic score for each histologic abnormality assessed and transcript level of each target gene for ischemic kidneys (n = 6) obtained from the cats of Table 1 with experimentally induced CKD.
| Histologic abnormality | |||
|---|---|---|---|
| Gene | Fibrosis | Inflammation | Tubular atrophy |
| HIF-1α | 0.94* | 0.00 | 0.60 |
| MMP-2 | 0.94* | –0.28 | 0.66 |
| MMP-7 | 0.88† | 0.00 | 0.43 |
| MMP-9 | 0.77 | 0.31 | –0.03 |
| TIMP-1 | 0.94* | 0.15 | 0.43 |
| TGF-β1 | 0.60 | 0.15 | 0.09 |
| VEGF-A | –0.14 | –0.62 | 0.43 |
P < 0.01.
P < 0.05.
Discussion
The banked renal tissue samples evaluated in the present study were obtained from 8 healthy control cats and 6 cats with experimentally induced CKD (RI group). For the cats of the RI group, CKD was induced by occlusion of the renal artery and vein of the right kidney (ischemic kidney) for 90 minutes, while the vessels of the left kidney (contralateral kidney) were left undisturbed; the cats were monitored for 6 months after surgery and then euthanized. Results of the present study indicated that gene transcription of hypoxia-induced mediators of fibrosis in renal tissue homogenates varied significantly between cats with experimentally induced CKD and healthy control cats. In general, transcription of MMP-7, MMP-9, TIMP-1, and TGF-β1 was upregulated and transcription of VEGF-A was downregulated in kidneys of cats with CKD, compared with healthy control kidneys. Moreover, there was a significant strong positive correlation between the transcript abundance of HIF-1α, MMP-2, MMP-7, and TIMP-1 and the histologic severity of fibrosis for ischemic kidneys, which further supported the role of those specific hypoxia-induced mediators of fibrosis in the development of CKD in cats.
In the present study, the ischemic kidneys of the RI group were harvested 6 months after a single transient hypoxic insult. The fact that altered transcription of genes associated with profibrotic pathways was detected in those kidneys suggested that a single transient hypoxic event can trigger a profibrotic cascade that remains active for months after the insult. Acute kidney injury and CKD, although once considered separate disease entities, are now recognized as interconnected syndromes.28,29 Results of the present study supported the link between acute kidney injury and CKD and identified specific cytokines that might be involved in the progression of CKD in cats. Further, because the histologic characteristics of kidneys from cats with CKD are similar to those of kidneys from humans with advanced stages of CKD30,31 and several forms of CKD of unknown etiology32,33 as well as various tubulointerstitial nephropathies,34,35 CKD in cats has been proposed as a naturally occurring model to study the profibrotic mechanisms that lead to progression of CKD in human patients.36 Therefore, the results of the present study may be useful in the design of future translational research.
Hypoxia is a potent regulator of gene expression, with a broad range of molecular targets.9 In regard to the pathogenesis of CKD, renal hypoxia may be caused by a decrease in peritubular capillary blood flow owing to an imbalance in vasoactive factors, loss of capillary integrity, increase in oxygen demand from compensatory hyperfiltration and tubular hypertrophy, and increase in oxygen diffusion distance between peritubular capillaries and tubular and interstitial cells subsequent to accumulation of ECM.37–39 The resulting decrease in local oxygen tension exacerbates tubular injury, leading to tubular cell necrosis and tubular rupture, activation of resident interstitial fibroblasts, myofibroblast differentiation, further accumulation of ECM, and recruitment of inflammatory cells, which culminate in tubulointerstitial inflammation and fibrosis and further local hypoxia.10,31 Thus, we hypothesized that profibrotic pathways triggered by hypoxia would be differentially regulated in ischemia-induced CKD.
