Abstract
OBJECTIVE To measure programmed cell death ligand-1 (PD-L1) mRNA expression in archived primary nodal diffuse large B-cell lymphoma (DLBCL) specimens of dogs and determine whether that expression was associated with progression-free survival time (PFST).
SAMPLE Archived tumoral lymph node specimens from 42 dogs with DLBCL and lymph node specimens from 10 healthy dogs (controls).
PROCEDURES Archived tumoral and control lymph node specimens underwent multiplex qPCR analysis with probes and primers against canine PD-L1 and glyceraldehyde 3-phosphate dehydrogenase (housekeeping gene) to determine PD-L1 mRNA expression. The 2−ΔΔCt method was used to calculate the fold change in PD-L1 expression in DLBCL specimens relative to that in control lymph nodes. Kaplan-Meier and Cox proportional hazard analyses were used to evaluate the association of various tumoral and clinical factors with PFST.
RESULTS The fold change in PD-L1 mRNA expression in DLBCL specimens relative to control specimens ranged from 0.21 to 7.44. Twenty-one of 42 (50%) DLBCL specimens had a PD-L1-fold change > 1, which suggested PD-L1 was overexpressed in those specimens. Median PFST was 249 days for dogs with DLBCL. The PFST was not associated with PD-L1 mRNA expression but was associated with thrombocytopenia at the time of diagnosis (hazard ratio, 2.56; 95% confidence interval, 1.28 to 5.15).
CONCLUSIONS AND CLINICAL RELEVANCE Results indicated that tumoral PD-L1 mRNA expression varied among dogs with DLBCL and that PD-L1 MRNA was overexpressed in half the study population. Therefore, anti–PD-L1 therapies may be clinically beneficial for some dogs with DLBCL.
Diffuse large B-cell lymphoma is one of the most common cancers in dogs. Current standard of care for dogs with lymphoma includes doxorubicin-based chemotherapy protocols, which result in clinical remission rates of up to 90%. However, relapses are common, and reported mean remission duration ranges from 8 to 12 months.1–6 Therefore, novel therapies are necessary to improve remission duration for dogs with lymphoma.
Immune checkpoint inhibitors have emerged as promising novel treatments for human patients with DLBCL and other cancers. A therapeutic target of particular interest in checkpoint inhibitor therapy is the interaction of PD-1 with PD-L1. Programmed cell death protein-1 is a T-cell surface protein that is part of the B7 receptor family. Its interaction with PD-L1 has an important role in attenuating effector T-cell responses to protect against autoimmune disease. Programmed cell death ligand-1 is overexpressed in many types of cancer and leads to T-cell exhaustion and tumoral immune evasion.7,8 Specifically, in human medicine, overexpression of PD-L1 has been described in patients with melanoma,9 non–small cell lung cancer,10 breast cancer,11 bladder cancer,12 renal carcinoma,13 hepatocellular carcinoma,14 esophageal cancer,15 gastric cancer,16 pancreatic cancer,17 and lymphoma.18 For patients with those types of cancers, including DLBCL, overexpression of PD-L1 is associated with a poor clinical outcome.18 However, the recent development and use of anti–PD-L1 therapies have resulted in clinical responses and improved survival times for human patients with cancer, including those who have previously received multiple treatments and those with advanced disease.19–21
For dogs with DLBCL, tumor expression of PD-L1must be documented before it can be rationally targeted by anti–PD-L1 therapy. Currently, information regarding PD-L1 expression in veterinary patients with naturally occurring cancer, including dogs with DLBCL, is limited. Studies22—24 in which PD-L1 expression was evaluated in multiple types of canine tumors, including a small number of lymphomas, have yielded conflicting results. The primary objective of the study reported here was to quantify PD-L1 expression in the tumors of a larger, more homogenous population of dogs with DLBCL than previously evaluated.24 A secondary objective was to determine whether PD-L1 expression was associated with PFST following chemotherapy in dogs with DLBCL. We hypothesized that expression of PD-L1 in canine DLBCL tumors would vary and that PD-L1 expression would be negatively associated with PFST.
Materials and Methods
Tumor specimens and data collection
The medical records database of the Purdue University Veterinary Teaching Hospital was searched to identify dogs that had a histologically confirmed diagnosis of DLBCL between 2012 and 2016. Identified dogs for which archived tumor specimens were available for analysis and that had a multicentric (primary nodal) distribution of disease, had not received any antineoplastic treatments (including corticosteroids) prior to collection of biopsy specimens, and were treated with at least 1 cycle of CHOP chemotherapy, as described by Garrett et al,1 were included in the study.
