• View in gallery

    Mean ± SD values for clinical score (A), percentage of neutrophils in BAL fluid (B), pulmonary resistance (C), pulmonary elastance (D), and transpulmonary pressure (E) for 6 control horses (white bars) and 6 horses with severe equine asthma (black bars) at 1 week after challenge exposure with moldy hay. Clinical score was assigned by use of a scale from 0 to 4 for abdominal movement (0 = no abdominal movement and 4 = severe and marked abdominal movement) and nasal flaring (0 = no flaring and 4 = severe and continuous flaring); abdominal and nasal flaring scores were added (maximum score, 8). *Value differs significantly (P < 0.05) from the value for the control horses.

  • View in gallery

    Mean ± SD values for the ability of neutrophils obtained from 6 control horses (white bars) and 6 horses with severe equine asthma (black bars) to kill Streptococcus zooepidemicus (A), Streptococcus equi (B), and Streptococcus suis strain B218 (C), which was a nonencapsulated mutant strain used as a positive control sample. Bacteria were mixed with neutrophils suspended in RPMI 1640 medium and pooled equine serum (60% RPMI 1640 medium and 40% equine serum) and incubated for 60 minutes (S equi and S zooepidemicus) or 90 minutes (S suis B218). See Figure 1 for remainder of key

  • View in gallery

    Mean ± SD values for flow cytometry assay of phagocytosis of fluorescent polystyrene beads by neutrophils from 6 control horses (white bar) and 6 horses with severe equine asthma (black bar). Results are the percentage of neutrophils with associated fluorescent beads.

  • View in gallery

    Confocal microscopic image of equine neutrophils representing phagocytosis of fluorescent polystyrene beads (red) by circulating neutrophils marked with a primary antibody (anti-CD90) and a fluorescent secondary antibody (anti-mouse IgM-fluorescein isothiocyanate; green). Bar = 15 μm.

  • View in gallery

    Gene expression of TNF-α (A through C), IL-8 (D through F), and IL-10 (G through I) induced in circulating blood neutrophils obtained from 6 control horses (white circles) and 6 horses with severe equine asthma (black circles) and stimulated by incubation with S zooepidemicus (104 CFUs/mL; A, D, and G), S equi (104 CFUs/mL; B, E, and H), or LPS (2 μg/mL; C, F, and 1) for up to 12 hours. Results were obtained by use of a real-time quantitative PCR assay and represent the fold increase (as calculated by use of the 2−ΔΔCt method) over that of unstimulated neutrophils (ie, negative control sample, which was assigned a value of I for each horse at each time point). Ubiquitin and GAPDH were used as reference genes to normalize gene expression. Notice that the scale on the y-axis for IL-8 (panels D through F) differs from the scale on the y-axis for TNF-α and IL-10. *Value differs significantly (P < 0.01) from the value for LPS stimulation at the same time point. †Value differs significantly different (P < 0.01) from the value for S equi stimulation at the same time point.

  • 1. Leclere M, Lavoie-Lamoureux A, Lavoie JP. Heaves, an asthma-like disease of horses. Respirology 2011;16:10271046.

  • 2. Fairbairn SM, Page CP, Lees P, et al. Early neutrophil but not eosinophil or platelet recruitment to the lungs of allergic horses following antigen exposure. Clin Exp Allergy 1993;23:821828.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 3. Marr KA, Foster AP, Lees P, et al. Effect of antigen challenge on the activation of peripheral bloodneutrophils from horses with chronic obstructive pulmonary disease. Res Vet Sci 1997;62:253260.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 4. Brazil TJ, Dagleish MP, McGorum BC, et al. Kinetics of pulmonary neutrophil recruitment and clearance in a natural and spontaneously resolving model of airway inflammation. Clin Exp Allergy 2005;35:854865.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 5. Lavoie-Lamoureux A, Moran K, Beauchamp G, et al. IL-4 activates equine neutrophils and induces a mixed inflammatory cytokine expression profile with enhanced neutrophil chemotactic mediator release ex vivo. Am J Physiol Lung Cell Mol Physiol 2010;299:L472L482.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 6. Smith JA. Neutrophils, host defense, and inflammation: a double-edged sword. J Leukoc Biol 1994;56:672686.

  • 7. Grandguillot L, Fairbrother JM, Vrins A. Use of a protected catheter brush for culture of the lower respiratory tract in horses with small airway disease. Can J Vet Res 1991;55:5055.

    • Search Google Scholar
    • Export Citation
  • 8. Mansmann RA, Strouss AA. Evaluation of transtracheal aspiration in the horse. J Am Vet Med Assoc 1976;169:631633.

  • 9. Nuytten J, Muylle E, Oyaert W, et al. Cytology, bacteriology and phagocytic capacity of tracheo-bronchial aspirates in healthy horses and horses with chronic obstructive pulmonary disease (COPD). Zentralbl Veterinarmed A 1983;30:114120.

    • Search Google Scholar
    • Export Citation
  • 10. Lavoie JP, Dalle S, Breton L, et al. Bronchiectasis in three adult horses with heaves. J Vet Intern Med 2004;18:757760.

  • 11. Theegarten D, Sachse K, Mentrup B, et al. Chlamydophila spp. infection in horses with recurrent airway obstruction: similarities to human chronic obstructive disease. Respir Res 2008;9:1422.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 12. Laharrague P, Corberand J, Fillola G, et al. Polymorphonuclear dysfunction in bronchopulmonary diseases in human adults. J Clin Lab Immunol 1985;17:2124.

    • Search Google Scholar
    • Export Citation
  • 13. King P, Bennett-Wood V, Hutchinson P, et al. Bactericidal activity of neutrophils with reduced oxidative burst from adults with bronchiectasis. APMIS 2009;117:133139.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 14. Picavet T. Clinical approach to the coughing horse, in Proceedings. Voorjaarsdagen 2007;236237.

  • 15. Magnusson U, Jonsson K. A method for the accurate measurement of opsonic activity in uterine secretions of the mare. Theriogenology 1991;36:737747.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 16. Jacobsen K, Gintz T, Reed SM, et al. Isolation of equine neutrophils and analysis of functional characteristics by chemiluminescence and bacterial assays. Am J Vet Res 1982;43:19121916.

    • Search Google Scholar
    • Export Citation
  • 17. Martens RJ, Martens JG, Renshaw HW, et al. Rhodococcus equi: equine neutrophil chemiluminescent and bactericidal responses to opsonizing antibody. Vet Microbiol 1987;14:277286.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 18. Leblanc MM, Pritchard EL. Effects of bovine colostrum, foal serum immunoglobulin concentration and intravenous plasma transfusion on chemiluminescence response of foal neutrophils. Anim Genet 1988;19:435445.

    • Search Google Scholar
    • Export Citation
  • 19. Takai S, Morozumi Y, Higashiyama S, et al. Nitroblue tetrazolium reduction by neutrophils of newborn foals, adult horses, and a foal infected with Rhodococcus (Corynebacterium) equi. Nippon Juigaku Zasshi 1986;48:405408.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 20. Yager JA, Foster SF, Zink MC, et al. In vitro bactericidal efficacy of equine polymorphonuclear leukocytes against Corynebacterium equi. Am J Vet Res 1986;47:438440.

    • Search Google Scholar
    • Export Citation
  • 21. Watson ED. Opsonins in uterine washings influencing in vitro activity of equine neutrophils. Equine Vet J 1988;20:435437.

  • 22. Bernoco M, Liu IK, Wuest-Ehlert CJ, et al. Chemotactic and phagocytic function of peripheral blood polymorphonuclear leucocytes in newborn foals. J Reprod Fertil Suppl 1987;35:599605.