In the present study, although there was a significant positive correlation between transcription of HIF-1α and interstitial fibrosis for ischemic kidneys, the mean normalized transcript levels of HIF-1α did not differ significantly among ischemic kidneys, contralateral kidneys, and control kidneys. Hypoxia-inducible factor-1 is a master regulator of oxygen homeostasis and plays critical roles in both cellular and systemic physiology and pathophysiology.40 In human patients with CKD, an increase in renal HIF-1α expression is associated with tubulointerstitial injury.41 Therefore, the finding that transcription of HIF-1α was not significantly upregulated in the ischemic kidneys relative to the control kidneys in the present study was unexpected. It is possible that HIF-1α transcription is only transiently increased following an ischemic event, and because the ischemic kidney specimens evaluated in the present study were harvested and banked 6 months after the ischemic insult, HIF-1α transcription was no longer upregulated. Also, the mechanisms by which hypoxia alters ECM metabolism in renal cells appear to involve both transcriptional and posttranscriptional events and can be initiated by mechanisms that are and are not dependent on HIF-1α.9 Posttranscription regulation of HIF-1α expression was not evaluated in the present study. Regardless, the strong positive correlation between transcript levels of HIF-1α and fibrosis severity for ischemic kidneys suggested that complex interactions in vivo might influence the relationship between gene transcription and morphometric renal changes.
Matrix metalloproteinases are an important group of enzymes that regulate ECM composition.42 Expression of most MMPs is normally low in healthy tissues. Matrix metalloproteinase expression is induced when remodeling of the ECM is required and is primarily regulated at the transcriptional level.42 Despite the critical role of MMPs in matrix degradation, they can both inhibit and stimulate regulation of fibrosis.43,44 Results of studies of CKD in rodents indicate that the collagenases MMP-2 and MMP-945 and the matrilysin MMP-744,46 have profibrotic effects, and all 3 of those MMPs were upregulated in the ischemic feline kidneys evaluated in the present study. Upregulation of MMP-2 and MMP-9 has also been documented in diabetic human patients with CKD.47 In children with CKD, serum concentrations of MMP-2 and MMP-9 and their inhibitors TIMP-1 and TIMP-2 are increased in proportion to disease stage.48 Matrix metalloproteinase-7 is an important mediator of fibrosis in patients with CKD and a urinary biomarker for renal fibrosis.46,49 In humans, urine MMP-7 activity is positively correlated with renal fibrosis scores.49 In the present study, the mean transcript level of MMP-2 was numerically greater and the mean transcript level of MMP-7 was significantly greater for ischemic kidneys, compared with the corresponding transcript levels for the contralateral kidneys, and both MMP-2 and MMP-7 were significantly and positively correlated with fibrosis severity of ischemic kidneys. Those findings suggested the MMP-7 may be a useful biomarker for renal fibrosis in cats, although further evaluation of MMP-7 activity in the urine of cats with and without CKD is necessary before its use is recommended for clinical patients.
Research indicates that there is a close relationship between MMP-7 and TGF-β signaling in renal disease.46 Activation of TGF-β triggers a series of events that promote fibrosis, including transcription of genes that encode matrix proteins, inhibitors of matrix-degrading enzymes, and matrix-binding integrin receptors; transformation of fibroblasts into myofibroblasts; and chemotaxis of fibroblasts and monocytes.15 The urine TGF-β1-to-creatinine concentration ratio is greater in cats with CKD than in healthy cats.18 In the present study, there was a significant and strong positive correlation between transcript levels of TGF-β1 and severity of interstitial fibrosis in ischemic kidneys.
In the present study, transcript levels of VEGF-A were significantly greater in the kidneys of cats with experimentally induced CKD than in the kidneys of control cats. That finding was consistent with the fact that the urine VEGF-to-creatinine concentration ratio is decreased in cats with naturally occurring CKD.20 Loss of peritubular capillary density, possibly modulated by a decrease in expression of VEGF or other angiogenic factors, has been proposed as a contributor to progression of renal disease as well as age-associated decline in renal function.50 In cats, CKD even at its earliest stages has a histologic pattern that is characterized by marked tubulointerstitial changes with limited glomerular injury.3,5 That pattern was observed in the ischemic kidneys evaluated in the present study and suggested that a decrease in VEGF-A transcription may be a feature of certain types of CKD, although a causal relationship between downregulation of VEGF-A and progression of renal disease has yet to be established. In fact, in human medicine, VEGF has been described as having both protective and deleterious effects on renal function dependent on the type or form of CKD.19 Unfortunately, distinction between VEGF and VEGF-A has been inconsistent in previous studies. In 1 study,20 the urine VEGF-to-creatinine concentration ratio was significantly lower in cats with spontaneous CKD than in healthy control cats, and that ratio is inversely correlated with the development of azotemia following treatment of hyperthyroidism in cats.51 However, in another study,a an increase in urine VEGF concentration was associated with progression of azotemia and a decrease in survival time for cats with CKD. Thus, as for the other mediators evaluated in the present study, the role of VEGF in the pathogenesis of CKD appeared to be complex.
