Leptin and adiponectin are the most common adipokines in dogs. They are proteins produced in adipose tissue and are important factors in the pathophysiologic processes of obesity and its related conditions.1 Leptin is encoded by the ob gene and is responsible for the regulation of food intake and energy expenditure.2,3 Leptin can also regulate reproductive and immune function and modulate insulin sensitivity.1
Hyperadrenocorticism (commonly referred to as Cushing syndrome) describes the clinical manifestations of chronic hypercortisolemia that result from various metabolic changes associated with exogenous administration of glucocorticoids or endogenous overproduction.4 Those metabolic changes include dyslipidemia, glucose intolerance, hypercoagulability, arterial hypertension, and obesity with an increase in visceral adiposity.5–7 Abdominal visceral obesity is one of the most common features of humans with hyperadrenocorticism.8 In addition, redistribution of body fat in human patients with hyperadrenocorticism leads to increases in the proportion of fat in the visceral compartment and metabolic complications.9–11
Serum leptin concentrations are positively correlated with total body fat, but serum adiponectin concentrations are inversely correlated with visceral adiposity in humans.12 Thus, changes in fat mass may dysregulate the production and secretion of adipokines and contribute to the pathogenesis of several metabolic and cardiovascular complications.13–15 Visceral obesity might also occur in dogs with hypercortisolemia, but it has not been definitively verified. Similar to results for humans12 and rodents,16 circulating leptin concentrations are positively correlated with body fat in dogs, but there is controversy regarding the correlation between adiponectin concentrations and body fat in dogs.17
In humans, glucocorticoids act directly on adipose tissue, increase leptin secretion and expression, and inhibit adiponectin secretion.3,18 In another study19 conducted by our research group, we reported that the serum leptin concentration in dogs with pituitary-dependent hyperadrenocorticism was significantly higher than the concentration in healthy dogs. The increase in visceral fat distribution in humans with hyperadrenocorticism is associated with changes in the production and expression of leptin.11,20 However, there is a lack of information about fat redistribution and leptin mRNA expression in the visceral adipose tissue of dogs with hypercortisolemia.
Therefore, the objective of the study reported here was to examine the effects of oral administration of hydrocortisone on serum leptin and adiponectin concentrations, mRNA expression of leptin and adiponectin in visceral fat, and abdominal fat distribution in dogs. Furthermore, we intended to evaluate the correlation between the serum leptin concentration and visceral fat mass.
Materials and Methods
Animals
Twelve 1-year-old male research Beagles were used in the study. The dogs were evaluated and treated at the Laboratory Research Center of Chungbuk National University. Body weight ranged from 10.19 to 12.21 kg (median, 11.35 kg). Dogs were considered healthy on the basis of results of a physical examination, indirect measurement of systolic blood pressure, examination of fecal specimens for parasites by use of a flotation technique, heartworm antigen test, CBC, serum biochemical analysis, urinalysis, ACTH response test,19 thyroid gland function test, and diagnostic imaging (survey radiography and abdominal ultrasonography).
Dogs were housed separately in cages with a light cycle of 12 hours of light and 12 hours of darkness. They were fed a commercial dieta (amount of the diet was determined on the basis of the energy requirement for maintenance calculated with the body weight) and had ad libitum access to drinking water. None of the dogs received any drugs before the onset of the study.
Dogs were handled in accordance with published guidelines.21 The study was approved by the Institutional Animal Care and Use Committee of the Laboratory Animal Research Center of Chungbuk National University (CBNUA-713-14-01).
Study design
Dogs were randomly allocated (block randomization method) into 2 groups (6 dogs/group) by use of commercial software.b Dogs in the control group received an empty gelatin capsule. For dogs in the hydrocortisone group, hypercortisolemia was induced by the administration of hydrocortisone, which is the synthetic glucocorticoid most similar to cortisol.22 The hydrocortisone dosage was chosen on the basis of studies8,23 in which hypercortisolemia was induced in dogs. Dogs received hydrocortisonec (8.5 mg/kg) orally every 12 hours for 90 days, after which the dose was tapered over a 2-month period until administration was stopped. Day 0 (baseline) was the day before the start of hydrocortisone or placebo administration. Dogs were monitored daily for development of clinical signs of hypercortisolemia (eg, polyuria, polydipsia, polyphagia, and skin abnormalities).
Collection of blood samples
Blood samples (2 mL) were collected before (day 0) and during (days 1, 3, 7, 30, 60, and 90) the treatment period. Food was withheld from the dogs for 12 hours before blood collection, but water was freely available during food withholding. The investigators were extremely careful to ensure food was not visible to any dogs at the time of blood collection.
Blood was collected from a jugular vein into serum separating tubes. Serum was separated from clotted blood by centrifugation at 1,200 × g for 10 minutes. All samples were centrifuged within 30 minutes after blood collection. Serum was stored at −80°C until assayed as a batch analysis (maximum duration of storage, 97 days).