    • Search Google Scholar
    • Export Citation
  • 23. Klucinski W, Winnicka A, Olszewski M, et al. Phagocytic activity of polymorphonuclear leukocytes lavaged from the lungs of horses with clinically diagnosed chronic pulmonary disease. Zentralbl Veterinarmed A 1994;41:558567.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 24. Foerster RJ, Wolf G. Phagocytosis of opsonized fluorescent microspheres by equine polymorphonuclear leukocytes. Zentralbl Veterinarmed B 1990;37:481490.

    • Search Google Scholar
    • Export Citation
  • 25. Johannisson A, Grondahl G, Demmers S, et al. Flow-cytometric studies of the phagocytic capacities of equine neutrophils. Acta Vet Scand 1995;36:553562.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 26. Raidal SL, Bailey GD, Love DN. The flow cytometric evaluation of phagocytosis by equine peripheral blood neutrophils and pulmonary alveolar macrophages. Vet J 1998;156:107116.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 27. McTaggart C, Yovich JV, Penhale J, et al. A comparison of foal and adult horse neutrophil function using flow cytometric techniques. Res Vet Sci 2001;71:7379.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 28. Joubert P, Silversides DW, Lavoie JP. Equine neutrophils express mRNA for tumour necrosis factor-alpha, interleukin (IL)-1beta, IL-6, IL-8, macrophage-inflammatory-protein-2 but not for IL-4, IL-5 and interferon-gamma. Equine Vet J 2001;33:730733.

    • Search Google Scholar
    • Export Citation
  • 29. Joubert P, Cordeau ME, Boyer A, et al. Cytokine expression by peripheral blood neutrophils from heaves-affected horses before and after allergen challenge. Vet J 2008;178:227232.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 30. Lavoie-Lamoureux A, Beauchamp G, Quessy S, et al. Systemic inflammation and priming of peripheral blood leukocytes persist during clinical remission in horses with heaves. Vet Immunol Immunopathol 2012;146:3545.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 31. Riihimaki M, Raine A, Pourazar J, et al. Epithelial expression of mRNA and protein for IL-6, IL-10 and TNF-alpha in endobronchial biopsies in horses with recurrent airway obstruction. BMC Vet Res 2008;4:815.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 32. Laan TT, Bull S, Pirie R, et al. The role of alveolar macrophages in the pathogenesis of recurrent airway obstruction in horses. J Vet Intern Med 2006;20:167174.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 33. Horohov DW, Beadle RE, Mouch S, et al. Temporal regulation of cytokine mRNA expression in equine recurrent airway obstruction. Vet Immunol Immunopathol 2005;108:237245.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 34. Ainsworth DM, Grunig G, Matychak MB, et al. Recurrent airway obstruction (RAO) in horses is characterized by IFN-gamma and IL-8 production in bronchoalveolar lavage cells. Vet Immunol Immunopathol 2003;96:8391.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 35. Giguere S, Viel L, Lee E, et al. Cytokine induction in pulmonary airways of horses with heaves and effect of therapy with inhaled fluticasone propionate. Vet Immunol Immunopathol 2002;85:147158.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 36. Padoan E, Ferraresso S, Pegolo S, et al. Real time RT-PCR analysis of inflammatory mediator expression in recurrent airway obstruction-affected horses. Vet Immunol Immunopathol 2013;156:190199.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 37. Lavoie JP, Maghni K, Desnoyers M, et al. Neutrophilic airway inflammation in horses with heaves is characterized by a Th2-type cytokine profile. Am J Respir Crit Care Med 2001;164:14101413.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 38. Lancefield RC, Perlmann GE. Preparation and properties of type-specific M antigen isolated from a group A, type 1 hemolytic Streptococcus. J Exp Med 1952;96:7182.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 39. Erol E, Locke SJ, Donahoe JK, et al. Beta-hemolytic Streptococcus spp. from horses: a retrospective study (2000–2010). J Vet Diagn Invest 2012;24:142147.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 40. Timoney JF. Strangles. Vet Clin North Am Equine Pract 1993;9:365374.

  • 41. Robinson NE, Olszewski MA, Boehler D, et al. Relationship between clinical signs and lung function in horses with recurrent airway obstruction (heaves) during a bronchodilator trial. Equine Vet J 2000;32:393400.

    • Search Google Scholar
    • Export Citation
  • 42. Jean D, Vrins A, Lavoie JP. Monthly, daily, and circadian variations of measurements of pulmonary mechanics in horses with chronic obstructive pulmonary disease. Am J Vet Res 1999;60:13411346.

    • Search Google Scholar
    • Export Citation
  • 43. Lapointe JM, Lavoie JP, Vrins AA. Effects of triamcinolone acetonide on pulmonary function and bronchoalveolar lavage cytologic features in horses with chronic obstructive pulmonary disease. Am J Vet Res 1993;54:13101316.

    • Search Google Scholar
    • Export Citation
  • 44. Charland N, Harel J, Kobisch M, et al. Streptococcus suis serotype 2 mutants deficient in capsular expression. Microbiology 1998;144:325332.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 45. Chabot-Roy G, Willson P, Segura M, et al. Phagocytosis and killing of Streptococcus suis by porcine neutrophils. Microb Pathog 2006;41:2132.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 46. Leutenegger CM, von Rechenberg B, Huder JB, et al. Quantitative real-time PCR for equine cytokine mRNA in nondecalcified bone tissue embedded in methyl methacrylate. Calcif Tissue Int 1999;65:378383.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 47. Anzai T, Timoney JF, Kuwamoto Y, et al. In vivo pathogenicity and resistance to phagocytosis of Streptococcus equi strains with different levels of capsule expression. Vet Microbiol 1999;67:277286.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 48. Wood JL, Newton JR, Chanter N, et al. Association between respiratory disease and bacterial and viral infections in British racehorses. J Clin Microbiol 2005;43:120126.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 49. Wood JL, Newton JR, Chanter N, et al. Inflammatory airway disease, nasal discharge and respiratory infections in young British racehorses. Equine Vet J 2005;37:236242.

    • Search Google Scholar
    • Export Citation
  • 50. Brinkmann V, Reichard U, Goosmann C, et al. Neutrophil extracellular traps kill bacteria. Science 2004;303:15321535.

  • 51. Witko-Sarsat V, Rieu P, Descamps-Latscha B, et al. Neutrophils: molecules, functions and pathophysiological aspects. Lab Invest 2000;80:617653.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 52. Dagleish MP, Pemberton AD, Brazil TJ, et al. Kinetics of equine neutrophil elastase release and superoxide anion generation following secretagogue activation: a potential mechanism for antiproteinase inactivation. Vet Immunol Immunopathol 1999;72:257275.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 53. McFarlane D, Sellon DC, Gaffney D, et al. Hematologic and serum biochemical variables and plasma corticotropin concentration in healthy aged horses. Am J Vet Res 1998;59:12471251.

    • Search Google Scholar
    • Export Citation
  • 54. McFarlane D, Hill K, Anton J. Neutrophil function in healthy aged horses and horses with pituitary dysfunction. Vet Immunol Immunopathol 2015; 165:99106.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 55. Tremblay GM, Ferland C, Lapointe JM, et al. Effect of stabling on bronchoalveolar cells obtained from normal and COPD horses. Equine Vet J 1993;25:194197.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 56. Leclere M, Lavoie-Lamoureux A, Gelinas-Lymburner E, et al. Effect of antigenic exposure on airway smooth muscle remodeling in an equine model of chronic asthma. Am J Respir Cell Mol Biol 2011;45:181187.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 57. Lavoie-Lamoureux A, Leclere M, Lemos K, et al. Markers of systemic inflammation in horses with heaves. J Vet Intern Med 2012;26:14191426.