An interesting finding of the present study was the fact that, relative to the healthy control kidneys, VEGF-A was downregulated and TIMP-1 was upregulated in the contralateral (unmanipulated) kidneys of cats with experimentally induced CKD. That suggested there was crosstalk between kidneys in response to a unilateral renal insult. Following unilateral renal injury, mediators that may affect gene transcription in the uninjured contralateral kidney include circulating hormones, cytokines, or exosomes containing microRNAs,52,53 none of which were assessed in the present study. In rats, experimental induction of transient ischemia followed by reperfusion of 1 kidney resulted in production of tumor necrosis factor α and neutrophil infiltration through a tumor necrosis factor α–dependent mechanism in both kidneys.54 In a similar study,55 experimentally induced transient ischemia and reperfusion of 1 kidney resulted in inflammatory cell infiltration in both kidneys of aged rats but not younger rats. In the present study, inflammation was not observed in the contralateral kidneys of the cats with experimentally induced unilateral renal ischemia; however, the cats from which the kidney specimens were obtained were young adults (median age, 1.4 years) and not aged or geriatric cats. Further research is necessary to determine whether unilateral renal injury triggers alterations in gene transcription and induces inflammation in both kidneys of aged cats.
The present study was not without limitations. The design was constrained by the availability of banked kidney specimens from a fairly small number of cats that underwent experimentally induced transient unilateral renal ischemia in a previous study.6 Kidney specimens from a sham-operated control group were not available. Therefore, it is possible that some of the alterations described, particularly those in the contralateral kidneys, might have been the result of decreased renal perfusion during anesthesia rather than a consequence of crosstalk between the 2 kidneys following unilateral renal injury. Additionally, changes in select molecular patterns were assessed exclusively by measurement of gene transcript levels; measurement of the proteins transcribed by those genes was not performed. It is possible that posttran-scription regulation might cause protein concentration alterations different from those suggested by the transcript level data. The cats represented in the RI group were all spayed females, whereas the cats represented in the control group were all sexually intact females. Also, the cats of the RI group were older (1.4 years vs 9 months) and heavier (4.72 vs 3.59 kg) than the control cats. It is possible that differences in age and neuter status might have affected gene transcription. Finally, for the cats of the RI group, changes in gene transcript levels for renal profibrotic pathways were evaluated at only 1 point in time 6 months after unilateral renal ischemia. Thus, changes in renal gene transcription soon after ischemic injury were not evaluated. That fact was important because the histopathologic lesions observed (eg, fibrosis) were indicative of chronic changes, which were likely a consequence of altered gene expression soon after renal injury, and those alterations may or may not have been ongoing at the time of euthanasia and kidney harvest. Because renal fibrosis contributes to chronic tissue hypoxia,10,11 the gene transcription changes observed in the present study might have been the result rather than a cause of the renal tubulointerstitial fibrosis observed. Future prospective studies should include a larger number of cats with experimentally induced CKD that are matched with healthy control cats on the basis of age and sex, and specimens should be obtained at various times < 6 months after ischemic injury. Further research involving cats with naturally occurring CKD is also necessary to determine whether conclusions drawn regarding renal molecular profibrotic pathways in cats with experimentally induced CKD hold true for cats with natural disease.
Results of the present study indicated that there was differential regulation of transcription of genes associated with major profibrotic pathways in renal specimens obtained from cats with experimentally induced CKD, compared with healthy control cats. Chronic kidney disease was induced by transient unilateral renal ischemia, and 6 months later, alterations in gene transcript levels were detected in ischemic as well as contralateral kidneys. Further research into profibrotic pathways associated with CKD in cats is necessary to identify new biomarkers for renal fibrosis and therapeutic targets for the identification and treatment of cats with naturally occurring disease.
Acknowledgments
This work was performed at the University of Georgia College of Veterinary Medicine.
