Streptococcus suis, a gram-positive coccus, is a major pathogen of pigs that causes various diseases such as septicemia, meningitis, and endocar-ditis,1 which result in marked economic losses for the swine industry. In addition, S suis is an emerging pathogen for humans because life-threatening or fatal S suis infections have been reported in people engaged in slaughtering pigs and working in the pork industry.2,3 However, S suis inhabits several sites (eg, nasal cavities, tonsils, and genital and digestive tracts) of pigs without causing disease.1 It sometimes exerts its pathogenic effects on the host. Certain serotypes of S suis (eg, serotypes 2, 1/2, 3, 7, 9, and 14) are frequently detected in diseased pigs in North and South America, Europe, and Asia. In particular, S suis serotype 2 is the most prevalent and highly virulent among all serotypes.1
Streptococcus suis may colonize pigs through vertical transmission during parturition4 or through horizontal transmission by aerosolization.1 Experimental exposure to airborne S suis causes infection.5 It is also possible that S suis can infect susceptible hosts through feces excreted by infected pigs, similar to the manner by which infection with the hepatitis E virus is spread among pigs through the fecal-oral route.6 Previous studies7–9 were conducted primarily to isolate S suis from the organs of healthy or diseased pigs. However, the main source of infection has yet to be elucidated.
Specially designed primers for PCR assays and loop-mediated isothermal amplification procedures have been used to detect S suis.10,11 These methods do not detect bacterial taxa that should be removed from the S suis classification. Such taxa include Streptococcus parasuis, Streptococcus orisratti, and Streptococcus ruminantium. Recently, S parasuis (formerly recognized as S suis serotypes 20, 22, and 26) was reclassified as a new species and isolated from healthy and diseased pigs.12 Streptococcus orisratti includes serotypes formerly classified as S suis serotypes 32 and 34.13 In addition, S suis serotype 33 was reclassified recently as S ruminantium.14 Among these closely related bacteria, the etiologic importance and colonization preference of S parasuis remain unknown, compared with the information known for S suis.12,15 Several qPCR assays have been used to detect specific pig-related bacteria such as enterobacteria, lactobacilli, Leptospira interrogans, and Bifidobacterium spp.16–18 These qPCR assays have been useful for monitoring microbial shifts and have been applied for the high-throughput detection of multiple bacterial species.19 Studies20–22 have provided descriptions of the design of qPCR assay primers for S suis, although the taxa that should be removed from the S suis classification are inevitably also detected by use of these qPCR assays.
The purpose of the study reported here was to create a novel qPCR assay to detect and quantify S suis in pigs and their living environment. A novel qPCR assay was designed to detect S suis but not bacterial taxa that formerly belonged to the S suis classification. Subsequently, the qPCR assay was used to compare the abundance of S suis between piglets and sows, among piglets of various growth stages, and among farms and to estimate the ratio of the number of S suis to the number of total bacteria. In addition, quantification of S suis serotype 2 or 1/2 and S parasuis was used to compare colonization preferences.
Materials and Methods
Sample
From August 2015 to June 2016, samples of saliva and feces and vaginal swab specimens (ie, body samples) were collected from sows and piglets on 4 farms in Japan (Figure 1). Swab specimens of the feed troughs and water dispensers (ie, environmental samples) at those 4 farms were also collected. Owner consent was provided for use of the animals and collection of samples. All experiments conformed to the Guidelines for Animal Experiments of the University of Tokyo and were approved by the Animal Research Committee of the University of Tokyo (No. P16-289).
Location of the 4 pig farms in Japan included in the study (A), and the description of the pigs and antimicrobials used at each farm (B). The map in panel A was publicly available from the Geospatial Information Authority of Japan. In panel B, the various growth stages of the piglets are indicated. Notice the time course for administration of antimicrobials (arrows). Gr = Growing piglets. PW = Postweaning piglets. Su = Suckling piglets.
Citation: American Journal of Veterinary Research 79, 9; 10.2460/ajvr.79.9.941
Location of the 4 pig farms in Japan included in the study (A), and the description of the pigs and antimicrobials used at each farm (B). The map in panel A was publicly available from the Geospatial Information Authority of Japan. In panel B, the various growth stages of the piglets are indicated. Notice the time course for administration of antimicrobials (arrows). Gr = Growing piglets. PW = Postweaning piglets. Su = Suckling piglets.
Citation: American Journal of Veterinary Research 79, 9; 10.2460/ajvr.79.9.941
Location of the 4 pig farms in Japan included in the study (A), and the description of the pigs and antimicrobials used at each farm (B). The map in panel A was publicly available from the Geospatial Information Authority of Japan. In panel B, the various growth stages of the piglets are indicated. Notice the time course for administration of antimicrobials (arrows). Gr = Growing piglets. PW = Postweaning piglets. Su = Suckling piglets.