    • Crossref
    • Search Google Scholar
    • Export Citation

Advertisement

Phagocytosis, bacterial killing, and cytokine activation of circulating blood neutrophils in horses with severe equine asthma and control horses

View More View Less
  • 1 Département de Sciences Cliniques, Faculté de Médecine Vétérinaire, Université de Montréal, St-Hyacinthe, QC J2S 2M2, Canada.
  • | 2 Groupe de Recherche sur les Maladies Infectieuses du Porc (GREMIP), Faculté de médecine vétérinaire, Université de Montréal, St-Hyacinthe, QC J2S 7C6, Canada.
  • | 3 Département de Sciences Cliniques, Faculté de Médecine Vétérinaire, Université de Montréal, St-Hyacinthe, QC J2S 2M2, Canada.
  • | 4 Groupe de Recherche sur les Maladies Infectieuses du Porc (GREMIP), Faculté de médecine vétérinaire, Université de Montréal, St-Hyacinthe, QC J2S 7C6, Canada.
  • | 5 Groupe de Recherche sur les Maladies Infectieuses du Porc (GREMIP), Faculté de médecine vétérinaire, Université de Montréal, St-Hyacinthe, QC J2S 7C6, Canada.
  • | 6 Département de Sciences Cliniques, Faculté de Médecine Vétérinaire, Université de Montréal, St-Hyacinthe, QC J2S 2M2, Canada.
  • | 7 Département de Sciences Cliniques, Faculté de Médecine Vétérinaire, Université de Montréal, St-Hyacinthe, QC J2S 2M2, Canada.

Abstract

OBJECTIVE To evaluate in vitro phagocytosis and bactericidal activity of circulating blood neutrophils in horses with severe equine asthma and control horses and to determine whether circulating blood neutrophils in horses with severe equine asthma have an increase in expression of the proinflammatory cytokine tumor necrosis factor (TNF)-α and the chemokine interleukin (IL)-8 and a decrease in expression of the anti-inflammatory cytokine IL-10 in response to bacteria.

ANIMALS 6 horses with severe equine asthma and 6 control horses.

PROCEDURES Circulating blood neutrophils were isolated from horses with severe equine asthma and control horses. Phagocytosis was evaluated by use of flow cytometry. Bactericidal activity of circulating blood neutrophils was assessed by use of Streptococcus equi and Streptococcus zooepidemicus as targets, whereas the cytokine mRNA response was assessed by use of a quantitative PCR assay.

RESULTS Circulating blood neutrophils from horses with severe equine asthma had significantly lower bactericidal activity toward S zooepidemicus but not toward S equi, compared with results for control horses. Phagocytosis and mRNA expression of TNF-α, IL-8, and IL-10 were not different between groups.

CONCLUSIONS AND CLINCAL RELEVANCE Impairment of bactericidal activity of circulating blood neutrophils in horses with severe equine asthma could contribute to an increased susceptibility to infections.

Abstract

OBJECTIVE To evaluate in vitro phagocytosis and bactericidal activity of circulating blood neutrophils in horses with severe equine asthma and control horses and to determine whether circulating blood neutrophils in horses with severe equine asthma have an increase in expression of the proinflammatory cytokine tumor necrosis factor (TNF)-α and the chemokine interleukin (IL)-8 and a decrease in expression of the anti-inflammatory cytokine IL-10 in response to bacteria.

ANIMALS 6 horses with severe equine asthma and 6 control horses.

PROCEDURES Circulating blood neutrophils were isolated from horses with severe equine asthma and control horses. Phagocytosis was evaluated by use of flow cytometry. Bactericidal activity of circulating blood neutrophils was assessed by use of Streptococcus equi and Streptococcus zooepidemicus as targets, whereas the cytokine mRNA response was assessed by use of a quantitative PCR assay.

RESULTS Circulating blood neutrophils from horses with severe equine asthma had significantly lower bactericidal activity toward S zooepidemicus but not toward S equi, compared with results for control horses. Phagocytosis and mRNA expression of TNF-α, IL-8, and IL-10 were not different between groups.

CONCLUSIONS AND CLINCAL RELEVANCE Impairment of bactericidal activity of circulating blood neutrophils in horses with severe equine asthma could contribute to an increased susceptibility to infections.

Severe equine asthma (also known as recurrent airway obstruction or heaves) is a common chronic pulmonary inflammatory disease affecting mature horses in the Northern Hemisphere. Affected horses develop labored breathing at rest that is associated with bronchoconstriction, mucus secretion, and airway remodeling when exposed to aeroallergens during stabling and hay feeding.1 Infiltration of neutrophils within the airways is a characteristic finding of severe equine asthma and occurs within hours after exposure to moldy hay.2 Although the exact role neutrophils play in the pathogenesis of the condition is not clear, there is evidence that circulating blood neutrophils are activated in horses with severe equine asthma.3–5

Neutrophils are the primary cell type involved in the initial host defense against pathogenic microorganisms and play an important role in clearance of pathogenic microorganisms through engulfment and degradation.6 Bacterial growth on microbial culture of tracheal secretions7–9 and samples from horses with bronchiectasis,10 which possibly developed as a consequence of chronic bacterial colonization of the airways, has been reported secondary to severe equine asthma.11 Humans with bronchiectasis and asthma have a reduced ability to kill Candida spp and Staphylococcus aureus, respectively.12,13 Collectively, these findings suggest that the bactericidal capacity of neutrophils in equine chronic respiratory diseases, such as severe equine asthma, could be altered. This could potentially contribute to the development of secondary bacterial infection in severely asthmatic horses.14

Several in vitro assays exist for the evaluation of bactericidal activity and phagocytic capacity of neutrophils. For horses, bactericidal activity has been assessed by use of chemiluminescence assays,15–18 nitroblue tetrazolium dye reduction tests,19 and incubation of neutrophils and bacteria with subsequent counting of viable bacteria after incubation.20,21 Phagocytosis assays typically assess the ability of a cell to attach to or to internalize particles. Phagocytosis in horses has been evaluated by use of light microscopy9,22,23 and flow cytometry.24–27 Flow cytometry analysis is a rapid and reproducible method for analyzing phagocytosis in large numbers of cells on a cell-by-cell basis.25,26

Equine neutrophils are capable of expressing an array of proinflammatory and chemoattractant cytokines,5,28,29 many of which are upregulated during severe equine asthma.30–36 It currently is recognized that these neutrophils are capable of modulating their cytokine response on the basis of the antigens they encounter. For instance, when stimulated with IL-4, a cytokine upregulated in the lungs of horses with severe equine asthma,37 expression of IL-1β by circulating blood neutrophils is lower, compared with expression after activation by bacterial extracts.5 Therefore, the complex inflammatory milieu in the lung tissues of horses with severe equine asthma could differentially activate neutrophils and influence their cytokine response to bacterial infection.

On the basis of these observations, we hypothesized that phagocytosis or bacterial killing (or both) by circulating blood neutrophils in horses with severe equine asthma would be less than in healthy horses, and that circulating blood neutrophils would have altered expression of inflammatory mediators in response to bacteria. Thus, the first objective of the study reported here was to compare phagocytosis and bacterial killing of Streptococcus equi and Streptococcus zooepidemicus by circulating blood neutrophils of horses with clinical signs of severe equine asthma and control horses. These bacteria were selected because S equi and S zooepidemicus, which are β-hemolytic and Lancefield group C streptococci,38 are commonly involved in equine diseases. Streptococcus zooepidemicus is a part of the normal bacterial flora in horses and the organism most frequently cultured (72.0%)39 from infections in which β-hemolytic streptococci are isolated. Streptococcus equi causes strangles, a contagious, acute, and suppurative lymphadenitis in horses.40 The second objective of the study reported here was to determine whether circulating blood neutrophils of horses with severe equine asthma have an increase in the expression of the proinflammatory cytokine TNF-α and the chemokine IL-8 and a decrease in expression of an anti-inflammatory cytokine IL-10, compared with expression in horses without respiratory disease.