Supported by a grant from the Department of Small Animal Medicine and Surgery, College of Veterinary Medicine, University of Georgia. Dr. Bianca Lourenço is the recipient of a Boehringer Ingelheim Postdoctoral Scholarship, and her ORCID No. is 0000–0001–5249–4645.
Presented in part as an oral abstract at the American College of Veterinary Internal Medicine Forum, Seattle, June 2018.
The authors thank Daven Khana for assistance with the molecular experiments.
ABBREVIATIONS
| ABL | V-abl Abelson murine leukemia viral oncogene homolog |
| CKD | Chronic kidney disease |
| ECM | Extracellular matrix |
| GAPDH | Glyceraldehyde 3-phosphate dehydrogenase |
| HIF-1α | Hypoxia-inducible factor-1α |
| MMP | Matrix metalloproteinase |
| RPS7 | Ribosomal protein S7 gene |
| TGF-β | Transforming growth factor-β |
| TIMP | Tissue inhibitor of metalloproteinase |
| USG | Urine specific gravity |
| VEGF | Vascular endothelial growth factor |
Footnotes
Chakrabarti S, Syme HM, Elliott J. Urinary vascular endothelial growth factor as a prognostic marker in feline chronic kidney disease (abstr). J Vet Intern Med 2012;26:1524.
RNAlater stabilization solution, Quiagen, Valencia, Calif.
RNeasy Plus Mini Kit, Qiagen, Valencia, Calif.
NanoDrop Spectrophotometer, Thermo Fisher Scientific, Waltham, Mass.
2100 Bioanalyzer system, Agilent Technologies, Palo Alto, Calif.
ezDNase, Invitrogen, Carlsbad, Calif.
SuperScript IV VILO Master Mix, Invitrogen, Carlsbad, Calif. h. SsoAdvanced SYBR Green Supermix, Bio-Rad Laboratories, Hercules, Calif.
CFX96, Bio-Rad Laboratories, Hercules, Calif.
CFX Manager, Bio-Rad Laboratories, Hercules, Calif.
geNorm, Center for Medical Genetics, Ghent, Belgium.
BLAST, National Center for Biotechnology Information, National Institutes of Health, Bethesda, Md. Available at: blast.ncbi.nlm.nih.gov/Blast.cgi. Accessed Apr 8, 2017.
PGEM-T easy vector, Promega, Madison, Wis.
Molecular Cloning Laboratories, San Francisco, Calif.
SPSS Statistics for Windows, version 24, IBM Corp, Armonk, NY.
Prism for Mac, version 7, GraphPad Software Inc, La Jolla, Calif.
References
1. Lulich J, Osborne C, O'Brien T, et al. Feline renal failure: questions, answers, questions. Compend Contin Educ Pract Vet 1992;14:127–153.
2. Marino CL, Lascelles BD, Vaden SL, et al. Prevalence and classification of chronic kidney disease in cats randomly selected from four age groups and in cats recruited for degenerative joint disease studies. J Feline Med Surg 2014;16:465–472.
3. Brown CA, Elliott J, Schmiedt CW, et al. Chronic kidney disease in aged cats: clinical features, morphology, and proposed pathogeneses. Vet Pathol 2016;53:309–326.
4. Chakrabarti S, Syme HM, Brown CA, et al. Histomorphometry of feline chronic kidney disease and correlation with markers of renal dysfunction. Vet Pathol 2013;50:147–155
5. McLeland SM, Cianciolo RE, Duncan CG, et al. A comparison of biochemical and histopathologic staging in cats with chronic kidney disease. Vet Pathol 2015;52:524–534.
6. Brown CA, Rissi DR, Dickerson VM, et al. Chronic renal changes after a single ischemic event in an experimental model of feline chronic kidney disease. Vet Pathol 2019;56:536–543
7. Schmiedt CW, Brainard BM, Hinson W, et al. Unilateral renal ischemia as a model of acute kidney injury and renal fibrosis in cats. Vet Pathol 2016;53:87–101.
8. DiBartola SP, Rutgers HC, Zack PM, et al. Clinicopathologic findings associated with chronic renal disease in cats: 74 cases (1973–1984). J Am Vet Med Assoc 1987;190:1196–1202.