Citation: American Journal of Veterinary Research 79, 9; 10.2460/ajvr.79.9.941
Piglets were categorized into 3 growth stages for the period from birth (day 0) to day 70: suckling piglets, postweaning piglets, and growing piglets (Figure 1). Ages of piglets in the various stages differed among the 4 farms. For example, 2 farms included a category of growing piglets, whereas the other 2 farms only had categories for suckling and postweaning piglets. Use of antimicrobials also differed among the 4 farms. Antimicrobials were not used for treating diseases but were added in the feed at all farms enrolled in the study, except for 1 farm (pigs at that farm did not receive any feed containing antimicrobials). All pigs appeared to be healthy; none of the animals had signs of disease.
Sample collection
Saliva samples were collected with handmade applicators. A piece of cotton was affixed with twine onto disposable wooden chopsticks, and the handmade applicators were sterilized in a pouch. Each handmade applicator was removed from the sterilization pouch immediately before sample collection. Investigators held onto the distal 5 cm of the end of the applicator opposite the cotton. The applicator was wiped on the inner surface of the oral cavity of a pig for 2 to 3 minutes to collect saliva. Three applicators were used for each pig.
A commercially available swaba was used for collecting swab samples from the vagina of pigs as well as feed troughs and water dispensers. Approximately 1 g of feces was collected from the rectum of each pig by use of a spoon.b All samples were immersed in a storage reagentc in conical tubes to prevent bacterial growth and degradation of DNA.23,24 Tubes were stored at −20°C until use.
Bacterial strains and culture conditions
Bacteria used in the study included 45 strains of S suis, 5 strains of S parasuis, 3 strains of S orisratti, 2 strains of S ruminantium, 2 strains of Escherichia coli, and 1 strain each of Streptococcus acidominimus, Streptococcus dysgalactiae subsp equisimilis, Streptococcus entericus, Streptococcus gallinaceus, Streptococcus minor, Streptococcus oralis, Streptococcus ovis, Streptococcus pluranimalium, Streptococcus plurextorum, Streptococcus porci, Streptococcus porcinus, Streptococcus pyogenes, Actinobacillus pleuropneumoniae, Bordatella bronchiseptica, Brachyspira hyodysenteriae, Erysipelothrix rhusiopathiae, Erysipelothrix tonsillarum, Haemophilus parasuis, Mycoplasma hyopnuemoniae, Mycoplasma hyorhinis, Mycoplasma hyosynoviae, Salmonella enterica subsp enterica serovar Choleraesuis, and Staphylococcus hyicus (Supplementary Table S1, available at http://avmajournals.avma.org/doi/suppl/10.2460/ajvr.79.9.941). All strains were part of our laboratory stock, purchased from culture collections, or provided by other researchers. Bacteria were cultured as described previously.11 Streptococcus suis strains were genotyped by use of a PCR assay for 16S rRNA genes of 35 serotypes25 and recN.10 This procedure was followed by serotyping with a co-agglutination test and a direct agglutination test with commercial antisera.26,d
Extraction of DNA
Frozen samples were thawed and centrifuged at 20,630 × g for 10 minutes at 4°C. The pellet in each tube was washed twice with sterile saline (0.85% NaCl) solution and then resuspended in 1 mL of the saline solution. An aliquot (800 μL) was centrifuged again; that pellet was resuspended in 350 μL of solution from a commercially available kite and used for the extraction of total DNA in accordance with the manufacturer's instructions, with a few modifications. Beads provided in the kit were not used. Instead, 400 μL of 0.5-mm-diameter zirconia beadsf and two 5-mm-diameter zirconia beadsf was used to crush bacterial cells. Bacteria were crushed with a homogenizerg at 3,200 rpm for 10 minutes. Total DNA was eluted in 100 μL of the elution buffer provided in the kite and stored at −20°C until use. The concentration of DNA was determined by use of a fluorometerh with reagents.i Quality of DNA was verified by measuring the ratio of the absorbances at 260 and 280 nm with a spectrophotometer.j Samples with a ratio of 1.8 to 2.0 were subsequently used for qPCR assays.
Genomic DNA from the bacterial strains used in the study was extracted by use of a previously described method27 for Streptococcus spp or a boiling method11 for other bacterial species. Concentration of the extracted genomic DNA was measured with a fluorometer.h
Primer design and PCR assay conditions
The qPCR assay for total bacteria (designated as the qPCRTB assay) and the qPCR assay for S suis serotype 2 or 1/2 (designated as the qPCR2J assay) have been described elsewhere,28,29 whereas primers and probes of 2 qPCR assays (a qPCR assay for S suis [designated as the qPCRSS assay] and a qPCR assay for S parasuis [designated as the qPCRSP assay]) were designed for the present study (Appendix). Nucleotide sequences of recN in the bacterial species used in the study were retrieved from the National Center for Biotechnology Information GenBank. These sequences were aligned by use of a commercially available software programk with the default parameters. Nucleotide sequences spanning 80 to 150 bp were searched for primers corresponding to the appropriate loci. Specificity of the designed primers was confirmed in silico by conducting a searchl of the nucleotide collection of the National Center for Biotechnology Information.