Materials and Methods

Animals

Twelve adult mixed-breed horses (10 mares and 2 geldings) from a university research herd were included in the study. Six horses with severe equine asthma had a history of chronic respiratory tract disease and abnormal lung function following exposure to moldy hay. Six control horses had no history or clinical signs of respiratory tract disease and had a maximum transpulmonary pressure of < 10 cm H2O following exposure to moldy hay. Horses were kept in pastures with no additional food supplementation for 3 months prior to the study. Horses had not been medicated for at least 3 months prior to the study, and they were regularly vaccinated and dewormed.

The 2 groups of horses were stabled in the same barn during the experimental period. Horses were fed dry timothy hay and sweet feed twice each day; straw bedding was used for all horses. All stabled horses were exposed to moldy hay. All experimental procedures were performed in accordance with the guidelines of the Canadian Council on Animal Care and were approved by the Animal Care Committee of the University of Montreal.

Clinical score and pulmonary function

After the horses were exposed to moldy hay, a clinical score was assessed by 2 observers (JMV and M-PL) as described elsewhere.41 Briefly, a score from 0 to 4 was assigned for abdominal movement (0 = no abdominal movement and 4 = severe and marked abdominal movement) and nasal flaring (0 = no flaring and 4 = severe and continuous flaring). Abdominal and nasal flaring scores were added (maximum score, 8). Scores ≥ 5 indicated airway dysfunction.

Measurements of respiratory mechanics were performed as described elsewhere.42 Briefly, flow rate was measured by use of a heated pneumotachograph and associated differential pressure transducer fitted into a mask that was placed over the nose of each horse. Esophageal pressure was measured with a balloon sealed onto the end of a polyethylene catheter placed in the distal third of the esophagus. Transpulmonary pressure was determined by use of a differential pressure transducer, and the esophageal pressure was subtracted from the mask pressure. Signals of the transducers were amplified and analyzed by use of a digital-analog converter and computer equipped with data acquisition and analysis software.a Signals were sampled at a frequency of 120 Hz for 90 seconds, and all valid breaths were used for analysis. Values of pulmonary resistance and elastance were obtained for each breath by applying a multiple regression equation for a single compartment model of the lungs.

BAL

One week after horses were exposed to moldy hay, BAL was performed. Horses were sedated and maintained in a standing position. A flexible endoscope and 2 boluses (250 mL/bolus) of sterile isotonic saline (0.9% NaCl) solution were used, as described elsewhere.43 Total nucleated cells were counted with a hemacytometer. Cytocentrifugation slides were stained with a modified Wright stain, and a differential count was performed on 400 cells.

Isolation of circulating blood neutrophils

At the same time as the BAL, a blood sample (10 mL) was collected via jugular venipuncture into sterile EDTA-containing evacuated tubes.b Blood samples were stored at room temperature (20°C) until processed; all blood samples were processed within 30 minutes after collection. Circulating blood neutrophils were isolated by use of density gradient centrifugationc performed in accordance with the manufacturer's instructions. Purified circulating blood neutrophils were then suspended in RPMI 1640 medium and supplemented with normal pooled equine serum (60% RPMI 1640 and 40% normal equine serum; final concentration, 5 × 106 cells/mL). Total cell counts were determined with a hemacytometer, and viability was assessed by use of the trypan blue dyed exclusion test.

Bacterial strains and growth conditions

Two strains of pathogenic Streptococcus spp were used: S equi and S zooepidemicus. In addition, a nonencapsulated strain of Streptococcus suis (strain B218) was used as a positive control sample. Streptococcus suis B218 is a well-characterized strain that is highly susceptible to phagocytosis, and it is considered an appropriate control sample to validate a phagocytosis assay.44 Bacteria were grown overnight on sheep blood agar plates at 37°C. Isolated colonies were used as inoculum for 10 mL of Todd-Hewitt broth,e which was incubated for 16 hours at 37°C with agitation. Optimal working cultures were obtained by inoculating 0.2 mL of the S zooepidemicus overnight suspension with 9.8 mL of RPMI 1640 medium and 0.5 mL of the S equi overnight suspension with 9.5 mL of RPMI 1640 medium; cultures were incubated for 2 hours at 37°C with agitation. Streptococcus suis B218 was grown as described elsewhere.45 Logarithmic-phase bacteria were washed 3 times in PBS solution and then diluted in RPMI 1640 medium. The number of CFUs per milliliter in the final suspension was determined by plating samples onto Todd-Hewitt agar.e

Bactericidal assay

An aliquot (25 mL) containing circulating blood neutrophils at a concentration of 5 × 106 cells/mL diluted in RPMI 1640 medium and normal equine serum (60% RPMI 1640 medium and 40% normal equine serum) was mixed in microtubes with 0.25 mL of S suis B218 at 2 × 104 CFUs/mL (positive control sample) or with 0.25 mL of S equi or S zooepidemicus at 2 × 107 CFUs/mL. These microtubes were then incubated at 37°C and 5% CO2 for 90 minutes (S suis B218) or 60 minutes (S equi and S zooepidemicus). Preliminary experiments on the kinetics for killing of S suis B218, S equi, and S zooepidemicus by neutrophils revealed that killing was optimal for these experimental conditions (data not shown). After incubation with circulating blood neutrophils was completed, cells were lysed with sterile water, and viable bacterial counts were performed on Todd-Hewitt agar plates with an automated cell counter.f Tubes with bacteria alone were treated similarly and used as control samples. Results were expressed as the percentage of bacteria that were killed.

Phagocytosis determined by use of flow cytometry

Red fluorescent polystyrene beadsg (1 μm in diameter; 1010 beads/mL) were washed in PBS solution and resuspended in RPMI 1640 medium at a concentration of 2.5 × 108 beads/mL. An aliquot (0.2 mL) containing circulating blood neutrophils at a concentration of 5 × 106 cells/mL was mixed in microtubes with 0.2 mL of fluorescent beads; microtubes then were incubated at 37°C and 5% CO2 for 30 minutes. Extracellular beads were removed through 3 washes with PBS solution, and cells were resuspended in 0.4 mL of sorting buffer (PBS solution-1% fetal bovine serum). A solution of 0.2 mL of circulating blood neutrophils at a concentration of 5 × 106 cells/mL without fluorescent beads was used as a negative control sample. All incubations were performed in the dark. Flow cytometry was performed with a flow cytometer.h Data for 30,000 events were acquired and analyzed by use of software.i The percentage of circulating blood neutrophils that had ingested beads and thereby had red fluorescence was calculated.

Confocal microscopy

Neutrophils were incubated with fluorescent beads as described previously. Extracellular beads were removed through 3 washes with PBS solution, and cells were stained by incubation with an antibodyj against the surface neutrophil marker CD90 for 5 minutes at 4°C. Cells were washed 3 times in PBS solution and incubated for 5 minutes with phycoerythrin-coupled goat anti-mouse IgM antibodyk (diluted 1:500 in PBS solution). Cells were washed twice, examined with a confocal microscopel integrated into an enhanced imaging system,m and analyzed by use of imaging software.n

Neutrophil stimulation assays

An aliquot (0.5 mL) of circulating blood neutrophils at a concentration of 2 × 106 cells/mL, diluted in RPMI 1640 medium supplemented with equine serum (60% RPMI 1640 medium and 40% equine serum), was mixed in microtubes with 0.5 mL of S equi or S zooepidemicus at a concentration of 104 CFUs/mL and incubated for 4, 8, and 12 hours in an incubator at 37°C and 5% CO2. The RPMI 1640 medium and LPS from Escherichia coli O111:B4 (2 μg/mL) were used as negative and positive control samples, respectively. Gene expression for TNF-α was evaluated at 4, 8, and 12 hours, and gene expression for IL-10 and IL-8 was evaluated at 8 and 12 hours. At each time point, neutrophils were centrifuged, and the pellet was resuspended in 1 mL of reagento and frozen at −70°C for subsequent analysis.