9. Fine LG, Bandyopadhay D, Norman JT. Is there a common mechanism for the progression of different types of renal diseases other than proteinuria? Towards the unifying theme of chronic hypoxia. Kidney Int Suppl 2000;75:S22–S26.
10. Fine LG, Norman JT. Chronic hypoxia as a mechanism of progression of chronic kidney diseases: from hypothesis to novel therapeutics. Kidney Int 2008;74:867–872.
11. Palm F, Nordquist L. Renal tubulointerstitial hypoxia: cause and consequence of kidney dysfunction. Clin Exp Pharmacol Physiol 2011;38:474–480.
12. Nangaku M, Eckardt KU. Hypoxia and the HIF system in kidney disease. J Mol Med (Berl) 2007;85:1325–1330.
13. Leonard MO, Cottell DC, Godson C, et al. The role of HIF-1α in transcriptional regulation of the proximal tubular epithelial cell response to hypoxia. J Biol Chem 2003;278:40296–40304.
14. Kimura K, Iwano M, Higgins DF, et al. Stable expression of HIF-1α in tubular epithelial cells promotes interstitial fibrosis. Am J Physiol Renal Physiol 2008;295:F1023–F1029
15. Eddy AA. Molecular basis of renal fibrosis. Pediatr Nephrol 2000;15:290–301.
16. Catania JM, Chen G, Parrish AR. Role of matrix metalloproteinases in renal pathophysiologies. Am J Physiol Renal Physiol 2007;292:F905–F911.
17. Tan RJ, Liu Y. Matrix metalloproteinases in kidney homeostasis and diseases. Am J Physiol Renal Physiol 2012;302:F1351–F1361.
18. Arata S, Ohmi A, Mizukoshi F, et al. Urinary transforming growth factor-β1 in feline chronic renal failure. J Vet Med Sci 2005;67:1253–1255.
19. Kang D-H, Johnson RJ. Vascular endothelial growth factor: a new player in the pathogenesis of renal fibrosis. Curr Opin Nephrol Hypertens 2003;12:43–49.
20. Habenicht LM, Webb TL, Clauss LA, et al. Urinary cytokine levels in apparently healthy cats and cats with chronic kidney disease. J Feline Med Surg 2013;15:99–104.
21. Riedel J, Badewien-Rentzsch B, Kohn B, et al. Characterization of key genes of the renin-angiotensin system in mature feline adipocytes and during in vitro adipogenesis. J Anim Physiol Anim Nutr (Berl) 2016;100:1139–1148.
22. Kessler Y, Helfer-Hungerbuehler AK, Cattori V, et al. Quantitative TaqMan real-time PCR assays for gene expression normalisation in feline tissues. BMC Mol Biol 2009;10:106.
23. Agaoglu OK, Agaoglu AR, Guzeloglu A, et al. Expression of hypoxia-inducible factors and vascular endothelial growth factor during pregnancy in the feline uterus. Theriogenology 2015;84:24–33.
24. Agaoglu OK, Agaoglu AR, Guzeloglu A, et al. Gene expression profiles of some cytokines, growth factors, receptors, and enzymes (GM-CSF, IFNγ, MMP-2, IGF-II, EGF, TGF-β, IGF-IIR) during pregnancy in the cat uterus. Theriogenology 2016;85:638–644.
25. Bustin SA, Benes V, Garson JA, et al. The MIQE guidelines: minimum information for publication of quantitative real-time PCR experiments. Clin Chem 2009;55:611–622.
26. Vandesompele J, De Preter K, Pattyn F, et al. Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol 2002;3:research0034.1.
27. Ye J, Coulouris G, Zaretskaya I, et al. Primer-BLAST: a tool to design target-specific primers for polymerase chain reaction. BMC Bioinformatics 2012;13:134.
28. Cowgill LD, Polzin DJ, Elliott J, et al. Is progressive chronic kidney disease a slow acute kidney injury? Vet Clin North Am Small Anim Pract 2016;46:995–1013.
29. Kaballo MA, Elsayed ME, Stack AG. Linking acute kidney injury to chronic kidney disease: the missing links. J Nephrol 2017;30:461–475.
30. Hodgkins KS, Schnaper HW. Tubulointerstitial injury and the progression of chronic kidney disease. Pediatr Nephrol 2012;27:901–909.