For each dog included in the study, information extracted from the medical record included signalment, presence or absence of anemia and thrombocytopenia at the time of diagnosis, tumor stage (as determined by the WHO classification system25; WHO tumor stage) and substage, PFST, and cause of death. At the time of diagnosis, complete tumor staging typically included a CBC, serum biochemical profile, thoracic and abdominal radiography, abdominal ultrasonography, and cytologic analysis of a bone marrow aspirate; however, some dogs did not undergo all staging tests. Each dog was assigned the highest WHO tumor stage possible on the basis of information recorded in the medical record. For dogs with incomplete medical records, referring veterinarians and owners were contacted to collect missing and follow-up information.
Control specimens
Tonsil and lymph node specimens were collected from 10 healthy research dogs (controls) immediately following euthanasia and confirmation of death. All dogs were sexually intact male mongrels with ages ranging from 1 to 3 years at the time of tissue collection. The dogs were euthanized with a barbiturate overdose following completion of a terminal surgical laboratory exercise that was part of the DVM curriculum at the Purdue University College of Veterinary Medicine. All maintenance protocols and procedures performed on those dogs were reviewed and approved by the Purdue University Animal Care and Use Committee.
Histologic examination
Archived tissue specimens from dogs with DLBCL were retrieved from the Indiana Animal Disease Diagnostic Laboratory. Immediately after harvest, all archived and control tissue specimens designated for histologic evaluation were fixed in neutral-buffered 10% formalin and then embedded in paraffin. Embedded specimens were sliced into 3-μm-thick sections, deparaffinized, and processed with H&E stain (archived and control specimens) or immunohistochemical methods (archived specimens only) for detection of CD3, CD79a, and Pax-5, a B-cell specific transcription factor protein. All specimens were histologically reviewed by 1 board-certified veterinary pathologist (JAR-V). The morphological diagnosis and grade for each DLBCL specimen were confirmed, and all control tonsil and lymph node specimens were confirmed to be histologically normal.
qPCR analysis
Control and DLBCL-affected lymph node specimens designated for qPCR analysis were homogenized in guanidinium thiocyanate and acid phenola immediately after harvest, after which RNA was extracted in accordance with the manufacturer's instructions. Extracted RNA samples were then stored at −80°C until analysis. Fresh tonsil tissue from a healthy dog was used as a positive control for PD-L1 expression during validation (ie, PD-L1 induction experiments) of the qPCR assay but was not used as a control in subsequent experiments in which lymph node PD-L1 mRNA expression was compared between dogs with DLBCL and healthy control dogs. Spectrophotometricb analysis was performed on all samples to determine the RNA concentration and purity, and all samples had A260:A280 ratios > 1.8. Then, cDNA was generated from each RNA sample by use of a commercial cDNA reaction master mixc in accordance with the manufacturer's instructions.
Multiplex qPCR analysis was performed with a commercial instrument.d For each sample, the reaction was performed in triplicate by use of custom-designed fluorescent probese with primers against canine PD-L1 and GAPDH (ie, housekeeping gene). The following custom-designed sequences were used to amplify canine PD-L1: TGTGTCAGGCTGAGGGTTACC (forward primer), ACTCGGTGGTCACTGCTTGTC (reverse primer), and TGAGGCTGAAGTCATC (probe). Those sequences were designed to specifically amplify a 60-bp product that spans nucleotides 533 to 593 of the canine PD-L1 gene. The specificity of the primers and probes for the canine PD-L1 gene was confirmed by comparison with known alignment sequences maintained in an internet-based search tool.f The only canine gene sequence that had 100% homology with the custom-designed primers and probe was that for PD-L1. The probes and primers used to amplify GAPDH were obtained commercially.g Commercially available reporter dyes were used to detect amplification of PD-L1h and GAPDH.i A commercial reagentj was used to quench fluorescence of reporter dyes in intact probes. The PCR cycling conditions included initial denaturation at 94°C for 10 minutes; 40 cycles of denaturation at 95°C for 30 seconds, annealing at 55°C for 1 minute, and extension at 72°C for 1 minute; and a final extension at 72°C for 10 minutes. For each sample, the Ctvalues for PD-L1 and GAPDH were reported for each reaction, and the mean Ctvalue for the 3 reactions was calculated for both PD-L1 and GAPDH and used for further calculations. The fold change in PD-L1 expression relative to that for GAPDH (ΔCt) was defined as the difference between the Ctvalue for PD-L1 (CtPD-L1) and the Ctvalue for GAPDH (CtGAPDH).