RNA extraction and reverse transcription

Total RNA extraction from the reagent was performed in the presence of 10 μg of glycogenp in accordance with the manufacturer's instructions. The RNA pellets were air dried and suspended in RNase-DNase-free water.d The concentration and purity of RNA was evaluated with a spectrophotometer.q Two hundred nanograms of total RNA was reverse transcribed in the presence of 60 U of ribonuclease inhibitorr by use of 500 U of reverse transcriptases in accordance with the manufacturer's instructions, except that the reaction was performed in a final volume of 30 μL. Random hexamerst (225 ng) were used in addition to 500 ng of oligo(dT)12–18.p The cDNA samples were stored at −20°C.

Real-time quantitative PCR assay

The cDNA was amplified by use of a PCR amplification kitu with a real-time PCR assay detection system.v All PCR assay amplifications included an enzyme activation step of 3 minutes at 98°C, which was followed by 40 cycles of a denaturing step for 3 seconds at 98°C and an annealing-extension step for 5 seconds at 57°C. The final reaction volume was 10 μL that contained 250nM each of forward and reverse primers used to amplify the target genes (TNF-α, IL-8, IL-10, and ubiquitin; Appendix). Primer sequences for GAPDH have been published in another study.46 Ubiquitin and GAPDH were selected by use of the PCR assay detection system as the most stable genes among 4 candidates (which also included β-actin and 18S) and were used for normalization. Amplification efficiencies ranged between 94% and 109%. Differences between samples were calculated by use of the 2−ΔΔCt method. Gene expression data at each time point for each horse were expressed as the fold difference over that of results for the nonstimulated neutrophils (ie, negative control sample, which was assigned a value of 1). This quantification method helped eliminate run-to-run variations because all samples for a given time point and each horse were assayed on the same PCR assay plate. Differences in baseline gene expression (unstimulated circulating blood neutrophils in RPMI 1640 medium) were not reported.

Statistical analysis

Bactericidal and phagocytic activities of neurophils from horses with severe equine asthma and control horses were compared by use of Student t tests. The PCR assay data were logarithmically (log10) transformed to normalize distribution and included in a repeated-measures linear model; group (horses with severe equine asthma vs control horses) was used as a between-subject factor, whereas time (4, 8, and 12 hours) and stimulation (S zooepidemicus, S equi, and LPS) were used as within-subject factors. Differences for within-subject and between-subject factors were further evaluated by use of a priori contrasts with sequential Bonferroni correction for multiple testing. Statistical softwarew was used for the analysis. Results were expressed as mean ± SD or mean ± SEM. Differences between groups were considered significant at P ≤ 0.05. Other differences were considered significant at P < 0.01.

Results

Animals

The 6 horses with severe equine asthma (5 mares and 1 gelding) had a mean ± SD body weight of 487.8 ± 38.8 kg, whereas the control horses (5 mares and 1 gelding) had a mean body weight of 486.2 ± 14.3 kg. Horses with severe equine asthma were significantly (P = 0.02) older (21.0 ± 3.0 years) than control horses (15.6 ± 3.4 years).

Clinical evaluation of horses

Horses with severe equine asthma had clinical exacerbation of the disease as indicated by high values for pressure decrease per unit length, pulmonary resistance, and elastance, whereas lung function of the control horses remained within reference limits (Figure 1). Mean ± SD percentage of neutrophils in BAL fluid was significantly (P < 0.001) higher in horses with severe equine asthma (37.2 ± 3.7%) than in control horses (12.3 ± 6.1%).

Figure 1—
Figure 1—

Mean ± SD values for clinical score (A), percentage of neutrophils in BAL fluid (B), pulmonary resistance (C), pulmonary elastance (D), and transpulmonary pressure (E) for 6 control horses (white bars) and 6 horses with severe equine asthma (black bars) at 1 week after challenge exposure with moldy hay. Clinical score was assigned by use of a scale from 0 to 4 for abdominal movement (0 = no abdominal movement and 4 = severe and marked abdominal movement) and nasal flaring (0 = no flaring and 4 = severe and continuous flaring); abdominal and nasal flaring scores were added (maximum score, 8). *Value differs significantly (P < 0.05) from the value for the control horses.

Citation: American Journal of Veterinary Research 79, 4; 10.2460/ajvr.79.4.455

Isolation of circulating blood neutrophils

Purity of the neutrophils isolated from blood samples was > 99%. Viability of the isolated neutrophils was > 98%.

Bactericidal activity of circulating blood neutrophils against S equi and S zooepidemicus

Circulating blood neutrophils in severely asthmatic horses had significantly (P = 0.046) lower bactericidal activity (mean ± SD, 8.5 ± 10.6%) against S zooepidemicus than did control horses (36.5 ± 25.8%; Figure 2). Bactericidal activity against S equi for neutrophils from horses with severe equine asthma (7.3 ± 11.8%) did not differ significantly (P = 0.10) from that of neutrophils from control horses (23.7 ± 17.8%). Bactericidal activity of neutrophils against S suis (positive control sample) did not differ significantly (P = 0.68) between groups of horses (horses with severe equine asthma, 95.6 ± 3.9%; control horses, 94.3 ± 6.6%).

Figure 2—
Figure 2—

Mean ± SD values for the ability of neutrophils obtained from 6 control horses (white bars) and 6 horses with severe equine asthma (black bars) to kill Streptococcus zooepidemicus (A), Streptococcus equi (B), and Streptococcus suis strain B218 (C), which was a nonencapsulated mutant strain used as a positive control sample. Bacteria were mixed with neutrophils suspended in RPMI 1640 medium and pooled equine serum (60% RPMI 1640 medium and 40% equine serum) and incubated for 60 minutes (S equi and S zooepidemicus) or 90 minutes (S suis B218). See Figure 1 for remainder of key

Citation: American Journal of Veterinary Research 79, 4; 10.2460/ajvr.79.4.455

Phagocytosis capacity of circulating blood neutrophils

No significant (P = 0.91) differences were observed in the phagocytic activity of circulating blood neutrophils from severely asthmatic horses and healthy control horses (Figure 3). In addition, the number of phagocytosed fluorescent beads per neutrophil, as determined by use of confocal microscopy, was similar between groups (Figure 4).

Figure 3—
Figure 3—

Mean ± SD values for flow cytometry assay of phagocytosis of fluorescent polystyrene beads by neutrophils from 6 control horses (white bar) and 6 horses with severe equine asthma (black bar). Results are the percentage of neutrophils with associated fluorescent beads.

Citation: American Journal of Veterinary Research 79, 4; 10.2460/ajvr.79.4.455

Figure 4—
Figure 4—

Confocal microscopic image of equine neutrophils representing phagocytosis of fluorescent polystyrene beads (red) by circulating neutrophils marked with a primary antibody (anti-CD90) and a fluorescent secondary antibody (anti-mouse IgM-fluorescein isothiocyanate; green). Bar = 15 μm.