Probes were labeled with a fluorescent reporter dyem at the 5’ end, an internal quencher dyen in the middle, and a dark quencher dyeo at the 3’ end. Each qPCR assay was performed in a total volume of 20 μL, which contained 2 μL of DNA template, 0.4μM each primer (0.2μM each primer for the qPCRTB assay), 0.2μM probe, 1X reference dye,p and 1X qPCR assay buffer-enzyme mixture.q Melting temperatures were estimated with the calculator provided by open-source software.r The qPCR assay conditions were 1 minute at 95°C, which was followed by 40 cycles of 15 seconds at 95°C and 1 minute at 60°C. A thermal cyclers was used for amplification. Distilled watert was the template for the negative control sample. All reactions were performed in triplicate.
Evaluation of the specificity and sensitivity of qPCR assays
Specificity of the qPCRSS and qPCRSP assays was evaluated by use of 0.2 ng of the genomic DNA of the bacteria as the template. Sensitivity of the qPCRSS and qPCRSP assays was evaluated by use of 10-fold serial dilutions of genomic DNA of S suis P1/7 and S parasuis SUT-286T, respectively, as the template.
Estimation of bacterial cell numbers
Ten-fold serial dilutions of genomic DNA of the following bacterial strains were used for each qPCR assay: E coli ATCC 25922 for the qPCRTB assay, S suis P1/7 for the qPCRSS and qPCR2J assays, and S parasuis SUT-286T for the qPCRSP assay. For the standard curve, data obtained for the qPCR assays by use of the serial dilution templates were plotted against cell numbers, which were calculated from the DNA concentrations and the length (number of base pairs) of each genome, as described previously.30 Cell numbers of the target species were estimated from the standard curve. For the qPCRTB assay, cell numbers were estimated by use of E coli; therefore, we converted the number of E coli into the number of total bacteria as follows: number of total bacteria = number of E coli × 7/4.1858. The values 7 and 4.1858 represent the mean copy numbers of the 16S rRNA gene of E coli and total bacteria, respectively. The mean copy number for total bacteria was estimated from 1,690 publicly available complete bacterial genomes.31 Scatterplots were created by use of open-source softwareu and evaluated to determine the estimated cell number of S suis, S suis serotype 2 or 1/2, and S parasuis and their ratios to the number of total bacteria.
Results
Sample
Body samples were collected from 84 suckling piglets, postweaning piglets, growing piglets, and sows (Table 1). Saliva samples were collected from piglets and sows at all farms. Fecal samples were collected only from sows and only at 3 farms. Vaginal swab specimens were collected only from sows at 1 farm. Swab specimens were collected from feed troughs and water dispensers of growing piglets at 1 farm, postweaning piglets at 2 farms, and sows at 3 farms.
Results of a qPCR assay for Streptococcus suis (designated as the qPCRSS assay) for samples collected from pigs and the environment on 4 pig farms in Japan.
| Category | Sample | Growth stage | Farm 1 | Farm 2 | Farm 3 | Farm 4 |
|---|---|---|---|---|---|---|
| Body samples | Saliva | Suckling piglets | 9/9 | 9/9 | 5/5 | 15/15 |
| Postweaning piglets | 9/9 | 9/9 | NC | NC | ||
| Growing piglets | NC | 9/9 | NC | NC | ||
| Sows | 6/6 | 3/3 | 5/5 | 3/3 | ||
| Feces | Sows | 3/6 | 0/3 | 0/1 | NC | |
| Vaginal swab specimens | Sows | NC | NC | 3/6 | NC | |
| Environmental | Feed trough swab specimens | Postweaning piglets | 3/3 | 3/3 | NC | NC |
| samples | Growing piglets | NC | 3/3 | NC | NC | |
| Sows | 3/6 | 2/3 | 1/1 | NC | ||
| Water dispenser swab specimens | Postweaning piglets | 2/3 | 3/3 | NC | NC | |
| Growing piglets | NC | 3/3 | NC | NC | ||
| Sows | 3/6 | 0/3 | 1/1 | NC |
Values reported represent the number of samples with a positive result for the qPCRSS assay/number of samples collected.
NC = Not collected.
Specificity and sensitivity of the designed qPCR assays
Primers and probe of the qPCRSS assay had no or only 1 mismatch with S suis and had ≥ 4 mismatches with the other species (Supplementary Table S2, available at http://avmajournals.avma.org/doi/suppl/10.2460/ajvr.79.9.941; Supplementary Figure S1, available at http://avmajournals.avma.org/doi/suppl/10.2460/ajvr.79.9.941). However, primers and probe of qPCRSP had no mismatches with S parasuis and ≥ 8 mismatches with the other species (Supplementary Table S3; available at http://avmajournals.avma.org/doi/suppl/10.2460/ajvr.79.9.941). The qPCRSS and qPCRSP assays with the designed primers and probes amplified the desired regions of only the appropriate species (Supplementary Table S1). The detection limits of the qPCRSS and qPCRSP assays were 45 and 6.8 cells, respectively, in the 20-μL reaction.