Assessment of abdominal fat distribution
Dogs were anesthetized, and total body fat, visceral body fat, and subcutaneous body fat in the abdomen were measured by use of a CT method. Anesthesia was induced by administration of propofold (5 mg/kg, IV) and maintained with isofluranee in oxygen. The CT imaging was performed before (day 0) and during (days 30, 60, and 90) administration of hydrocortisone. Dogs were positioned in dorsal recumbency, and all images were obtained by use of helical CTf with the following parameters: rotation time, 0.7 seconds; slice thickness, 3 mm; x-ray tube potential, 120 kV; and x-ray tube current, 130 mA. All images were acquired from the apex of the heart through the caudal aspect of the sacroiliac articulation. Thresholds of −105 to −135 HU were used to assess fat.24
Visceral and subcutaneous fat mass were assessed separately. Regions of interest4 were manually drawn around the abdominal cavity on the CT image of each dog. Visceral fat and subcutaneous fat were measured at the level of each cross section by quantifying the fat mass. Subcutaneous fat mass was calculated by subtracting the visceral fat mass from the total fat mass. Total fat mass, visceral fat mass, and subcutaneous fat mass for the entire abdomen were calculated as the sum of each fat value from the sum of all slices from the heart apex to the caudal aspect of the sacroiliac articulation.
A single 3-mm-thick slice at the level of L3 was used for fat mass analysis.24 To compare changes of the abdominal fat mass attributable to administration of hydrocortisone, several values for fat distribution were used, which included the total, visceral, and subcutaneous fat masses25; percentage of visceral fat mass, which was calculated as the ratio of visceral fat mass to total fat mass; and ratio of visceral fat mass to subcutaneous fat mass. All CT images were analyzed by an experienced investigator (DC) who was not aware of the treatment group of each dog.
Collection of adipose tissue samples
Immediately after CT was completed, visceral adipose tissue samples were surgically obtained from the anesthetized dogs. All dogs received cefazoling (30 mg/kg, IV) prophylactically before the procedure.
Dogs were positioned in dorsal recumbency. Hair was shaved from the incision site (caudal right quadrant of the abdomen), and the skin was aseptically prepared. Dogs were then moved to an operating room. The incision site was sprayed with 4% chlorhexidine gluconate and 70% ethanol until the skin was saturated. After a 3-minute period, dry sterile gauze was used to soak up excess antiseptic solution, and the abdomen was draped.
An incision (3 to 5 cm) was made. Samples of visceral adipose tissue were obtained aseptically. Approximately 3 cm3 of visceral adipose tissue were procured from the abdominal region. The extracted visceral adipose tissue was excised with a surgical blade. Biopsy resulted in minimal bleeding. The muscle and skin were sutured with a simple interrupted pattern.
After sample collection was completed, dogs received saline (0.9% NaCl) solution (60 mL/kg, IV, for 24 hours), cefazolin (30 mg/kg, IV, q 12 h for 3 days), famotidineh (0.5 mg/kg, IV, q 12 h for 3 days), and butorphanol tartratei (0.2 mg/kg, IV, q 12 h for 3 days). The incision site was carefully managed by application of povidone-iodine solution to prevent postoperative infection. Rectal temperature, pulse and respiration rates, indirect arterial blood pressure, mucous membrane color, and capillary refill time were monitored every 15 to 30 minutes after sample collection until dogs had completely recovered from anesthesia; these variables then were monitored every 8 hours for 1 week. No complications were observed in any dogs during or after biopsy, and none of the dogs were removed from the study.
Biopsy samples were immediately rinsed with saline solution.j An aliquot (1 mL) of guanidinium thiocyanatek was added to each biopsy sample. Samples were inspected to verify tissue homogeneity, snap-frozen in liquid nitrogen, and stored at −80°C until analyzed.
Assay of serum concentrations
Serum biochemical analyses were performed with an autoanalyzer.l All samples were assayed in duplicate. Serum leptin concentrations were analyzed by use of a canine-specific ELISA kitm used in accordance with the manufacturer's instructions. Sensitivity for the leptin assay was 0.78 ng/mL, intra-assay variability was 2%, and interassay variability was 6%. Serum adiponectin concentrations were analyzed by use of a commercially available ELISA kitn that had been validated for use with canine serum26; the kit was used in accordance with the manufacturer's instructions. Sensitivity for the adiponectin assay was 0.47 ng/mL, intra-assay variability was 3.9%, and inter-assay variability was 6.0%.
Assessment of mRNA expression
Samples of mRNA were extracted from the abdominal adipose tissue. The RNA was extracted with guanidinium thiocyanate; the concentration of total RNA was determined at 260 nm. The amount of 18S rRNA served as an indicator of the quantity of total RNA. Changes in leptin and adiponectin mRNA expression were quantitated by use of a real-time PCR assay. Total RNA (1 μg) was reverse transcribed into cDNA by use of reverse transcriptaseo and a random primer.p An aliquot (1 μL) of cDNA was used for the PCR assay, which was performed with standard conditions27,28 (denaturation at 95°C for 30 seconds, annealing at 55°C for 30 seconds, and extension at 72°C for 1 minute). Primer sequences for leptin (GenBank accession No. NM_001003070.1; forward, GCCCTATCTGTCCTGTGTTG; and reverse, AGACTGCGTGTGTGAAATGT) and adiponectin (GenBank accession No. NM_001006644.1; forward, AGAGAAAGGAGATGCAGGTCT; and reverse, CTCCAACCCCACACTGAATG) were used. Aliquots (10 μL/aliquot) of the PCR assay product were separated on 2% agarose gels and stained with ethidium bromide. Gel images were analyzed by use of a software packageq designed to record and analyze 1-D electrophoresis gels.