PD-L1 induction experiments
To confirm that the qPCR assay specifically measured PD-L1 mRNA expression (ie, that the product identified was representative of the canine PD-L1 gene), PD-L1 induction experiments were performed with 2 established tumor cell lines derived from canine TCCs. Because PD-L1 is constitutively expressed in squamous tonsillar epithelium,26 fresh tonsil tissue obtained from a control dog was used as the control tissue for these experiments. Control tonsillar tissues and invasive canine TCC cell lines27 (K9TCC and K9TCC-PU-Nk) were treated and incubated with 20 and 100 ng/mL of recombinant canine IFN-γ proteink for 24 hours. Then, RNA was isolated from the cells by use of guanidinium thiocyanate and acid phenol,a and PD-L1 expression was determined by use of the qPCR assay previously described.
Data analysis
The qPCR data were analyzed with the 2−ΔΔCt method as described28 to calculate the fold change in PD-L1 expression in DLBCL lymph nodes relative to control lymph nodes. The mean ΔCt value for the 10 control lymph nodes was calculated and used as the referent against which the ΔCt values for the DLBCL specimens were compared to obtain ΔΔCt values for each DLBCL specimen. In this schema, mean PD-L1 expression in the control lymph nodes was set equal to 1.
Progression-free survival time was defined as the time (in days) from initiation of chemotherapy to the date of tumor progression or death from any cause, whichever came first. Progressive disease was defined as the recurrence of subjective lymphadenomegaly for dogs previously classified as being in complete remission or a ≥ 20% increase in the sum of the maximal dimensions of measured lymph nodes for dogs that were in partial remission.29 The date of tumor progression was inferred from lymph node measurements recorded in the medical record; however, the follow-up schedule for study dogs was not standardized. The median PFST for the study population was estimated with Kaplan-Meier analysis. The study population was dichotomously stratified on the basis of multiple suspected or known prognostic factors including WHO tumor stage (III vs IV and V), tumor substage (a vs b), presence or absence of anemia and thrombocytopenia at DLBCL diagnosis, and fold change in PD-L1 expression (< or ≥ 1) relative to control lymph nodes. For each prognostic factor, the log-rank test was used to compare the PFST distribution between the 2 strata. Cox-proportional hazards analysis was used to assess the association of each prognostic factor with the likelihood of cancer progression. Univariable analyses were performed initially, and prognostic factors with values of P ≤ 0.25 on univariable analysis were included in a multivariable model, which was built in a backward stepwise manner. During multivariable modeling, all possible 2-way interaction terms were assessed. Confounding was also evaluated and defined as a ≥ 20% change in the hazard ratio estimates for 1 or more remaining variables between models with and without the potential confounder. Values of P ≤ 0.05 were considered significant for all analyses unless otherwise specified. All analyses were performed with commercially available software.l
Results
Study population
The study population consisted of 42 dogs (17 spayed females, 1 sexually intact male, and 24 neutered males) with a mean age of 7.9 years (median, 7.4 years; range, 4.3 to 13.2 years) and weight of 32.6 kg(median, 35.1 kg; range, 5.9 to 69 kg). There were 8 Golden Retrievers, 7 mixed-breed dogs, 5 Labrador Retrievers, 2 Basset Hounds, 2 Beagles, 2 Bernese Mountain Dogs, 2 Rottweilers, and 1 each of Australian Shepherd, Bloodhound, Border Collie, Briard, Bulldog, Coonhound, Dachshund, German Shepherd Dog, Havanese, Mastiff, Miniature Pinscher, Miniature Schnauzer, Pembroke Welsh Corgi, and Scottish Terrier.
Among the 42 dogs, 11 (26%) and 13 (31%) were anemic and thrombocytopenic, respectively, at the time of DLBCL diagnosis. The WHO tumor stage was classified as stage III, IV, and V for 5 (12%), 29 (69%), and 8 (19%) dogs, respectively. The tumor substage was classified as a for 40 (95%) dogs and b for 2 (5%) dogs. Thirty-six of the 42 (86%) dogs underwent complete tumor staging. Of the dogs that did not undergo complete tumor staging, 5 did not undergo bone marrow aspiration and 4 did not undergo abdominal ultrasonography.