Citation: American Journal of Veterinary Research 79, 4; 10.2460/ajvr.79.4.455

Gene expression induced in circulating blood neutrophils by S equi and S zooepidemicus

Expression of TNF-α and IL-8 by circulating blood neutrophils was significantly (P < 0.001) upregulated by both bacteria. However, there was no effect of the disease on gene expression by neutrophils, as indicated by the lack of significant (all P > 0.27) effects for group, the group-by-time interaction, and the group-by-stimulation interaction. Mean ± SEM fold increase for TNF-α expression by S zooepidemicus-stimulated circulating blood neutrophils of control horses was approximately half that of horses with severe equine asthma at 4 (6.43 ± 1.52 and 11.91 ± 3.67, respectively) and 8 (12.16 ± 4.76 and 25.42 ± 4.76, respectively) hours; however, this difference was not significant. Expression of IL-8 was significantly (P < 0.001) higher for S zooepidemicus stimulation of circulating blood neutrophils than for S equi or LPS stimulation of circulating blood neutrophils after 8 hours, whereas both S zooepidemicus and S equi induced significantly (P = 0.002) higher IL-8 expression than did LPS after 12 hours. In contrast, all stimuli had a similar effect on IL-10 expression (Figure 5).

Figure 5—
Figure 5—

Gene expression of TNF-α (A through C), IL-8 (D through F), and IL-10 (G through I) induced in circulating blood neutrophils obtained from 6 control horses (white circles) and 6 horses with severe equine asthma (black circles) and stimulated by incubation with S zooepidemicus (104 CFUs/mL; A, D, and G), S equi (104 CFUs/mL; B, E, and H), or LPS (2 μg/mL; C, F, and 1) for up to 12 hours. Results were obtained by use of a real-time quantitative PCR assay and represent the fold increase (as calculated by use of the 2−ΔΔCt method) over that of unstimulated neutrophils (ie, negative control sample, which was assigned a value of I for each horse at each time point). Ubiquitin and GAPDH were used as reference genes to normalize gene expression. Notice that the scale on the y-axis for IL-8 (panels D through F) differs from the scale on the y-axis for TNF-α and IL-10. *Value differs significantly (P < 0.01) from the value for LPS stimulation at the same time point. †Value differs significantly different (P < 0.01) from the value for S equi stimulation at the same time point.

Citation: American Journal of Veterinary Research 79, 4; 10.2460/ajvr.79.4.455

Discussion

Circulating blood neutrophils of horses with severe equine asthma are activated, compared with results for those of healthy horses.30 However, it is unknown whether the disease affects the phagocytic or bactericidal activity (or both) of circulating blood neutrophils. Results of the study reported here indicated that the bactericidal activity of circulating blood neutrophils against S zooepidemicus, but not against S equi, was lower in severely asthmatic horses. This difference between the 2 bacteria can be explained by an inability of neutrophils to internalize or destroy S equi. Partial failure of neutrophils to phagocytose and kill S equi appears to be attributable to several morphological characteristics of S equi, including a combination of the hyaluronic acid capsule, antiphagocytic scanning electron microscopy protein, M-protein, and other undetermined antiphagocytic factors released by the bacteria. Virulent isolates of S equi from horses with strangles typically are highly encapsulated, whereas nonencapsulated mutants are much less virulent.47 The antiphagocytic capsule greatly reduces the number of streptococci that become associated with the surface of neutrophils and that subsequently are ingested and killed.

A decrease of killing activity against Candida spp by polymorphonuclear neutrophilic leukocytes was observed in humans with asthma and was believed to contribute to an increased susceptibility to infection in these patients.12 Circulating blood neutrophils of humans with bronchiectasis also reportedly have a reduced ability to kill S aureus, compared with the ability for those of healthy control subjects.13 Results of the present study suggested that the reduced killing capacity of circulating blood neutrophils could promote bacterial colonization and secondary infections in horses with severe equine asthma. Although overwhelming bacterial bronchopneumonia is uncommon in horses with severe equine asthma, there are anecdotal reports of pulmonary infectious diseases in severely asthmatic horses. Investigators of 1 study11 reported that pulmonary chlamydial infections with inflammation were more frequent in horses with severe equine asthma than in control horses. In another study,10 investigators described 3 severely asthmatic horses with bronchiectasis. This irreversible destruction of the airway architecture leads to localized or diffuse chronic dilatation, impaired mucociliary clearance, bacterial colonization, and recurrent infection. In addition, a strong association between isolation of S zooepidemicus, Streptococcus pneumoniae, Actinobacillus spp, Pasteurella spp, and Mycoplasma equirhinis from tracheal wash solution and the presence of inflammatory airway disease has been reported.48,49 However, whether these bacteria play an important role in the pathogenesis of inflammatory airway disease has not yet been determined.

In the study reported here, the impaired bactericidal capacity detected in horses with severe equine asthma was likely unrelated to a reduced number of internalized bacteria because there was no difference in the phagocytic activity between neutrophils from severely asthmatic and control horses as determined by use of flow cytometry and confocal microscopy. These results support the findings that the phagocytic activity against S aureus or yeast cells is unaffected in horses with severe equine asthma.9,23 A similar discrepancy between neutrophil function and phagocytosis was reported in humans with asthma and bronchial bacterial infection, whereby random migration, nitroblue tetrazolium dye reduction, and Candida spp killing activity were markedly decreased in polymorphonuclear neutrophilic leukocytes; however, phagocytosis was unaffected in both groups of patients in that report.12 Phagocytosis is triggered by the binding of opsonized bacteria through opsonin or nonspecific glycosylated receptors that recognize certain lectins on target bacteria. Two bactericidal processes are activated concomitantly with phagocytosis: the oxidative burst (production of cytotoxic reactive oxygen species and reactive nitrogen species) and the degranulation and release of contents of azurophilic and specific granules into the phagosome. Extracellular bactericidal activities have also been described for neutrophils.50 Intracellular or extracellular (or both) bactericidal mechanisms affected by severe equine asthma warrant further investigation. Moreover, modulation of the innate immune response is another important component of neutrophil function.51,52

Horses with severe equine asthma were significantly older than control horses of the present study. It is highly unlikely that this difference impacted results of this study because age-related changes of the immune system primarily impact adaptive immunity. In healthy aged horses, quantity of circulating neutrophils,53 ability of neutrophils to adhere, oxidative burst, and phagocytosis are all unchanged,54 compared with results for younger adult horses. An age-related increase in gene expression of proinflammatory cytokines produced by peripheral blood mononuclear cells has been reported, but it is unclear how an age-associated imbalance in cytokines may influence neutrophil activity.

Pulmonary neutrophilia (> 5%) was also evident for the BAL samples of control horses of the present study. This finding is not unusual for healthy horses and may be the result of stabling in a dusty environment.55,56 However, this effect is less common in healthy horses than in horses with severe equine asthma and usually resolves despite continuous exposure to stable dust. Different inflammatory pathways likely contribute to the recruitment of inflammatory cells in the 2 groups because healthy horses with airway neutrophilia do not develop altered lung function after antigenic exposure,41 which is in contrast to the effects in horses with severe equine asthma.

In the present study, blood samples were collected 1 week after horses were exposed to moldy hay. This allowed a sufficient interval for horses with severe equine asthma to develop clinical signs and stabilize airway obstruction. The timing selected for blood collection should be taken into consideration when evaluating neutrophil expression data. Investigators of 1 study4 detected priming of equine circulating blood neutrophils in addition to transient neutrophilic leukocytosis 24 hours after challenge exposure to hay or straw, with results returning to preexposure values within 4 days after cessation of exposure. For the study reported here, we assumed that neutrophil cytokine expression 1 week after antigen exposure would be sufficiently stable to allow evaluation.