Statistical analysis
Statistical analyses were performed with commercially available statistical software.r The Friedman test and Dunn post hoc test were used to compare changes in serum leptin and adiponectin concentrations before and during hydrocortisone administration. Differences between the hydrocortisone and control groups were analyzed by use of the Mann-Whitney U test. Correlations between serum leptin concentrations and body fat mass were evaluated with the Spearman correlation test. Values were considered significant at P < 0.05.
Results
Long-term administration of hydrocortisone resulted in the development of clinical signs consistent with hypercortisolemia, including polyuria, polydipsia, polyphagia, no regrowth of hair within 1 month after the area was shaved for surgery, and thinning of the skin with prominent subcutaneous veins in the abdomen, in all dogs of the hydrocortisone group. Abnormalities of laboratory analyses, including a stress leukogram, high alkaline phosphatase activity, and isosthenuria, were also consistent with cortisol excess in all dogs of the hydrocortisone group. Some dogs of the hydrocortisone group also developed abdominal distention (n = 5) and muscle atrophy (2). However, all dogs of both groups remained bright, alert, and afebrile during the entire study period. All dogs were in good health throughout the study, as determined on the basis of no abnormalities for physical examination findings and results of laboratory analyses.
Changes were detected in serum leptin and adiponectin concentrations (Figure 1). Serum leptin concentrations increased significantly (P < 0.001) from baseline and peaked on day 60. Compared with the leptin concentration on day 0, the concentration was significantly higher on days 30 (P = 0.016) and 60 (P < 0.001) for dogs of the hydrocortisone group. It also differed significantly (P = 0.002) between treatment groups on days 1, 3, 7, 30, 60, and 90. The serum adiponectin concentration was significantly lower on days 30 (P = 0.018), 60 (P = 0.002), and 90 (P < 0.001) than at baseline, and it was lowest on day 90 for the hydrocortisone group. It also differed significantly between treatment groups on days 3 (P = 0.004), 7 (P = 0.004), 30 (P = 0.002), 60 (P = 0.002), and 90 (P = 0.002). Additionally, the ratio of the adiponectin concentration to the leptin concentration for the hydrocortisone group was significantly lower on days 60 (P < 0.001) and 90 (P = 0.005), compared with the ratio on day 0. The ratio also differed significantly (P = 0.002) between treatment groups on days 1, 3, 7, 30, 60, and 90.
Median (interquartile [25th to 75th percentile] range) values for serum concentrations of leptin (A) and adiponectin (B) and the ratio of adiponectin concentration to leptin concentration (C) of dogs before (day 0) and during (days 1, 3, 7, 30, 60, and 90) hydrocortisone administration (8.5 mg/kg, PO, q 12 h; black bars; n = 6) or administration of a placebo to a control group (gray bars; 6). *Within a day, value differs significantly (P < 0.05) from the value for the control group. °Within the hydrocortisone group, value differs significantly (P < 0.05) from the value at day 0.
Citation: American Journal of Veterinary Research 80, 8; 10.2460/ajvr.80.8.771
Median (interquartile [25th to 75th percentile] range) values for serum concentrations of leptin (A) and adiponectin (B) and the ratio of adiponectin concentration to leptin concentration (C) of dogs before (day 0) and during (days 1, 3, 7, 30, 60, and 90) hydrocortisone administration (8.5 mg/kg, PO, q 12 h; black bars; n = 6) or administration of a placebo to a control group (gray bars; 6). *Within a day, value differs significantly (P < 0.05) from the value for the control group. °Within the hydrocortisone group, value differs significantly (P < 0.05) from the value at day 0.
Citation: American Journal of Veterinary Research 80, 8; 10.2460/ajvr.80.8.771
Median (interquartile [25th to 75th percentile] range) values for serum concentrations of leptin (A) and adiponectin (B) and the ratio of adiponectin concentration to leptin concentration (C) of dogs before (day 0) and during (days 1, 3, 7, 30, 60, and 90) hydrocortisone administration (8.5 mg/kg, PO, q 12 h; black bars; n = 6) or administration of a placebo to a control group (gray bars; 6). *Within a day, value differs significantly (P < 0.05) from the value for the control group. °Within the hydrocortisone group, value differs significantly (P < 0.05) from the value at day 0.
Citation: American Journal of Veterinary Research 80, 8; 10.2460/ajvr.80.8.771
Leptin mRNA expression for the hydrocortisone group was significantly (P = 0.010) greater on day 30, compared with the expression at baseline (Figure 2). However, leptin mRNA expression for the hydrocortisone group began to decrease on day 60 and was further decreased on day 90, compared with the expression on day 30. Leptin mRNA expression differed significantly (P = 0.002) between treatment groups on day 30. Adiponectin mRNA expression for the hydrocortisone group was significantly (P = 0.042) greater on day 30 than on day 0. Adiponectin mRNA expression then progressively decreased on days 60 and 90, compared with the expression on day 30. It was significantly (P = 0.002) greater for the hydrocortisone group than the control group on day 30.
Median (interquartile range) values of leptin (A) and adiponectin (B) mRNA expression in dogs before and during administration of hydrocortisone (black bars; n = 6) or a placebo (gray bars; 6) for 90 days. Notice that the scale on the y-axis differs between panels. See Figure 1 for remainder of key.