Estimated bacterial cell numbers in samples
Body and environmental samples were evaluated by use of the qPCR assays. Bacterial cell numbers estimated by use of the qPCRTB assay were > 1 × 106 cells/reaction tube for all samples collected (Supplementary Figure S2, available at http://avmajournals.avma.org/doi/suppl/10.2460/ajvr.79.9.941). The qPCRSS assay yielded positive results for all saliva samples but negative results for some of the other samples (Table 1). The qPCRSP assay yielded negative results for some body and environmental samples. The qPCR2J assay yielded positive results for 3 saliva samples and 2 swab specimens of feed troughs from 2 farms where S suis infections were prevalent.
Cell numbers estimated by use of the qPCRTB assay were in the range of the log10 value of 3 (Supplementary Figure S2). There was no apparent difference in the range of cell numbers among farms as estimated by use of each qPCR assay. Cell numbers in saliva samples estimated by use of the qPCRSS assay apparently did not change with increasing age, whereas cell numbers in saliva samples estimated by use of the qPCRSP assay increased slightly with increasing age.
Ratios of numbers of S suis, S suis serotype 2 or 1/2, and S parasuis to the number of total bacteria
The exact amounts of samples could not be measured precisely; thus, it was difficult to directly compare cell numbers. However, the data were converted to ratios of the number of a specific bacterium (S suis, S suis serotype 2 or 1/2, and S parasuis) to the number of total bacteria (Figure 2). Most of the ratios were < 1% (reported as log10 values < 0). For many saliva samples, ratios of the number of S suis and S parasuis to the number of total bacteria were from 1% to 15%. For a few swab specimen samples of feed troughs, the ratio of the number of S parasuis to the number of total bacteria ranged from 2% to 5%. A ratio > 1% for the number of S suis serotype 2 or 1/2 to the number of total bacteria was recorded for only the saliva sample from 1 sow. The ratios of the number of S suis to the number of total bacteria in saliva samples appeared to increase with increasing age of pigs on all 4 farms, although the farms were geographically distant from each other and differed with regard to the use of antimicrobials. Similarly, ratios of the number of S parasuis to the number of total bacteria in saliva samples and feed trough swab specimens appeared to increase with increasing age of pigs. Ratios of the number of S suis to the number of total bacteria were lower on the farm where β-lactams were administered, compared with the ratios for the other 3 farms.
Ratio of the number of a specific bacterium to the number of total bacteria for samples of saliva (A) and feces (B) and vaginal swab specimens (C) collected from pigs on 4 farms and swab specimens of feed troughs (D) and water dispensers (E) collected on those same 4 farms. Results were determined by use of a qPCR assay for S suis (designated as the qPCRSS assay), a qPCR assay for S suis serotype 2 or 1/2 (designated as the qPCR2J assay), a qPCR assay for S parasuis (designated as the qPCRSP assay), and a qPCR assay for total bacteria (designated as the qPCRTB assay); ratios represent the log10 value for the number of a specific bacterium to the number of total bacteria. Each symbol indicates 1 value for samples obtained at a particular farm (farm 1, circle; farm 2, square; farm 3, triangle; and farm 4, diamond) and are plotted for piglets of various growth stages and sows. Numbers represent the number of samples that had negative results, which were defined as values below detection limits (not detected; ND) of the qPCR assays. See Figure 1 for remainder of key.
Citation: American Journal of Veterinary Research 79, 9; 10.2460/ajvr.79.9.941
Ratio of the number of a specific bacterium to the number of total bacteria for samples of saliva (A) and feces (B) and vaginal swab specimens (C) collected from pigs on 4 farms and swab specimens of feed troughs (D) and water dispensers (E) collected on those same 4 farms. Results were determined by use of a qPCR assay for S suis (designated as the qPCRSS assay), a qPCR assay for S suis serotype 2 or 1/2 (designated as the qPCR2J assay), a qPCR assay for S parasuis (designated as the qPCRSP assay), and a qPCR assay for total bacteria (designated as the qPCRTB assay); ratios represent the log10 value for the number of a specific bacterium to the number of total bacteria. Each symbol indicates 1 value for samples obtained at a particular farm (farm 1, circle; farm 2, square; farm 3, triangle; and farm 4, diamond) and are plotted for piglets of various growth stages and sows. Numbers represent the number of samples that had negative results, which were defined as values below detection limits (not detected; ND) of the qPCR assays. See Figure 1 for remainder of key.