Ex vivo production of proinflammatory (IL-8 and TNF-α) and anti-inflammatory (IL-10) cytokines by circulating blood neutrophils in response to various Streptococcus spp was compared between control horses and severely asthmatic horses. Equine neutrophils are capable of expressing an array of proinflammatory and chemoattractant cytokines. In the present study, we selected a representative inflammatory cytokine involved in bacterial sepsis and inflammatory diseases (TNF-α) and a potent chemokine for neutrophils (IL-8, which is also produced by these cells). Finally, because equine asthma may induce modulation of neutrophil function, a regulatory cytokine (IL-10) was also evaluated. As determined by use of the assay conditions for the present study, ex vivo mRNA expression of these cytokines by circulating blood neutrophils was not significantly increased in horses with clinical exacerbation of severe equine asthma. Similarly, no significant differences in the concentrations of proinflammatory cytokines (TNF-α) and chemokines (IL-8) produced by circulating blood neutrophils in horses with severe equine asthma and control horses were detected after 5 hours of an antigenic challenge in another study.29 Also, the serum IL-10 concentration is not significantly different between control and horses with severe equine asthma at 7 and 10 days after antigenic challenge.57 In another study,30 investigators reported ex vivo overexpression of TNF-α for circulating blood neutrophils (which were obtained from severely asthmatic horses that did not have clinical signs of the disease) stimulated by microbial products (LPS) for 5 hours. A possible explanation for this difference could be that in severely asthmatic horses without clinical signs of the disease, circulating blood neutrophils are already maximally upregulated by exposure to microbial products (bacteria). Considering that there is variable expression of cytokines and chemokines in the first hours of antigenic or LPS-bacterial stimulation in vivo and ex vivo, it is difficult to determine the role of these cytokines and chemokines in the early phases of recruitment and activation of inflammatory cells involved in the pathogenesis of severe equine asthma.

For the study reported here, the bactericidal capacities of circulating neutrophils against S zooepidemicus were lower in horses with severe equine asthma than in control horses, although phagocytosis and mRNA expression of TNF-α, IL-8, or IL-10 were unaltered. Reduced bactericidal capacities of circulating blood neutrophils against S zooepidemicus could potentially contribute to the development of secondary infections in severely asthmatic horses.

Acknowledgments

Supported by Fonds du centenaire and Pfizer Animal Health.

The authors declare there were no conflicts of interest.

Presented as an abstract at the Annual Congress of the American College of Veterinary Internal Medicine-Large Animals, Denver, June 2011.

The authors thank Guy Beauchamp for assistance with the statistical analysis and Mathieu Houde for technical assistance.

ABBREVIATIONS

BAL

Bronchoalveolar lavage

GAPDH

Glyceraldehyde-3-phosphate dehydrogenase

IL

Interleukin

LPS

Lipopolysaccharide

TNF

Tumor necrosis factor

Footnotes

a.

RHT-Infodat, RHT-INFODAT INC, Brossard, QC, Canada.

b.

Vacutainer, Becton Dickinson, Mississauga, ON, Canada.

c.

Lympholyte-poly, Cedarlane Laboratories, Burlington, ON, Canada.

d.

Gibco, Ottawa, ON, Canada.

e.

Difco Laboratories, Detroit, Mich.

f.

Autoplate 400, Spiral Biotech, Norwood, Mass.

g.

FluoSphere, Invitrogen, Eugene, Ore.

h.

FACSCalibur, BD Biosciences, San Jose, Calif.

i.

CellQuest Pro, BD Biosciences, San Jose, Calif.

j.

Clone DH24A, VMRD Inc, Pullman, Wash.

k.

STAR86F, Serotec, Raleigh, NC.

l.

IX-80 confocal microscope, Olympus, Markham, ON, Canada.

m.

FV1000 imagery system, Olympus, Markham, ON, Canada.

n.

FluoView, Olympus, Markham, ON, Canada.

o.

TRIzol, Invitrogen, Eugene, Ore.

p.

Invitrogen, Eugene, Ore.

q.

Nanodrop1000, Thermo Scientific, Wilmington, Del.

r.

RNasin, Promega Corp, Madison, Wis.

s.

Superscript III, Thermo Scientific, Ottawa, ON, Canada.

t.

Applied Biosystem, Invitrogen, Eugene, Ore.

u.

SsoFast EvaGreen Supermix, Bio-Rad Laboratories, Hercules, Calif.

v.

Bio-Rad CFX-96, Bio-Rad Laboratories, Hercules, Calif.

w.

SAS, version 9.2, SAS Institute Inc, Cary, NC.

References

  • 1. Leclere M, Lavoie-Lamoureux A, Lavoie JP. Heaves, an asthma-like disease of horses. Respirology 2011;16:10271046.

  • 2. Fairbairn SM, Page CP, Lees P, et al. Early neutrophil but not eosinophil or platelet recruitment to the lungs of allergic horses following antigen exposure. Clin Exp Allergy 1993;23:821828.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 3. Marr KA, Foster AP, Lees P, et al. Effect of antigen challenge on the activation of peripheral bloodneutrophils from horses with chronic obstructive pulmonary disease. Res Vet Sci 1997;62:253260.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 4. Brazil TJ, Dagleish MP, McGorum BC, et al. Kinetics of pulmonary neutrophil recruitment and clearance in a natural and spontaneously resolving model of airway inflammation. Clin Exp Allergy 2005;35:854865.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 5. Lavoie-Lamoureux A, Moran K, Beauchamp G, et al. IL-4 activates equine neutrophils and induces a mixed inflammatory cytokine expression profile with enhanced neutrophil chemotactic mediator release ex vivo. Am J Physiol Lung Cell Mol Physiol 2010;299:L472L482.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 6. Smith JA. Neutrophils, host defense, and inflammation: a double-edged sword. J Leukoc Biol 1994;56:672686.

  • 7. Grandguillot L, Fairbrother JM, Vrins A. Use of a protected catheter brush for culture of the lower respiratory tract in horses with small airway disease. Can J Vet Res 1991;55:5055.

    • Search Google Scholar
    • Export Citation
  • 8. Mansmann RA, Strouss AA. Evaluation of transtracheal aspiration in the horse. J Am Vet Med Assoc 1976;169:631633.

  • 9. Nuytten J, Muylle E, Oyaert W, et al. Cytology, bacteriology and phagocytic capacity of tracheo-bronchial aspirates in healthy horses and horses with chronic obstructive pulmonary disease (COPD). Zentralbl Veterinarmed A 1983;30:114120.

    • Search Google Scholar
    • Export Citation
  • 10. Lavoie JP, Dalle S, Breton L, et al. Bronchiectasis in three adult horses with heaves. J Vet Intern Med 2004;18:757760.

  • 11. Theegarten D, Sachse K, Mentrup B, et al. Chlamydophila spp. infection in horses with recurrent airway obstruction: similarities to human chronic obstructive disease. Respir Res 2008;9:1422.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 12. Laharrague P, Corberand J, Fillola G, et al. Polymorphonuclear dysfunction in bronchopulmonary diseases in human adults. J Clin Lab Immunol 1985;17:2124.

    • Search Google Scholar
    • Export Citation
  • 13. King P, Bennett-Wood V, Hutchinson P, et al. Bactericidal activity of neutrophils with reduced oxidative burst from adults with bronchiectasis. APMIS 2009;117:133139.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 14. Picavet T. Clinical approach to the coughing horse, in Proceedings. Voorjaarsdagen 2007;236237.

  • 15. Magnusson U, Jonsson K. A method for the accurate measurement of opsonic activity in uterine secretions of the mare. Theriogenology 1991;36:737747.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 16. Jacobsen K, Gintz T, Reed SM, et al. Isolation of equine neutrophils and analysis of functional characteristics by chemiluminescence and bacterial assays. Am J Vet Res 1982;43:19121916.