Citation: American Journal of Veterinary Research 80, 8; 10.2460/ajvr.80.8.771
Median (interquartile range) values of leptin (A) and adiponectin (B) mRNA expression in dogs before and during administration of hydrocortisone (black bars; n = 6) or a placebo (gray bars; 6) for 90 days. Notice that the scale on the y-axis differs between panels. See Figure 1 for remainder of key.
Citation: American Journal of Veterinary Research 80, 8; 10.2460/ajvr.80.8.771
Median (interquartile range) values of leptin (A) and adiponectin (B) mRNA expression in dogs before and during administration of hydrocortisone (black bars; n = 6) or a placebo (gray bars; 6) for 90 days. Notice that the scale on the y-axis differs between panels. See Figure 1 for remainder of key.
Citation: American Journal of Veterinary Research 80, 8; 10.2460/ajvr.80.8.771
Body weight was similar to that at baseline for all dogs receiving hydrocortisone. The CT images obtained at the level of L3 before and during administration of hydrocortisone were evaluated (Figure 3).
Representative transverse CT images of a dog obtained at the level of L3 before (day 0) and during (days 30, 60, and 90) hydrocortisone administration (top row). For the same transverse CT images, pixels with an attenuation range of −135 to −105 HU are depicted as dark gray (bottom row).
Citation: American Journal of Veterinary Research 80, 8; 10.2460/ajvr.80.8.771
Representative transverse CT images of a dog obtained at the level of L3 before (day 0) and during (days 30, 60, and 90) hydrocortisone administration (top row). For the same transverse CT images, pixels with an attenuation range of −135 to −105 HU are depicted as dark gray (bottom row).
Citation: American Journal of Veterinary Research 80, 8; 10.2460/ajvr.80.8.771
Representative transverse CT images of a dog obtained at the level of L3 before (day 0) and during (days 30, 60, and 90) hydrocortisone administration (top row). For the same transverse CT images, pixels with an attenuation range of −135 to −105 HU are depicted as dark gray (bottom row).
Citation: American Journal of Veterinary Research 80, 8; 10.2460/ajvr.80.8.771
Total, visceral, and subcutaneous fat mass on days 0, 30, 60, and 90 were determined (Figure 4). Total fat mass of dogs in the hydrocortisone group was significantly (P = 0.002) greater on day 90, but not on days 30 or 60, compared with the total fat mass at baseline. Total fat mass differed significantly (P = 0.041) between treatment groups on day 90. Subcutaneous fat mass did not differ significantly over time within the hydrocortisone group or between treatment groups. However, visceral fat mass of dogs in the hydrocortisone group was significantly greater on days 60 (P = 0.022) and 90 (P < 0.001), compared with the visceral fat mass at baseline, and peaked on day 90. It also differed significantly (P = 0.002) between treatment groups on days 60 and 90.
Median (interquartile [25th to 75th percentile] range) values of the total (A), visceral (B), and subcutaneous (C) fat mass in the abdomen of dogs before and during (days 30, 60, and 90) administration of hydrocortisone (black bars; n = 6) or a placebo (gray bars; 6). Notice that the scale on the y-axis differs among panels. See Figure 1 for remainder of key.
Citation: American Journal of Veterinary Research 80, 8; 10.2460/ajvr.80.8.771
Median (interquartile [25th to 75th percentile] range) values of the total (A), visceral (B), and subcutaneous (C) fat mass in the abdomen of dogs before and during (days 30, 60, and 90) administration of hydrocortisone (black bars; n = 6) or a placebo (gray bars; 6). Notice that the scale on the y-axis differs among panels. See Figure 1 for remainder of key.
Citation: American Journal of Veterinary Research 80, 8; 10.2460/ajvr.80.8.771
Median (interquartile [25th to 75th percentile] range) values of the total (A), visceral (B), and subcutaneous (C) fat mass in the abdomen of dogs before and during (days 30, 60, and 90) administration of hydrocortisone (black bars; n = 6) or a placebo (gray bars; 6). Notice that the scale on the y-axis differs among panels. See Figure 1 for remainder of key.
Citation: American Journal of Veterinary Research 80, 8; 10.2460/ajvr.80.8.771
Total, visceral, and subcutaneous fat mass, percentage of visceral fat, and visceral fat-to-subcutaneous fat ratio for the dogs before and during administration of hydrocortisone were calculated (Table 1). There were significant increases in the visceral fat mass, percentage of visceral fat, and visceral fat-to-subcutaneous fat ratio during hydrocortisone administration. Total fat mass for the hydrocortisone group was significantly greater on day 90, compared with the values at baseline (P = 0.044) and on day 30 (P = 0.022). It was significantly (P = 0.041) greater for the hydrocortisone group than the control group on day 90.