Validation of the qPCR assay
During the PD-L1 induction experiments, the K9TCC TCC cell line had a 56- and 74-fold increase in PD-L1 mRNA expression when exposed to 20 and 100 ng/mL of canine IFN-g, respectively. The K9TCC-Pu-Nk cell line had a 56- and 65-fold increase in PD-L1 mRNA expression when treated with 20 and 100 ng/mL of canine IFN-g, respectively (Figure 1).
In vitro fold change in PD-L1 mRNA expression for 2 established invasive canine TCC cell lines (K9TCC and K9TCC-PU-Nk) after 24 hours of incubation with or without (control; black bars) IFN-γ at concentrations of 20 (white bars) and 100 (gray bars) ng/mL.
Citation: American Journal of Veterinary Research 79, 6; 10.2460/ajvr.79.6.643
PD-L1 mRNA expression
Programmed cell death protein ligand-1 mRNA was detected in all archived (DLBCL-affected) and control lymph node specimens. For the control lymph nodes, the mean Ctvalue was 21.63 (median; 21.64; range, 20.36 to 22.83) for GAPDH and 27.10 (median, 27.16; range, 25.92 to 28.23) for PD-L1, and the mean ΔCt was 5.47 (median, 5.44; range, 4.56 to 6.86; Supplementary Table S1, available at avma http://avmajournals.avma.org/doi/suppl/10.2460/ajvr.79.6.643). For 21 of the 42 (50%) DLBCL-affected lymph nodes, the ΔCt was greater than the mean ΔCt for the control lymph nodes. The fold change in PD-L1 expression for DLBCL-affected lymph nodes relative to that for the control lymph notes ranged from 0.21 to 7.44.
PFST and association of PD-L1expression with clinical outcome
The PFST could not be calculated for 4 of the 42 study dogs. Of those 4 dogs, 3 were still in clinical remission at 247, 1,072, and 1,170 days after chemotherapy initiation, and the remaining dog was lost to follow-up at 160 days after chemotherapy initiation. Those 4 dogs were censored from the Kaplan-Meier analysis. Among the other 38 dogs, 35 had tumor progression, 2 died from suspected hemangiosarcoma at 406 and 466 days after chemotherapy initiation, and 1 died from heart failure at 256 days after chemotherapy initiation. The estimated median PFST was 249 days for the entire study population.
The mean PFST was 241 days (median, 244 days; range, 34 to 561 days) for the 21 dogs with a PD-L1 fold change < 1.0, 254 days (median, 295 days; range, 41 to 466 days) for the 11 dogs with a PD-L1 fold change between 1.0 and 1.9, 387 days (median, 252 days; range, 35 to 1,170 days) for the 9 dogs with a PD-L1 fold change between 2.0 and 2.9, and 23 days for the 1 dog with a PD-L1 fold change ≥ 3.0. The median PFST did not differ significantly between dogs with a PD-L1 fold change < 1 and dogs with a PD-L1 fold change ≥ 1 (Figure 2).
Kaplan-Meier curves for PFST for 42 dogs with DLBCL on the basis of PD-L1 fold change in tumoral lymph node specimens (A) and presence of thrombocytopenia at diagnosis (B). The median PFST did not differ significantly (P = 0.69) between dogs with a PD-L1 fold change < 1 (solid line) and dogs with a PD-L1 fold change ≥ 1 (dashed line; A) but did differ significantly (P = 0.008) between dogs that did (solid line) and did not (dashed line; B) have thrombocytopenia.
Citation: American Journal of Veterinary Research 79, 6; 10.2460/ajvr.79.6.643
Results of the log-rank tests indicated that the PFST did not differ significantly on the basis of the WHO tumor stage at diagnosis (P = 0.12), tumor substage at diagnosis (P = 0.73), or presence of anemia (P = 0.82), but the PFST did differ significantly between dogs with thrombocytopenia and those with platelet counts within the reference range (nonthrombocytopenic dogs) at diagnosis. The median PFST for nonthrombocytopenic dogs (273 days; 95% CI, 232 to 326 days) was significantly (P < 0.008) greater than that for thrombocytopenic dogs (84 days; 95% CI, 41 to 256 days; Figure 2).