31. Mimura I, Nangaku M. The suffocating kidney: tubulointerstitial hypoxia in end-stage renal disease. Nat Rev Nephrol 2010;6:667–678.
32. Gifford FJ, Gifford RM, Eddleston M, et al. Endemic nephropathy around the world. Kidney Int Rep 2017;2:282–292.
33. Weaver VM, Fadrowski JJ, Jaar BG. Global dimensions of chronic kidney disease of unknown etiology (CKDu): a modern era environmental and/or occupational nephropathy? BMC Nephrol 2015;16:145.
34. Joyce E, Glasner P, Ranganathan S, et al. Tubulointerstitial nephritis: diagnosis, treatment, and monitoring. Pediatr Nephrol 2017;32:577–587.
35. Bleyer AJ, Kidd K, Živná M, et al. Autosomal dominant tubulointerstitial kidney disease. Adv Chronic Kidney Dis 2017;24:86–93.
36. Lawson JS, Liu H-H, Syme HM, et al. The cat as a naturally occurring model of renal interstitial fibrosis: characterisation of primary feline proximal tubular epithelial cells and comparative pro-fibrotic effects of TGF-β1. PLoS One 2018;13:e0202577.
37. Norman JT, Fine LG. Intrarenal oxygenation in chronic renal failure. Clin Exp Pharmacol Physiol 2006;33:989–996.
38. Palm F, Nordquist L. Renal oxidative stress, oxygenation, and hypertension. Am J Physiol Regul Integr Comp Physiol 2011;301:R1229–R1241.
39. Haase VH. Hypoxia-inducible factor signaling in the development of kidney fibrosis. Fibrogenesis Tissue Repair 2012;5 (suppl 1): S16.
40. Semenza GL. Regulation of mammalian O2 homeostasis by hypoxia-inducible factor 1. Annu Rev Cell Dev Biol 1999;15:551–578.
41. Higgins DF, Kimura K, Bernhardt WM, et al. Hypoxia promotes fibrogenesis in vivo via HIF-1 stimulation of epithelial-to-mesenchymal transition. J Clin Invest 2007;117:3810–3820.
42. Chakraborti S, Mandal M, Das S, et al. Regulation of matrix metalloproteinases: an overview. Mol Cell Biochem 2003;253:269–285.
43. Giannandrea M, Parks WC. Diverse functions of matrix metalloproteinases during fibrosis. Dis Model Mech 2014;7:193–203.
44. Eddy AA. Overview of the cellular and molecular basis of kidney fibrosis. Kidney Int Suppl (2011) 2014;4:2–8.
45. Zeisberg M, Neilson EG. Mechanisms of tubulointerstitial fibrosis. J Am Soc Nephrol 2010;21:1819–1834.
46. Ke B, Fan C, Yang L, et al. Matrix metalloproteinases-7 and kidney fibrosis (Erratum published in Front Physiol 2017;8:192). Front Physiol 2017;8:21.
47. Chung AW, Yang HH, Sigrist MK, et al. Matrix metalloproteinase-2 and −9 exacerbate arterial stiffening and angiogenesis in diabetes and chronic kidney disease. Cardiovasc Res 2009;84:494–504.
48. Musiał K, Zwolinska D. Matrix metalloproteinases (MMP-2,9) and their tissue inhibitors (TIMP-1,2) as novel markers of stress response and atherogenesis in children with chronic kidney disease (CKD) on conservative treatment. Cell Stress Chaperones 2011;16:97–103.
49. Zhou D, Tian Y, Sun L, et al. Matrix metalloproteinase-7 is a urinary biomarker and pathogenic mediator of kidney fibrosis. J Am Soc Nephrol 2017;28:598–611.
50. Kang DH, Kanellis J, Hugo C, et al. Role of the microvascular endothelium in progressive renal disease. J Am Soc Nephrol 2002;13:806–816.
51. Williams TL, Elliott J, Syme HM. Association between urinary vascular endothelial growth factor excretion and chronic kidney disease in hyperthyroid cats. Res Vet Sci 2014;96:436–441.
52. Guay C, Regazzi R. Exosomes as new players in metabolic organ cross-talk. Diabetes Obes Metab 2017;19 (suppl 1):137–146.