Body weight and fat distribution in the abdomen of dogs before (day 0) and during (days 30, 60, and 90) administration of hydrocortisone (8.5 mg/kg, PO, q 12 h; n = 6) or a placebo (6).
| Day 0 | Day 30 | Day 60 | Day 90 | |||||
|---|---|---|---|---|---|---|---|---|
| Variable | Hydrocortisone | Control | Hydrocortisone | Control | Hydrocortisone | Control | Hydrocortisone | Control |
| Body weight (kg) | 11.35 (10.58–12.21) | 10.67 (10.38–10.82) | 10.58 (10.08–10.99) | 10.53 (10.39–10.72) | 11.09 (10.24–11.80) | 10.61 (10.33–10.71) | 11.22 (10.37–11.95) | 10.38 (10.19–10.74) |
| Total fat mass (cm3) | 18.17 (12.09–26.04) | 17.81 (15.15–21.79) | 18.32 (13.52–25.91) | 13.85 (12.65–21.24) | 20.52 (13.87–33.93) | 15.94 (10.47–18.94) | 26.22*†‡ (16.43–42.55) | 15.29 (12.09–20.92) |
| Visceral fat mass (cm3) | 5.73 (3.56–7.06) | 5.83 (5.00–6.38) | 9.64* (8.76–13.02) | 4.73 (3.79–5.76) | 11.30*† (8.89–18.31) | 4.81 (3.44–6.02) | 15.35*† (10.47–22.71) | 4.96 (3.74–5.95) |
| Visceral fat (%) | 30.85 (23.19–40.21) | 31.59 (23.60–38.50) | 53.90* (48.84–60.74) | 31.37 (20.44–40.50) | 57.04*† (51.16–61.97) | 36.38 (18.21–45.03) | 59.51*† (55.85–63.28) | 27.44 (22.96–49.27) |
| Subcutaneous fat mass (cm3) | 13.74 (7.29–18.31) | 13.02 (9.35–15.95) | 8.70 (4.93–12.89) | 9.81 (7.59–16.31) | 9.22 (5.29–15.62) | 10.14 (5.77–15.49) | 10.87 (5.96–17.50) | 11.30 (6.15–15.72) |
| V:S | 0.45 (0.30–0.68) | 0.47 (0.31–0.63) | 1.17* (0.96–1.57) | 0.47 (0.26–0.68) | 1.33*† (1.05–1.66) | 0.57 (0.22–0.86) | 1.47*† (1.29–1.73) | 0.38 (0.30–0.98) |
Values reported are median (interquartile [25th to 75th percentile]) range.
Within a day, value differs significantly (P < 0.05) from the value for the control group.
Within the hydrocortisone group, value differs significantly (P < 0.05) from the value for day 0.
Within the hydrocortisone group, value differs significantly (P < 0.05) from the value for day 30.
V:S = Ratio of visceral fat mass to subcutaneous fat mass.
No significant differences in subcutaneous fat mass were detected on days 30, 60, and 90, compared with the mass at baseline. However, visceral fat mass for the hydrocortisone group was significantly greater on days 60 (P = 0.042) and 90 (P < 0.001) than at baseline. It differed significantly (P = 0.002) between treatment groups on days 30, 60, and 90. The percentage of visceral fat for the hydrocortisone group was significantly higher on days 60 (P = 0.005) and 90 (P = 0.002) than at baseline. It was significantly higher for the hydrocortisone group than the control group on days 30 (P = 0.002), 60 (P = 0.015), and 90 (P = 0.004). In addition, the visceral fat-to-subcutaneous fat ratio for the hydrocortisone group was also significantly higher on days 60 (P = 0.005) and 90 (P = 0.002) than at baseline. It differed significantly between treatment groups on days 30 (P = 0.002), 60 (P = 0.015), and 90 (P = 0.004).
Correlations between visceral fat mass and serum adipokine concentrations were determined (Figure 5). There was a significant positive correlation (r = 0.710; P < 0.001) between visceral fat mass and the leptin concentration. In contrast, visceral fat mass was not significantly correlated (r = −0.397; P = 0.055) with the adiponectin concentration.
Correlation curves between visceral fat mass and serum leptin (A) or adiponectin (B) concentrations for 6 dogs receiving hydrocortisone for 90 days. The line of best ft (solid line) and 95% confidence interval (dotted lines) are indicated.
Citation: American Journal of Veterinary Research 80, 8; 10.2460/ajvr.80.8.771
Correlation curves between visceral fat mass and serum leptin (A) or adiponectin (B) concentrations for 6 dogs receiving hydrocortisone for 90 days. The line of best ft (solid line) and 95% confidence interval (dotted lines) are indicated.
Citation: American Journal of Veterinary Research 80, 8; 10.2460/ajvr.80.8.771
Correlation curves between visceral fat mass and serum leptin (A) or adiponectin (B) concentrations for 6 dogs receiving hydrocortisone for 90 days. The line of best ft (solid line) and 95% confidence interval (dotted lines) are indicated.
Citation: American Journal of Veterinary Research 80, 8; 10.2460/ajvr.80.8.771
Discussion
Analysis of results of the present study indicated that administration of hydrocortisone at a dosage of 8.5 mg/kg, PO, every 12 hours for 90 days increased serum leptin concentrations and decreased serum adiponectin concentrations. Additionally, mRNA expression of leptin and adiponectin in visceral fat was greater on day 30, compared with expression at baseline. Fat distribution changed with an increase in visceral fat mass. To our knowledge, the study reported here was the first in which fat distribution of dogs was quantified after hydrocortisone administration and the first in which a correlation was identified between serum leptin concentration and visceral fat mass in dogs with hypercortisolemia.
In the present study, serum leptin concentration significantly increased with hydrocortisone administration. In particular, the leptin concentration increased over time in the hydrocortisone group and was higher after the first day of hydrocortisone administration, compared with the concentration in the control group. These results strongly suggested that cortisol was involved in the regulation of leptin secretion in vivo. In a previous study19 conducted by our research group, the serum leptin concentrations were significantly higher in dogs with hyperadrenocorticism, and there was a linear association for the leptin concentration in dogs with hyperadrenocorticism. Additionally, injection of dexamethasone in dogs increased plasma leptin concentrations in another study.29 These findings indicate that cortisol increases leptin secretion in dogs, suggesting that cortisol may have direct effects on leptin secretion.