On univariable Cox proportional hazards analyses, the likelihood of cancer progression was not associated with tumor substage (P = 0.733), presence of anemia at diagnosis (P = 0.823), or PD-L1 expression (P = 0.360), but was significantly associated with WHO tumor stage (P = 0.04) and presence of thrombocytopenia at diagnosis (P < 0.008). No confounders or significant 2-way interaction terms were identified during multivariable analysis. Results for the multivariable Cox proportional hazards model that included only the main effects for WHO tumor stage and thrombocytopenia were summarized (Table 1). Cancer progression was 2.56 times (95% CI, 1.28 to 5.15; P = 0.008) as likely for dogs with thrombocytopenia at diagnosis, compared with nonthrombocytopenic dogs.
Results of a multivariable Cox proportional hazards model to evaluate associations of potential prognostic factors with the hazard of developing progressive disease in a retrospective study of 42 dogs with DLBCL.
| Factor | Category | Hazard ratio | 95% CI | P value |
|---|---|---|---|---|
| Thrombocytopenia | Present | 2.56 | 1.28–5.15 | 0.008 |
| Absent | Referent | |||
| WHO tumor stage | V | 3.98 | 1.02–15.52 | 0.087 |
| IV | 2.72 | 0.82–9.08 | — | |
| III | Referent |
Values of P ≤ 0.05 were considered significant.
Discussion
In the present study, a multiplex qPCR assay was validated for quantification of PD-L1 mRNA expression in tumoral and healthy lymph node specimens of dogs. Comparison of the known mRNA sequence alignment for the canine PD-L1 gene with that of the product generated by the multiplex qPCR assay indicated that the PD-L1 probe and primers used in the assay had 100% specificity for that gene. The assay amplified a 60-bp sequence of PD-L1 mRNA that was inducible in tumor cell lines following treatment with IFN-γ, a known inducer of PD-L1 expression. That finding provided additional support that the multiplex qPCR assay accurately detected PD-L1 mRNA expression in tumoral and healthy lymph node tissues.
Subsequently, expression of PD-L1 mRNA in tumoral lymph nodes specimens was determined for 42 dogs with DLBCL and compared with that identified in lymph node specimens obtained from 10 healthy dogs (controls). Results indicated that PD-L1 mRNA was expressed in lymph node specimens obtained from all 10 control dogs and tumor specimens obtained from all 42 dogs with DLBCL. The results also suggested that PD-L1 mRNA expression varied among dogs with DLBCL. This was not unexpected because the PD-L1–PD-1 interaction has an important role in immune system balance for both healthy and sick animals.
Twenty-one (50%) of the DLBCL specimens evaluated in the present study had PD-L1 mRNA expression that was greater than the mean PD-L1 mRNA expression for control specimens (ie, a PD-L1 fold change > 1.0). That finding differs from results of another study,24 in which PD-L1 mRNA expression was 1.5- to 3.0-fold that in healthy lymph node tissue for all 7 canine B-cell lymphomas evaluated. However, the healthy lymph node tissue that was used as the referent for that study24 was obtained from only 1 clinically normal Labrador Retriever. The results of the present study also differed from those of 2 studies22,23 in which PD-L1 expression was determined by immunohistochemical methods. In 1 study,23 no immunohistochemical evidence of PD-L1 expression was found in any of the 5 DLBCLs evaluated. In the other study,22 all 15 lymphoma specimens assessed had immunohistochemical evidence of PD-L1 expression; however, the lymphoma specimens evaluated included both low- and high-grade tumors as well as B- and T-cell tumors. The antibodies used for the immunohistochemical analysis differed between those 2 studies,22,23 which may account for the apparently conflicting results. Collectively, the results of the present study and those other studies22–24 suggest that additional research, ideally with multiple validated detection modalities, is necessary to determine the extent to which PD-L1 is expressed by DLBCL in dogs. These collective results also suggest that findings may vary depending on the technique used to detect PD-L1 (eg, qPCR vs immunohistochemical analyses). In human medicine, immunohistochemical analysis is much more commonly used for detection of PD-L1 expression in tumors than are RNA-based methods.30 However, results of qPCR analysis, RNA sequencing, and in situ hybridization correlate well with those of immunohistochemical analysis for detection of PD-L1 in human tumors.31–33 For the present study, we would have liked to compare the qPCR results with immunohistochemical findings, but at the time the study was performed, no antibodies were validated for immunohistochemical detection of PD-L1 expression in canine tissue.