Citation: American Journal of Veterinary Research 79, 9; 10.2460/ajvr.79.9.941
Ratio of the number of a specific bacterium to the number of total bacteria for samples of saliva (A) and feces (B) and vaginal swab specimens (C) collected from pigs on 4 farms and swab specimens of feed troughs (D) and water dispensers (E) collected on those same 4 farms. Results were determined by use of a qPCR assay for S suis (designated as the qPCRSS assay), a qPCR assay for S suis serotype 2 or 1/2 (designated as the qPCR2J assay), a qPCR assay for S parasuis (designated as the qPCRSP assay), and a qPCR assay for total bacteria (designated as the qPCRTB assay); ratios represent the log10 value for the number of a specific bacterium to the number of total bacteria. Each symbol indicates 1 value for samples obtained at a particular farm (farm 1, circle; farm 2, square; farm 3, triangle; and farm 4, diamond) and are plotted for piglets of various growth stages and sows. Numbers represent the number of samples that had negative results, which were defined as values below detection limits (not detected; ND) of the qPCR assays. See Figure 1 for remainder of key.
Citation: American Journal of Veterinary Research 79, 9; 10.2460/ajvr.79.9.941
Discussion
It is believed that S suis does not colonize all pigs.32 However, in the study reported here, S suis was detected in all saliva samples, and a ratio > 1% for the number of S suis to the number of total bacteria was detected for many of the saliva samples. However, a few of the remaining saliva samples had positive results when tested by use of the qPCRSS assay, and the ratio of the number of S suis to the number of total bacteria was low in these samples. These observations suggested that pig saliva may be an important reservoir of S suis on swine farms and may lead to infection among pigs. Previously proposed sources of infection (ie, respiratory secretions, vaginal secretions, and fecal contents1,4) may still be important. However, the possibility of spreading an infection from the saliva of sows to piglets is not negligible, as determined on the basis of the increase in the ratios of the number of S suis to the number of total bacteria with increasing age of pigs for the saliva samples. This finding indicated the importance of preventing piglets from contacting sow saliva, which thereby would prevent endemic S suis infection. In this manner, it may be possible to prevent infections of piglets. We can only speculate on the reservoir and source of S suis infection on the basis of results of the present study, although these results should be an initial step in finding the route of S suis transmission among pigs.
The ratio of the number of S suis to the number of total bacteria reached 5% to 10%, even for saliva samples of piglets. However, S suis serotype 2 or 1/2 was detected in only a few samples from farms where S suis infections were prevalent, and it was not detected in the remaining samples. Furthermore, ratios of the number of S suis in saliva samples were lower for 1 farm where β-lactams were administered than ratios for the other 3 farms. Statistical analysis could not be conducted because the number of samples was inappropriate and exact amounts of samples could not be measured. The β-lactams are effective against S suis,33–35 which would suggest that the amount of S suis in pig saliva can be managed by use of these drugs. On the basis of these observations and the aforementioned 100% prevalence of S suis in saliva samples, several procedures for sows with positive results for the qPCRSS assay may be effective for preventing the transmission of S suis infections from sows to piglets. Sows infected with prevalent serotypes of S suis (eg, serotype 2 in Japan) should be replaced with uninfected sows. A partition should be placed to separate a sow's head from the area where her piglets suckle. Antimicrobials such as β-lactams should be used prudently, with careful consideration for the emergence of antimicrobial-resistant bacteria. Administration of β-lactams in drinking water may be a strategy that can be used on pig farms to effectively reduce the amount of S suis in the oral cavity and prevent diseases attributable to S suis infection. However, β-lactams must be used in a prudent manner and under veterinary supervision to prevent S suis infections on farms, with careful consideration for the emergence of antimicrobial-resistant bacteria.
Most saliva samples contained S parasuis, although ratios of the number of S parasuis to the number of total bacteria were low in saliva samples of piglets. This finding indicated that S parasuis has a low ability to colonize pigs, compared with the ability of S suis to colonize pigs. Ratio of the number of S parasuis to the number of total bacteria was 1% to 2% in some feed trough and water dispenser swab specimens, whereas the ratio of the number of S suis to the number of total bacteria in these samples was < 1%. These observations indicated that the colonization preference of S suis on pig farms differed from the colonization preference of S parasuis and that S parasuis colonized the environment and may not have been involved as a cause of disease.
Results for the study reported here were obtained by use of qPCR assays (particularly by the modification of the DNA extraction method), rather than by use of culture-based detection methods.7–9,25,36 Use of a homogenizer with 2 types of zirconia beads can efficiently crush the cell walls of gram-positive bacteria,37 including S suis and S parasuis. In addition, we confirmed that inhibitory activity of PCR assays was not evident for all sample categories used in the study (data not shown). Therefore, the method we used had high sensitivity and specificity.