In rodents, glucocorticoids increase leptin expression in vivo and in vitro.30–32 Acute administration of glucocorticoids in humans increases leptin concentrations,33 and glucocorticoids increase leptin secretion and expression of the ob gene in cultured human adipose tissue.3 These results suggest that glucocorticoids act directly on adipose tissue and increase leptin synthesis and secretion in humans. In another study29 of dogs, induction of hypercortisolemia increased leptin mRNA expression in subcutaneous adipose tissues and increased plasma leptin concentrations, although the method for induction of hypercortisolemia differed from that of the study reported here. In the present study, leptin expression for the hydrocortisone group was greater on day 30, compared with the expression at baseline and the expression for the control group. Therefore, the parallel increase in serum leptin concentrations and leptin mRNA expression in visceral adipose tissue after administration of hydrocortisone suggested that the effects of glucocorticoids on leptin secretion were mediated by mRNA expression. However, we did not determine the leptin mRNA expression on day 1, and this was an important limitation of the study. Thus, it will be necessary to determine the effects of glucocorticoids on leptin expression in cultured canine adipose tissues.
Leptin concentrations in humans with hyperadrenocorticism reportedly are similar34,35 or elevated,36 compared with concentrations for body mass index–matched control subjects. In 1 study,37 leptin concentrations were correlated with the amount of total adipose tissue and subcutaneous adipose tissue in women with hyperadrenocorticism; however, leptin concentrations were not correlated with the amount of visceral adipose tissue. In another study19 conducted by our research group, serum leptin concentrations in dogs with hyperadrenocorticism were significantly higher than concentrations in similarly overweight dogs with physiologically normal adrenal glands. Additionally, the leptin concentrations in dogs with hyperadrenocorticism after trilostane treatment in that study19 were higher than those in healthy dogs, which suggests that increases in the visceral fat mass lead to excessive hyperleptinemia in dogs. Thus, quantitative evaluation of the visceral fat mass would have helped to clarify whether hyperleptinemia in dogs with hyperadrenocorticism is related to visceral obesity. In the present study, a correlation was detected between serum leptin concentration and the visceral fat mass in dogs receiving hydrocortisone. These findings suggested that an increase in the abdominal visceral fat mass elevated the serum leptin concentration in dogs.
In the present study, serum adiponectin concentrations of dogs decreased significantly during administration of hydrocortisone for 90 days. However, another study19 conducted by our research group found that serum adiponectin concentrations did not differ significantly between dogs with hyperadrenocorticism and healthy dogs. Although the effects of glucocorticoids on adiponectin expression of humans have been studied, no consensus has been reached.38 It has been suggested17,39 that adiponectin expression might not be inversely related to adiposity in obese dogs and that differences in adiponectin physiology between dogs and humans might be expected. In rats, glucocorticoids decrease serum adiponectin concentrations and adiponectin mRNA expression in white adipose tissue.40 The authors of that study40 proposed that the decrease in serum adiponectin concentration was attributable to inhibited adiponectin mRNA expression. Dexamethasone treatment of dogs did not cause changes in adiponectin expression of canine adipocytes.41 In contrast to results of an in vitro study,41 adiponectin mRNA expression in abdominal visceral fat for the dogs of the present study was significantly greater on day 30. The reason for this discrepancy is unknown, but it is possible that adiponectin mRNA expression is altered under different conditions.17 Thus, additional studies will be necessary to clarify the effects of obesity on relationships between serum adiponectin concentrations and cortisol concentrations in dogs and the relationships of these hormones between obese and nonobese dogs.
The amount of abdominal visceral fat was greater after administration of hydrocortisone in the present study. Currently, CT is the criterion-referenced standard technique for confirmation of visceral obesity, which is characterized as increased amounts of adipose tissue surrounding the intra-abdominal organs,42 in humans and dogs.24,42 Hypercortisolemia is associated with visceral obesity in humans and dogs. Some studies11,37 have revealed that fat distribution changes in humans with hyperadrenocorticism, compared with results for control subjects. However, visceral obesity in dogs with hyperadrenocorticism has not been evaluated. Total fat mass differed significantly on day 90, compared with the mass on day 0. Visceral fat mass increased sequentially, whereas subcutaneous fat mass did not differ significantly during hydrocortisone administration. Therefore, the lack of a significant difference in the subcutaneous fat mass suggested that the increase in total fat mass associated with hydrocortisone administration was caused by an increase in the visceral fat mass.
In addition, single-slice images were evaluated to quantify multicompartmental fat distribution between the subcutaneous and visceral compartments in the abdomen. Results indicated a significant increase in the proportion of visceral fat after administration of hydrocortisone, compared with the proportion before administration. Therefore, fat redistribution appeared to be associated with visceral obesity in dogs receiving hydrocortisone.
The present study had several limitations. First, the leptin concentrations could have been influenced by a stress reaction (eg, reaction to drug administration, collection of blood samples, insertion of the catheter in a jugular vein, and pain caused by biopsy). Evaluations of site-related differences in leptin expression of canine adipocytes have not been reported. Therefore, additional studies will be necessary to identify mRNA expression of leptin and adiponectin in the subcutaneous and visceral adipose tissues of dogs.