In human patients with DLBCL, expression of PD-L1 is inversely correlated with prognosis. In a study18 of 273 patients with DLBCL, 218 (80%) received rituximab-CHOP or rituximab-CHOP–like chemotherapy. During the observation period, the survival rate for patents with PD-L1–positive lymphoma (defined as > 30% PD-L1–positive malignant cells as determined by immunohistochemical analysis) was significantly (P = 0.013) poorer than that for patients with PD-L1–negative lymphoma. For the dogs with DLBCL evaluated in the present study, PD-L1 mRNA expression was not associated with clinical outcome. However, further investigation is necessary because the small study population of the present study might have introduced type II error and limited our ability to detect a significant association between PD-L1 mRNA expression and PFST.
Although PD-L1 mRNA expression was not identified as a prognostic indicator for dogs with DLBCL in the present study, that does not mean that anti–PD-L1 therapy will not be beneficial for dogs with DLBCL, and such treatment may indeed be clinically beneficial for some dogs. However, it is currently unknown whether determination of PD-L1 mRNA expression by qPCR analysis will be useful for identification of DLBCL-affected dogs that will benefit from treatments that target the PD-1–PD-L1 axis. For example, in human medicine, immunohistochemical methods are frequently used to detect tumoral expression of PD-L1 and screen patients for enrollment into clinical trials that involve PD-1 or PD-L1–targeted therapies; however, the results of those methods have been inconsistent predictors of which patients will benefit from such treatment.30 In fact, the nature of the relationship between tumoral PD-L1 expression and likelihood or extent of clinical response to PD-1– or PD-L1–targeted therapies has not been elucidated, and some patients with tumors that have little or no PD-L1 expression may benefit from such treatment.20,34 Therefore, the clinical usefulness of the qPCR assay described in the present study for selection of dogs with DLBCL for PD-L1–targeted therapy warrants further investigation.
The present study had several limitations. Although the number of dogs with DLBCL evaluated in the present study was larger than that of all other studies22–24 in which PD-L1 expression was determined for canine DLBCLs, a larger study might produce different results or provide sufficient power to detect a significant and clinically relevant association between PD-L1 expression and PFST. Results of a large-scale study18 in human patients with DLBCL indicate that tumor expression of PD-L1 is negatively associated with survival time. In the present study, qPCR analysis allowed for quantification of PD-L1 mRNA in each sample evaluated, but it could not determine the localization of the PD-L1 protein within those specimens. Immunohistochemical analysis to confirm which cells express PD-L1 (eg, tumor cells, tumor-infiltrating lymphocytes, or stromal cells), the percentage of PD-L1–expressing cells, and the localization of PD-L1 within those cells would have been a useful complement to the qPCR assay described in this study. Immunohistochemical detection of PD-L1 in canine tumors has been described,23 but as previously mentioned, at the time this study was conducted, antibodies validated for detection of PD-L1 in canine tissues were not commercially available, and some antibodies that were previously thought to detect canine PD-L1 were no longer available. Finally, because of the retrospective nature of this study, tumor staging was not uniform among the dogs with DLBCL. Although the majority (36/42 [86%]) of dogs underwent complete tumor staging, some did not, and it is possible that the tumors of some dogs were understaged, which could have affected the results of the statistical analyses.
To our knowledge, the present study was the first to evaluate PD-L1 mRNA expression in a fairly large cohort of dogs with histologically confirmed DLBCL. Although tumoral PD-L1 mRNA expression was not significantly associated with survival time in this study, it was greater than the PD-L1 mRNA expression in control (healthy) lymph node specimens (ie, was overexpressed) for half of the study population. Therefore, PD-L1–targeted therapies may be clinically beneficial for some dogs with DLBCL, and further research is necessary to determine how qPCR analysis can be best used for identifying dogs with DLBCL that might benefit from such treatment.
Acknowledgments
Supported by a Graduate Student Competitive Research Award from the Department of Veterinary Clinical Sciences, College of Veterinary Medicine, Purdue University.
The authors declare that there were no conflicts of interest.
Presented in abstract form at the Annual Conference of the Veterinary Cancer Society, Orlando, Fla, October 2016.