A qPCR assay can be used to detect DNA of dead and live bacteria; however, the method used in the present study quantitatively detected bacterial colonization, as determined in a previous study20 in which intact S suis represented up to 13% of the estimated amount for a qPCR assay. The method used in the present study was important for providing the ability to detect S suis in samples obtained from live pigs as an alternative to detecting it in organs of slaughtered pigs. Detection of S suis serotype 2 or 1/2 from piglets will enable farmers to replace infected piglets before they mature into sows. This may reduce labor and costs, compared with labor and costs for postmortem examination of sows, and may prevent colonization of S suis serotype 2 or 1/2 in sows and thus prevent transmission of infection via saliva on pig farms. The design or use of other PCR assay primers for other S suis serotypes (eg, serotypes 3, 7, 9, and 14)38–40 as well as use of the qPCR2J assay to test the saliva of pigs will enable clinicians to detect and monitor colonization of specific serotypes of S suis. Incorporation of these methods with use of the qPCRSS assay, which provided reliable results and detected background amounts of S suis colonization, may help in the successful control of S suis infections on pig farms. Therefore, we propose that health evaluations conducted with saliva samples obtained from live pigs will help reduce S suis infections and provide substantial benefits for pig farms.
Acknowledgments
Funded by the Japan Society for the Promotion of Science (KAKENHI grant Nos. 15H02651, 15J10486, 16H05188, 16K08015, 16K15037, and 17K19552), the Livestock Promotional Fund from the Japan Racing Association, and the Research Program on Emerging and Re-emerging Infectious Diseases from the Japan Agency for Medical Research and Development.
The authors declare that there were no conflicts of interest.
The authors thank Yoshikazu Adachi, Jose Francisco Fernández-Garayzábal, Shizuka Fukudome, Taisuke Horimoto, Kiyohito Katsuragi, Yoshiaki Kawamura, Ken Kikuchi, Naoya Kikuchi, Hideki Kobayashi, Masanao Matayoshi, Yoshiko Otani, Yoshihiro Shimoji, Tatsuhumi Takahashi, and Haruyoshi Tomita for providing bacterial strains and DNA samples; Wataru Fujii, Masatoshi Hori, Yoshiakira Kanai, Masamichi Kuroumaru, Junyou Li, Noboru Manabe, Kento Miura, and Kunihiko Naito for technical assistance; and Shinichi Dozaki and Ryoko Yamada for assistance with collection of samples.
ABBREVIATIONS
| qPCR | Quantitative PCR |
| recN | Recombination-repair protein-coding gene |
Footnotes
BD BBV CultureSwab EZ II, Becton Dickinson, Milano, Italy.
Fisherbrand disposable sterile spoons, Thermo Fisher Scientific, Waltham, Mass.
RNALater stabilizing solution, Thermo Fisher Scientific, Waltham, Mass.
Statens Serum Institut, Copenhagen, Denmark.
PowerBiofilm DNA isolation kit, Mo Bio Laboratories Inc, Carlsbad, Calif.
Toray Industries Inc, Tokyo, Japan.
Bead crusher μT-12, Taitec Corp, Saitama, Japan.
Quantus fluorometer, Promega Corp, Fitchburg, Wis.
QuantiFluor dsDNA system, Promega Corp, Fitchburg, Wis. j. NanoDrop 1000 spectrophotometer, Thermo Fisher Scientific, Waltham, Mass.
GENETYX, version 13.0.4, Genetyx Corp, Tokyo, Japan.
BLASTN, National Center for Biotechnology Information, Rockville, Md. Available at: blast.ncbi.nlm.nih.gov/. Accessed Feb 20, 2017.
FAM, Integrated DNA Technologies, Tokyo, Japan.
ZEN, Integrated DNA Technologies, Tokyo, Japan.
IBFQ, Integrated DNA Technologies, Tokyo, Japan.
ROX, Toyobo Co Ltd, Osaka, Japan.
THUNDERBIRD probe qPCR mix, Toyobo Co Ltd, Osaka, Japan.
Thermo Fisher Scientific, Waltham, Mass. Available at: www6.appliedbiosystems.com/support/techtools/calc/. Accessed Sep 20, 2017.
StepOnePlus real-time PCR system, Thermo Fisher Scientific, Waltham, Mass.
Water for molecular biology (RT-PCR tested), MilliporeSigma, Bedford, Mass.
R, version 3.1.1, R Foundation for Statistical Computing, Vienna, Austria.
References
1. Goyette-Desjardins G, Auger JP, Xu J, et al. Streptococcus suis, an important pig pathogen and emerging zoonotic agent-an update on the worldwide distribution based on serotyping and sequence typing. Emerg Microbes Infect 2014;3:e45.
2. Yu H, Jing H, Chen Z, et al. Human Streptococcus suis outbreak, Sichuan, China. Emerg Infect Dis 2006;12:914–920.
3. Taniyama D, Sakurai M, Sakai T, et al. Human case of bacteremia due to Streptococcus suis serotype 5 in Japan: the first report and literature review. IDCases 2016;6:36–38.
4. Amass SF, SanMiguel P, Clark LK. Demonstration of vertical transmission of Streptococcus suis in swine by genomic fingerprinting. J Clin Microbiol 1997;35:1595–1596.
5. Madsen LW, Nielsen B, Aalbæk B, et al. Experimental infection of conventional pigs with Streptococcus suis serotype 2 by aerosolic exposure. Acta Vet Scand 2001;42:303–306.
6. Kasorndorkbua C, Guenette DK, Huang FF, et al. Routes of transmission of swine hepatitis E virus in pigs. J Clin Microbiol 2004;42:5047–5052.