In the present study, serum leptin and adiponectin concentrations in dogs administered hydrocortisone might have been affected directly by hypercortisolemia and dysregulation of mRNA expression of leptin and adiponectin in visceral adipose tissues. Additionally, analysis of the results suggested that serum leptin concentrations might have been related to visceral obesity. Additional studies will be necessary to clarify the role of leptin in the pathogenesis of complications related to chronic hypercortisolemia.
Acknowledgments
Supported by the Basic Science Research Program through the National Research Foundation of Korea (NRF) funded by the Ministry of Science, ICT and Future Planning (NRF2016R1A1A1A05005395).
The authors declare that there were no conflicts of interest.
Presented in part as an abstract at the American College of Veterinary Internal Medicine Forum, Denver, June 2016.
Footnotes
Natural Balance, Natural Balance Pet Foods Inc, Los Angeles, Calif.
Microsoft Excel, version 2013, Microsoft Co, Redmond, Wash.
Inist Biopharma Co, Kyunggi, Republic of Korea.
Provive 1%, Myungmoon Pharmaceutical Co, Seoul, Repubic of Korea.
Terrell, Piramal Critical Care Inc, Bethlehem, Pa.
Hi Speed CT/e, GE Medical Systems Inc, Chicago, Ill.
Yuhan, Seoul, Republic of Korea.
Gaster injectable, Dong-A ST, Seoul, Republic of Korea.
Butophan, Myungmoon Pharmaceutical Co, Seoul, Republic of Korea.
Daihan Pharmaceutical Co, Seoul, Republic of Korea.
TriZol reagent, Life Technologies Co, Carlsbad, Calif.
Hitachi 7020, Hitachi High-Technologies Corp, Tokyo, Japan.
Canine leptin ELISA kit, Millipore Co, Billerica, Mass.
Canine adiponectin ELISA kit, Millipore Co, Billerica, Mass.
M-MLV reverse transcriptase, Invitrogen, Carlsbad, Calif.
9-mer, Takara Bio Inc, Shiga, Japan.
Gel Doc EQ, Bio-Rad Laboratories Inc, Hercules, Calif.
GraphPad Prism, version 6, GraphPad Software Inc, La Jolla, Calif.
References
1. Radin MJ, Sharkey LC, Holycross BJ. Adipokines: a review of biological and analytical principles and an update in dogs, cats, and horses. Vet Clin Pathol 2009;38:136–156.
2. Caro JF, Sinha MK, Kolaczynski JW, et al. Leptin: the tale of an obesity gene. Diabetes 1996;45:1455–1462.
3. Masuzaki H, Ogawa Y, Hosoda K, et al. Glucocorticoid regulation of leptin in Cushing's syndrome. J Clin Endocrinol Metab 1997;82:2542–2547.
4. Arnaldi G, Angeli A, Atkinson AB, et al. Diagnosis and complications of Cushing's syndrome: a consensus statement. J Clin Endocrinol Metab 2003;88:5593–5602.
5. Andrews RC, Walker BR. Glucocorticoids and insulin resistance; old hormones, new targets. Clin Sci (Lond) 1999;96:513–523.
6. Arnaldi G, Scandali VM, Trementino L, et al. Pathophysiology of dyslipidemia in Cushing's syndrome. Neuroendocrinology 2010;92(suppl 1):86–90.
7. Vegiopoulos A, Herzig S. Glucocorticoids, metabolism and metabolic diseases. Mol Cell Endocrinol 2007;275:43–61.
8. Chanson P, Salenave S. Metabolic syndrome in Cushing's syndrome. Neuroendocrinology 2010;92(suppl 1):96–101.
9. Ferraù F, Korbonits M. Metabolic comorbidities in Cushing's syndrome. Eur J Endocrinol 2015;173:M133–M157.
10. Mayo-Smith W, Hayes CW, Biller BM, et al. Body fat distribution measured with CT: correlations in healthy subjects, patients with anorexia nervosa, and patients with Cushing syndrome. Radiology 1989;170:515–518.
11. Rockall AG, Sohaib SA, Evans D, et al. Computed tomography assessment of fat distribution in male and female patients with Cushing's syndrome. Eur J Endocrinol 2003;149:561–567.
12. Vega GL, Grundy SM. Metabolic risk susceptibility in men is partially related to adiponectin/leptin ratio. J Obes 2013;2013:409679.
13. Hotta K, Funahashi T, Bodkin NL, et al. Circulating concentrations of the adipocyte protein adiponectin are decreased in parallel with reduced insulin sensitivity during the progression to type 2 diabetes in rhesus monkeys. Diabetes 2001;50:1126–1133.
14. Houseknecht KL, Portocarrero CP. Leptin and its receptors: regulators of whole-body energy homeostasis. Domest Anim Endocrinol 1998;15:457–475.
15. Hu E, Liang P, Spiegelman BM. AdipoQ is a novel adipose-specific gene dysregulated in obesity. J Biol Chem 1996;271:10697–10703.
16. Cano P, Cardinali DP, Ríos-Lugo MJ, et al. Effect of a high-fat diet on 24-hour pattern of circulating adipocytokines in rats. Obesity (Silver Spring) 2009;17:1866–1871.