53. White LE, Hassoun HT. Inflammatory mechanisms of organ crosstalk during ischemic acute kidney injury. Int J Nephrol 2012;2012:505197.
54. Meldrum KK, Meldrum DR, Meng X, et al. TNF-α-dependent bilateral renal injury is induced by unilateral renal ischemia-reperfusion. Am J Physiol Heart Circ Physiol 2002;282:H540–H546.
55. Kato J, Nakayama M, Zhu WJ, et al. Ischemia/reperfusion of unilateral kidney exaggerates aging-induced damage to the heart and contralateral kidney. Nephron Exp Nephrol 2014;126:183–190.
Appendix 1
Gene primer sequences used for reverse transcription quantitative PCR assays to assess gene transcript levels in kidney specimens obtained from cats with and without experimentally induced CKD.
| Gene | Ensemble identification or NCBI accession No. | Primer sequence (5′→ 3′) | Fragment size (bp) | Reference No. or source |
|---|---|---|---|---|
| GAPDH* | ENSFCAG 00000006874 | Forward: GCTGCCCAGAACATCATCC | 134 | 21 |
| Reverse: GTCAGATCCACGACGGACAC | ||||
| RPS7* | NM_001009832 | Forward: GTCCCAGAAGCCGCACTT T | 74 | 22 |
| Reverse: CACAATCTCGCTCGGGAA AA | ||||
| ABL* | ENSFCAT | Forward: TGTGGCGAGTGGTGATAATACAC | 83 | 22 |
| 00000005306 | Reverse: TCCACTCACCATTCTGGTTGTAA | |||
| HIF-1α | XM_001493206 | Forward: TTGGCAGCAATGACACAGACACTG | 175 | 23 |
| Reverse: TTGAGTGCAGGGTCAGCACTACTT | ||||
| MMP-2 | XM_003998042.2 | Forward: AGACAAGTTCTGGAGGTACAATG | 149 | Footnote l |
| Reverse: CGCCCTTGAAGAAGTAGCTGT | ||||
| MMP-7 | XM_003992303.2 | Forward: CTTTGCAAGAGGAGCTCACG | 148 | Footnote l |
| Reverse: AATTCCTAGACCCCTGCCGT | ||||
| MMP-9 | XM_003983412.4 | Forward: GCTTCTGGAGGTTCGACGTG | 148 | Footnote l |
| Reverse: CAATAGAAGCGGTCCTGGCA | ||||
| TGF-β1 | AY425617.1 | Forward: AGCACGTGGAGCTGTACCAGAAAT | 110 | 24 |
| Reverse: TCCAGTGACATCAAAGGACAGCCA | ||||
| TIMP-1 | XM_011291721.2 | Forward: TCTCATCGCCGGAAAACTGC | 122 | Footnote l |
| Reverse: AGCCAGCAGCATAGGTCTTG | ||||
| VEGF-A | AB071947.1 | Forward: TTTCTGCTCTCTTGGGTGCATTGG | 139 | 23 |
| Reverse: TGCGCTGGTAGACATCCATGAACT |
Reference gene.
NCBI = National Center for Biotechnology Information.
Appendix 2
Description of the histologic scoring system used to assess feline renal tissue specimens for inflammation, tubular atrophy, and fibrosis.
| Histologic score | Histologic abnormality | ||
|---|---|---|---|
| Inflammation | Tubular atrophy | Fibrosis | |
| 0 | No inflammatory cells | No atrophy | Absent |
| 1 | Mild; < 10% of interstitium in the field affected | Mild; < 10 scattered atrophic tubules | Mild; rare foci or segments of fibrosis involving < 20% of the cortex |
| 2 | Moderate; 10% to 50% of the field affected | Moderate; linear streaks of tubular atrophy often with fibrosis and inflammation | Moderate; fibrotic segments involving 20% to 30% of the cortex |
| 3 | Severe; > 50% of the field affected | Severe; ≥ 2 streaks of tubular atrophy present | Severe; fibrotic segments involving > 30% of the cortex |
Inflammation was assessed on H&E-stained sections. Tubular atrophy was assessed on periodic acid–Schiff–stained sections with hematoxylin used as a counterstain. Fibrosis was assessed on Masson trichrome–stained sections.