ABBREVIATIONS
| CHOP | Cyclophosphamide, doxorubicin, vincristine, and prednisone |
| CI | Confidence interval |
| Ct | Cycle threshold |
| DLBCL | Diffuse large B-cell lymphoma |
| GAPDH | Glyceraldehyde 3-phosphate dehydrogenase |
| IFN | Interferon |
| PD-1 | Programmed cell death protein-1 |
| PD-L1 | Programmed cell death ligand-1 |
| PFST | Progression-free survival time |
| qPCR | Quantitative real-time PCR |
| TCC | Transitional cell carcinoma |
| WHO | World Health Organization |
Footnotes
TRIzol reagent, Invitrogen Corp, Carlsbad, Calif.
Nanodrop, Thermo Fisher Scientific, Waltham, Mass.
SuperScript VILO Master Mix, Invitrogen Corp, Carlsbad, Calif.
Stratagene Mx3000 qPCR system, Agilent Technologies Inc, Santa Clara, Calif.
TaqMan probes, Invitrogen Corp, Carlsbad, Calif.
Basic Local Alignment Search Tool (BLAST), US National Library of Medicine, Bethesda, Md. Available at: blast.ncbi.nlm.nih.gov/Blast.cgi. Accessed July 13, 2017.
Life Technologies, Carlsbad, Calif.
FAM, Life Technologies, Carlsbad, Calif.
VIC, Life Technologies, Carlsbad, Calif.
MGB-NFQ, Invitrogen Corp, Carlsbad, Calif.
R&D Systems Inc, Minneapolis, Minn.
StataSE, version 13.1, StataCorp LP, College Station, Tex.
References
1. Garrett LD, Thamm DH, Chun R, et al. Evaluation of a 6-month chemotherapy protocol with no maintenance therapy for dogs with lymphoma. J Vet Intern Med 2002;16:704–709.
2. Keller ET, MacEwen EG, Rosenthal RC, et al. Evaluation of prognostic factors and sequential combination chemotherapy with doxorubicin for canine lymphoma. J Vet Intern Med 1993;7:289–295.
3. Hosoya K, Kisseberth WC, Lord LK, et al. Comparison of COAP and UW-19 protocols for dogs with multicentric lymphoma. J Vet Intern Med 2007;21:1355–1363.
4. Sorenmo K, Overly B, Krick E, et al. Outcome and toxicity associated with a dose-intensified, maintenance-free CHOP-based chemotherapy protocol in canine lymphoma: 130 cases. Vet Comp Oncol 2010;8:196–208.
5. Burton JH, Garrett-Mayer E, Thamm DH. Evaluation of a 15-week CHOP protocol for the treatment of canine multicentric lymphoma. Vet Comp Oncol 2013;11:306–315.
6. Rassnick KM, McEntee MC, Erb HN, et al. Comparison of 3 protocols for treatment after induction of remission in dogs with lymphoma. J Vet Intern Med 2007;21:1364–1373.
7. Iwai Y, Ishida M, Tanaka Y, et al. Involvement of PD-L1 on tumor cells in the escape from host immune system and tumor immunotherapy by PD-L1 blockade. Proc Natl Acad Sci U S A 2002;99:12293–12297.
8. Dong H, Strome SE, Salomao DR, et al. Tumor-associated B7–H1 promotes T-cell apoptosis: a potential mechanism of immune evasion. Nat Med 2002;8:793–800.
9. Gadiot J, Hooijkaas AI, Kaiser AD, et al. Overall survival and PD-L1 expression in metastasized malignant melanoma. Cancer 2011;117:2192–2201.
10. Konishi J, Yamazaki K, Azuma M, et al. B7–H1 expression on non-small cell lung cancer cells and its relationship with tumor-infiltrating lymphocytes and their PD-1 expression. Clin Cancer Res 2004;10:5094–5100.
11. Ghebeh H, Mohammed S, Al-Omair A, et al. The B7–H1 (PD-L1) T lymphocyte-inhibitory molecule is expressed in breast cancer patients with infiltrating ductal carcinoma: correlation with important high-risk prognostic factors. Neoplasia 2006;8:190–198.
12. Nakanishi J, Wada Y, Matsumoto K, et al. Overexpression of B7–H1 (PD-L1) significantly associates with tumor grade and postoperative prognosis in human urothelial cancers. Cancer Immunol Immunother 2007;56:1173–1182.
13. Thompson RH, Gillett MD, Cheville JC, et al. Costimulatory B7–H1 in renal cell carcinoma patients: indicator of tumor aggressiveness and potential therapeutic target. Proc Natl Acad Sci U S A 2004;101:17174–17179.