7. Morales B, Ruiz A, Lacouture S, et al. Clonal distribution of Streptococcus suis isolated from diseased pigs in the central region of Chile. Can J Vet Res 2015;79:343–346.
8. Thongkamkoon P, Kiatyingangsulee T, Gottschalk M. Serotypes of Streptococcus suis isolated from healthy pigs in Phayao Province, Thailand. BMC Res Notes 2017;10:53.
9. Martinez G, Harel J, Lacouture S, et al. Genetic diversity of Streptococcus suis serotypes 2 and 1/2 isolates recovered from carrier pigs in closed herds. Can J Vet Res 2002;66:240–248.
10. Ishida S, Tien le HT, Osawa R, et al. Development of an appropriate PCR system for the reclassification of Streptococcus suis. J Microbiol Methods 2014;107:66–70.
11. Arai S, Tohya M, Yamada R, et al. Development of loop-mediated isothermal amplification to detect Streptococcus suis and its application to retail pork meat in Japan. Int J Food Microbiol 2015;208:35–42.
12. Nomoto R, Maruyama F, Ishida S, et al. Reappraisal of the taxonomy of Streptococcus suis serotypes 20, 22 and 26: Streptococcus parasuis sp. nov. Int J Syst Evol Microbiol 2015;65:438–443.
13. Hill JE, Gottschalk M, Brousseau R, et al. Biochemical analysis, cpn60 and 16S rDNA sequence data indicate that Streptococcus suis serotypes 32 and 34, isolated from pigs, are Streptococcus orisratti. Vet Microbiol 2005;107:63–69.
14. Tohya M, Arai S, Tomida J, et al. Defining the taxonomic status of Streptococcus suis serotype 33: the proposal for Streptococcus ruminantium sp. nov. Int J Syst Evol Microbiol 2017;67:3660–3665.
15. Okura M, Osaki M, Nomoto R, et al. Current taxonomical situation of Streptococcus suis. Pathogens 2016;5:e45.
16. Castillo M, Martin-Orue SM, Manzanilla EG, et al. Quantification of total bacteria, enterobacteria and lactobacilli populations in pig digesta by real-time PCR. Vet Microbiol 2006;114:165–170.
17. Lourdault K, Aviat F, Picardeau M. Use of quantitative real-time PCR for studying the dissemination of Leptospira interrogans in the guinea pig infection model of leptospirosis. J Med Microbiol 2009;58:648–655.
18. Gómez-Doñate M, Balleste E, Muniesa M, et al. New molecular quantitative PCR assay for detection of host-specific Bifid-obacteriaceae suitable for microbial source tracking. Appl Environ Microbiol 2012;78:5788–5795.
19. Hermann-Bank ML, Skovgaard K, Stockmarr A, et al. The gut microbiotassay: a high-throughput qPCR approach combinable with next generation sequencing to study gut microbial diversity. BMC Genomics 2013;14:788.
20. Bonifait L, Veillette M, Letourneau V, et al. Detection of Streptococcus suis in bioaerosols of swine confinement buildings. Appl Environ Microbiol 2014;80:3296–3304.
21. Su Y, Yao W, Perez-Gutierrez ON, et al. Changes in abundance of Lactobacillus spp. and Streptococcus suis in the stomach, jejunum and ileum of piglets after weaning. FEMS Microbiol Ecol 2008;66:546–555.
22. Srinivasan V, McGee L, Njanpop-Lafourcade BM, et al. Species-specific real-time PCR assay for the detection of Streptococcus suis from clinical specimens. Diagn Microbiol Infect Dis 2016;85:131–132.
23. Mutter GL, Zahrieh D, Liu C, et al. Comparison of frozen and RNALater solid tissue storage methods for use in RNA expression microarrays. BMC Genomics 2004;5:88.
24. Franzosa EA, Morgan XC, Segata N, et al. Relating the meta-transcriptome and metagenome of the human gut. Proc Natl Acad Sci U S A 2014;111:E2329–E2338.
25. Marois C, Bougeard S, Gottschalk M, et al. Multiplex PCR assay for detection of Streptococcus suis species and serotypes 2 and 1/2 in tonsils of live and dead pigs. J Clin Microbiol 2004;42:3169–3175.
26. Higgins R, Gottschalk M. An update on Streptococcus suis identification. J Vet Diagn Invest 1990;2:249–252.
27. Mogollon JD, Pijoan C, Murtaugh MP, et al. Characterization of prototype and clinically defined strains of Streptococcus suis by genomic fingerprinting. J Clin Microbiol 1990;28:2462–2466.
28. Nadkarni MA, Martin EF, Jacques NA, et al. Determination of bacterial load by real-time PCR using a broad-range (universal) probe and primers set. Microbiology 2002;148:257–266.
29. Nga TV, Nghia HD, Tu le TP, et al. Real-time PCR for detection of Streptococcus suis serotype 2 in cerebrospinal fluid of human patients with meningitis. Diagn Microbiol Infect Dis 2011;70:461–467.