17. Verkest KR, Rose FJ, Fleeman LM, et al. Adiposity and adiponectin in dogs: investigation of causes of discrepant results between two studies. Domest Anim Endocrinol 2011;41:35–41.
18. Fallo F, Scarda A, Sonino N, et al. Effect of glucocorticoids on adiponectin: a study in healthy subjects and in Cushing's syndrome. Eur J Endocrinol 2004;150:339–344.
19. Cho KD, Paek J, Kang JH, et al. Serum adipokine concentrations in dogs with naturally occurring pituitary-dependent hyperadrenocorticism. J Vet Intern Med 2014;28:429–436.
20. Lubkowska A, Radecka A, Bryczkowska I, et al. Serum adiponectin and leptin concentrations in relation to body fat distribution, hematological indices and lipid profile in humans. Int J Environ Res Public Health 2015;12:11528–11548.
21. National Research Council. Guide for the care and use of laboratory animals. National Academy Press: Washington, DC, 1996.
22. Kook PH, Schellenberg S, Grest P, et al. Microbiologic evaluation of gallbladder bile of healthy dogs and dogs with iatrogenic hypercortisolism: a pilot study. J Vet Intern Med 2010;24:224–228.
23. Kook PH, Schellenberg S, Rentsch KM, et al. Effects of iatrogenic hypercortisolism on gallbladder sludge formation and biochemical bile constituents in dogs. Vet J 2012;191:225–230.
24. Ishioka K, Okumura M, Sagawa M, et al. Computed tomographic assessment of body fat in Beagles. Vet Radiol Ultrasound 2005;46:49–53.
25. Nishii N, Takasu M, Ohba Y, et al. Effects of administration of glucocorticoids and feeding status on plasma leptin concentrations in dogs. Am J Vet Res 2006;67:266–270.
26. Tvarijonaviciute A. Martínez-Subiela, Ceron JJ. Validation of 2 commercially available enzyme-linked immunosorbent assays for adiponectin determination in canine serum samples. Can J Vet Res 2010;74:279–285.
27. Lee GS, Hong EJ, Gwak KS, et al. The essential oils of Chamaecyparis obtusa promote hair growth through the induction of vascular endothelial growth factor gene. Fitoterapia 2010;81:17–24.
28. Vo TT, An BS, Yang H, et al. Calbindin-D9k as a sensitive molecular biomarker for evaluating the synergistic impact of estrogenic chemicals on GH3 rat pituitary cells. Int J Mol Med 2012;30:1233–1240.
29. Ishioka K, Soliman MM, Honjoh T, et al. Dexamethasone increases serum leptin concentration in dogs. Vet J 2002;164:295–297.
30. De Vos P, Saladin R, Auwerx J, et al. Induction of ob gene expression by corticosteroids is accompanied by body weight loss and reduced food intake. J Biol Chem 1995;270:15958–15961.
31. Murakami T, Iida M, Shima K. Dexamethasone regulates obese expression in isolated rat adipocytes. Biochem Biophys Res Commun 1995;214:1260–1267.
32. Slieker LJ, Sloop KW, Surface PL, et al. Regulation of expression of ob mRNA and protein by glucocorticoids and cAMP. J Biol Chem 1996;271:5301–5304.
33. Newcomer JW, Selke G, Melson AK, et al. Dose-dependent cortisol-induced increases in plasma leptin concentration in healthy humans. Arch Gen Psychiatry 1998;55:995–1000.
34. Krsek M, Silha JV, Jezkova J, et al. Adipokine levels in Cushing's syndrome; elevated resistin levels in female patients with Cushing's syndrome. Clin Endocrinol (Oxf) 2004;60:350–357.
35. Widjaja A, Schürmeyer TH, Von zur Mühlen A, et al. Determinants of serum leptin levels in Cushing's syndrome. J Clin Endocrinol Metab 1998;83:600–603.
36. Veldman RG, Frölich M, Pincus SM, et al. Hyperleptinemia in women with Cushing's disease in driven by high-amplitude pulsatile, but orderly and eurhythmic, leptin secretion. Eur J Endocrinol 2001;144:21–27.
37. Geer EB, Shen W, Gallagher D, et al. MRI assessment of lean and adipose tissue distribution in female patients with Cushing's disease. Clin Endocrinol (Oxf) 2010;73:469–475.
38. Sukumaran S, Dubois DC, Jusko WJ, et al. Glucocorticoid effects on adiponectin expression. Vitam Horm 2012;90:163–186.
39. Verkest KR, Fleeman LM, Morton JM, et al. Compensation for obesity-induced insulin resistance in dogs: assessment of the effects of leptin, adiponectin, and glucagon-like peptide-1 using path analysis. Domest Anim Endocrinol 2011;41:24–34.
40. Shi JH, Du WH, Liu XY, et al. Glucocorticoids decrease serum adiponectin level and WAT adiponectin mRNA expression in rats. Steroids 2010;75:853–858.
41. Ryan VH, German AJ, Wood IS, et al. Adipokine expression and secretion by canine adipocytes: stimulation of inflammatory adipokine production by LPS and TNFα. Pflugers Arch 2010;460:603–616.
42. Shuster A, Patlas M, Pinthus JH, et al. The clinical importance of visceral adiposity: a critical review of methods for visceral adipose tissue analysis. Br J Radiol 2012;85:1–10.