14. Gao Q, Wang XY, Qiu SJ, et al. Overexpression of PD-L1 significantly associates with tumor aggressiveness and postoperative recurrence in human hepatocellular carcinoma. Clin Cancer Res 2009;15:971–979.
15. Ohigashi Y, Sho M, Yamada Y, et al. Clinical significance of programmed death-1 ligand-1 and programmed death-1 ligand-2 expression in human esophageal cancer. Clin Cancer Res 2005;11:2947–2953.
16. Wu C, Zhu Y, Jiang J, et al. Immunohistochemical localization of programmed death-1 ligand-1 (PD-L1) in gastric carcinoma and its clinical significance. Acta Histochem 2006;108:19–24.
17. Nomi T, Sho M, Akahori T, et al. Clinical significance and therapeutic potential of the programmed death-1 ligand/programmed death-1 pathway in human pancreatic cancer. Clin Cancer Res 2007;13:2151–2157.
18. Kiyasu J, Miyoshi H, Hirata A, et al. Expression of programmed cell death ligand 1 is associated with poor overall survival in patients with diffuse large B-cell lymphoma. Blood 2015;126:2193–2201.
19. Robert C, Schachter J, Long GV, et al. Pembrolizumab versus ipilimumab in advanced melanoma. N Engl J Med 2015;372:2521–2532.
20. Robert C, Long GV, Brady B, et al. Nivolumab in previously untreated melanoma without BRAF mutation. N Engl J Med 2015;372:320–330.
21. Lesokhin AM, Ansell SM, Armand P, et al. Nivolumab in patients with relapsed or refractory hematologic malignancy: preliminary results of a phase Ib study. J Clin Oncol 2016;34:2698–2704.
22. Shosu K, Sakurai M, Inoue K, et al. Programmed cell death ligand 1 expression in canine cancer. In Vivo 2016;30:195–204.
23. Maekawa N, Konnai S, Okagawa T, et al. Immunohistochemical analysis of PD-L1 expression in canine malignant cancers and PD-1 expression on lymphocytes in canine oral melanoma. PLoS One 2016;11:e0157176.
24. Kumar SR, Kim DY, Henry CJ, et al. Programmed death ligand 1 is expressed in canine B cell lymphoma and downregulated by MEK inhibitors. Vet Comp Oncol 2017;15:1527–1536.
25. Owen LN. TNM classification of tumors in domestic animals. Geneva: World Health Organization, 1980;46–47.
26. Lyford-Pike S, Peng S, Young GD, et al. Evidence for a role of the PD-1:PD-L1 pathway in immune resistance of HPV-associated head and neck squamous cell carcinoma. Cancer Res 2013;73:1733–1741.
27. Dhawan D, Ramos-Vara JA, Stewart JC, et al. Canine invasive transitional cell carcinoma cell lines: in vitro tools to complement a relevant animal model of invasive urinary bladder cancer. Urol Oncol 2009;27:284–292.
28. Schmittgen TD, Livak KJ. Analyzing real-time PCR data by the comparative C(T) method. Nat Protoc 2008;3:1101–1108.
29. Vail DM, Michels GM, Khanna C, et al. Response evaluation criteria for peripheral nodal lymphoma in dogs (v1.0)—a Veterinary Cooperative Oncology Group (VCOG) consensus document. Vet Comp Oncol 2010;8:28–37.
30. Novotny JF Jr, Cogswell J, Inzuna H, et al. Establishing a complementary diagnostic for anti–PD-1 immune checkpoint inhibitor therapy. Ann Oncol 2016;27:1966–1969.
31. Shen JK, Cote GM, Choy E, et al. Programmed cell death ligand 1 expression in osteosarcoma. Cancer Immunol Res 2014;2:690–698.
32. Schultheis AM, Scheel AH, Ozretić L, et al. PD-L1 expression in small cell neuroendocrine carcinomas. Eur J Cancer 2015;51:421–426.
33. Wu S, Shi X, Sun J, et al. The significance of programmed cell death ligand 1 expression in resected lung adenocarcinoma. Oncotarget 2017;8:16421–16429.
34. Brahmer J, Reckamp KL, Baas P, et al. Nivolumab versus docetaxel in advanced squamous-cell non-small-cell lung cancer. N Engl J Med 2015;373:123–135.