30. Ritalahti KM, Amos BK, Sung Y, et al. Quantitative PCR targeting 16S rRNA and reductive dehalogenase genes simultaneously monitors multiple Dehalococcoides strains. Appl Environ Microbiol 2006;72:2765–2774.
31. Vetrovsky T, Baldrian P. The variability of the 16S rRNA gene in bacterial genomes and its consequences for bacterial community analyses. PLoS One 2013;8:e57923.
32. Wertheim HF, Nghia HD, Taylor W, et al. Streptococcus suis: an emerging human pathogen. Clin Infect Dis 2009;48:617–625.
33. Tarradas MC, Arenas A, Maldonado A, et al. Susceptibility of Streptococcus suis to various antimicrobial agents. Zentralbl Veterinarmed B 1994;41:685–688.
34. Marie J, Morvan H, Berthelot-Herault F, et al. Antimicrobial susceptibility of Streptococcus suis isolated from swine in France and from humans in different countries between 1996 and 2000. J Antimicrob Chemother 2002;50:201–209.
35. Soares TC, Paes AC, Megid J, et al. Antimicrobial susceptibility of Streptococcus suis isolated from clinically healthy swine in Brazil. Can J Vet Res 2014;78:145–149.
36. Ngo TH, Tran TB, Tran TT, et al. Slaughterhouse pigs are a major reservoir of Streptococcus suis serotype 2 capable of causing human infection in southern Vietnam. PLoS One 2011;6:e17943.
37. Bahl MI, Bergstrom A, Licht TR. Freezing fecal samples prior to DNA extraction affects the Firmicutes to Bacteroidetes ratio determined by downstream quantitative PCR analysis. FEMS Microbiol Lett 2012;329:193–197.
38. Dekker N, Daemen I, Verstappen K, et al. Simultaneous quantification and differentiation of Streptococcus suis serotypes 2 and 9 by quantitative real-time PCR, evaluated in tonsillar and nasal samples of pigs. Pathogens 2016;5:e46.
39. Smith HE, Veenbergen V, Velde Jvd, et al. The cps genes of Streptococcus suis serotypes 1, 2, and 9: development of rapid serotype-specific PCR assays. J Clin Microbiol 1999;37:3146–3152.
40. Wang K, Sun X, Lu C. Development of rapid serotype-specific PCR assays for eight serotypes of Streptococcus suis. J Clin Microbiol 2012;50:3329–3334.
Appendix
Primers and probes used to detect bacteria in samples collected from pigs and the environment on 4 pig farms in Japan.
| qPCR assay* | Primer or probe | Nucleotide sequence (5′-3′) | Tm (°C) | Product size (bp) | Reference |
|---|---|---|---|---|---|
| qPCRSS | qPCRSS-F | CAGGCAATGATTTATCTGGAGATG | 60.6 | 95 | NR |
| qPCRSS-R | GCGTGATTGGCTGAGCTGACCT | 66.8 | — | — | |
| qPCRSS-P | (FR) GAAAGAAT (IQ) TGGTTGAACGAGC (DQ) | 57.4 | — | — | |
| qPCRSP | qPCRSP-F | CGGGAAATACTGTTTCTGATGAAG | 59.8 | 83 | NR |
| qPCRSP-R | TAATTGGTTGGCCAAGGAA | 57.4 | — | — | |
| qPCRSP-P | (FR) TGAAAATCA (IQ) CGTCAAGTTATTGG (DQ) | 57.7 | — | — | |
| qPCR2J | cps2J-F | GGTTACTTGCTACTTTTGATGGAAATT | 60.0 | 88 | 29 |
| cps2J-R | CGCACCTCTTTTATCTCTTCCAA | 60.5 | — | — | |
| cps2J-P | (FR) TCAAGAATC (IQ) TGAGCTGCAAAAGTGTCAAATTGA (DQ) | 70.8 | — | — | |
| qPCRTB | qPCRTB-F | TCCTACGGGAGGCAGCAGT | 61.7 | 467 | 28 |
| qPCRTB-R | GGACTACCAGGGTATCTAATCCTGTT | 59.9 | — | — | |
| qPCRTB-P | (FR) CGTATTAC (IQ) CGCGGCTGCTGGCAC (DQ) | 71.8 | — | — |
Represents a qPCR assay for Streptococcus suis (designated as the qPCRSS assay), a qPCR assay for S suis serotype 2 or 1/2 (designated as the qPCR2J assay), a qPCR assay for Streptococcus parasuis (designated as the qPCRSP assay), and a qPCR assay for total bacteria (designated as the qPCRTB assay).
cps = Capsular polysaccharide synthesis. DQ = Dark quencher.o F = Forward. FR = Fluorescent reporter.m IQ = Internal quencher.n NR = No reference; developed for the study reported here. P = Probe. R = Reverse. Tm = Melting temperature.
— = Not applicable.