    • Search Google Scholar
    • Export Citation
  • 17. Martens RJ, Martens JG, Renshaw HW, et al. Rhodococcus equi: equine neutrophil chemiluminescent and bactericidal responses to opsonizing antibody. Vet Microbiol 1987;14:277286.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 18. Leblanc MM, Pritchard EL. Effects of bovine colostrum, foal serum immunoglobulin concentration and intravenous plasma transfusion on chemiluminescence response of foal neutrophils. Anim Genet 1988;19:435445.

    • Search Google Scholar
    • Export Citation
  • 19. Takai S, Morozumi Y, Higashiyama S, et al. Nitroblue tetrazolium reduction by neutrophils of newborn foals, adult horses, and a foal infected with Rhodococcus (Corynebacterium) equi. Nippon Juigaku Zasshi 1986;48:405408.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 20. Yager JA, Foster SF, Zink MC, et al. In vitro bactericidal efficacy of equine polymorphonuclear leukocytes against Corynebacterium equi. Am J Vet Res 1986;47:438440.

    • Search Google Scholar
    • Export Citation
  • 21. Watson ED. Opsonins in uterine washings influencing in vitro activity of equine neutrophils. Equine Vet J 1988;20:435437.

  • 22. Bernoco M, Liu IK, Wuest-Ehlert CJ, et al. Chemotactic and phagocytic function of peripheral blood polymorphonuclear leucocytes in newborn foals. J Reprod Fertil Suppl 1987;35:599605.

    • Search Google Scholar
    • Export Citation
  • 23. Klucinski W, Winnicka A, Olszewski M, et al. Phagocytic activity of polymorphonuclear leukocytes lavaged from the lungs of horses with clinically diagnosed chronic pulmonary disease. Zentralbl Veterinarmed A 1994;41:558567.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 24. Foerster RJ, Wolf G. Phagocytosis of opsonized fluorescent microspheres by equine polymorphonuclear leukocytes. Zentralbl Veterinarmed B 1990;37:481490.

    • Search Google Scholar
    • Export Citation
  • 25. Johannisson A, Grondahl G, Demmers S, et al. Flow-cytometric studies of the phagocytic capacities of equine neutrophils. Acta Vet Scand 1995;36:553562.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 26. Raidal SL, Bailey GD, Love DN. The flow cytometric evaluation of phagocytosis by equine peripheral blood neutrophils and pulmonary alveolar macrophages. Vet J 1998;156:107116.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 27. McTaggart C, Yovich JV, Penhale J, et al. A comparison of foal and adult horse neutrophil function using flow cytometric techniques. Res Vet Sci 2001;71:7379.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 28. Joubert P, Silversides DW, Lavoie JP. Equine neutrophils express mRNA for tumour necrosis factor-alpha, interleukin (IL)-1beta, IL-6, IL-8, macrophage-inflammatory-protein-2 but not for IL-4, IL-5 and interferon-gamma. Equine Vet J 2001;33:730733.

    • Search Google Scholar
    • Export Citation
  • 29. Joubert P, Cordeau ME, Boyer A, et al. Cytokine expression by peripheral blood neutrophils from heaves-affected horses before and after allergen challenge. Vet J 2008;178:227232.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 30. Lavoie-Lamoureux A, Beauchamp G, Quessy S, et al. Systemic inflammation and priming of peripheral blood leukocytes persist during clinical remission in horses with heaves. Vet Immunol Immunopathol 2012;146:3545.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 31. Riihimaki M, Raine A, Pourazar J, et al. Epithelial expression of mRNA and protein for IL-6, IL-10 and TNF-alpha in endobronchial biopsies in horses with recurrent airway obstruction. BMC Vet Res 2008;4:815.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 32. Laan TT, Bull S, Pirie R, et al. The role of alveolar macrophages in the pathogenesis of recurrent airway obstruction in horses. J Vet Intern Med 2006;20:167174.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 33. Horohov DW, Beadle RE, Mouch S, et al. Temporal regulation of cytokine mRNA expression in equine recurrent airway obstruction. Vet Immunol Immunopathol 2005;108:237245.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 34. Ainsworth DM, Grunig G, Matychak MB, et al. Recurrent airway obstruction (RAO) in horses is characterized by IFN-gamma and IL-8 production in bronchoalveolar lavage cells. Vet Immunol Immunopathol 2003;96:8391.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 35. Giguere S, Viel L, Lee E, et al. Cytokine induction in pulmonary airways of horses with heaves and effect of therapy with inhaled fluticasone propionate. Vet Immunol Immunopathol 2002;85:147158.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 36. Padoan E, Ferraresso S, Pegolo S, et al. Real time RT-PCR analysis of inflammatory mediator expression in recurrent airway obstruction-affected horses. Vet Immunol Immunopathol 2013;156:190199.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 37. Lavoie JP, Maghni K, Desnoyers M, et al. Neutrophilic airway inflammation in horses with heaves is characterized by a Th2-type cytokine profile. Am J Respir Crit Care Med 2001;164:14101413.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 38. Lancefield RC, Perlmann GE. Preparation and properties of type-specific M antigen isolated from a group A, type 1 hemolytic Streptococcus. J Exp Med 1952;96:7182.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 39. Erol E, Locke SJ, Donahoe JK, et al. Beta-hemolytic Streptococcus spp. from horses: a retrospective study (2000–2010). J Vet Diagn Invest 2012;24:142147.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 40. Timoney JF. Strangles. Vet Clin North Am Equine Pract 1993;9:365374.

  • 41. Robinson NE, Olszewski MA, Boehler D, et al. Relationship between clinical signs and lung function in horses with recurrent airway obstruction (heaves) during a bronchodilator trial. Equine Vet J 2000;32:393400.

    • Search Google Scholar
    • Export Citation
  • 42. Jean D, Vrins A, Lavoie JP. Monthly, daily, and circadian variations of measurements of pulmonary mechanics in horses with chronic obstructive pulmonary disease. Am J Vet Res 1999;60:13411346.

    • Search Google Scholar
    • Export Citation
  • 43. Lapointe JM, Lavoie JP, Vrins AA. Effects of triamcinolone acetonide on pulmonary function and bronchoalveolar lavage cytologic features in horses with chronic obstructive pulmonary disease. Am J Vet Res 1993;54:13101316.

    • Search Google Scholar
    • Export Citation
  • 44. Charland N, Harel J, Kobisch M, et al. Streptococcus suis serotype 2 mutants deficient in capsular expression. Microbiology 1998;144:325332.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 45. Chabot-Roy G, Willson P, Segura M, et al. Phagocytosis and killing of Streptococcus suis by porcine neutrophils. Microb Pathog 2006;41:2132.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 46. Leutenegger CM, von Rechenberg B, Huder JB, et al. Quantitative real-time PCR for equine cytokine mRNA in nondecalcified bone tissue embedded in methyl methacrylate. Calcif Tissue Int 1999;65:378383.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 47. Anzai T, Timoney JF, Kuwamoto Y, et al. In vivo pathogenicity and resistance to phagocytosis of Streptococcus equi strains with different levels of capsule expression. Vet Microbiol 1999;67:277286.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 48. Wood JL, Newton JR, Chanter N, et al. Association between respiratory disease and bacterial and viral infections in British racehorses. J Clin Microbiol 2005;43:120126.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 49. Wood JL, Newton JR, Chanter N, et al. Inflammatory airway disease, nasal discharge and respiratory infections in young British racehorses. Equine Vet J 2005;37:236242.

    • Search Google Scholar
    • Export Citation
  • 50. Brinkmann V, Reichard U, Goosmann C, et al. Neutrophil extracellular traps kill bacteria. Science 2004;303:15321535.

  • 51. Witko-Sarsat V, Rieu P, Descamps-Latscha B, et al. Neutrophils: molecules, functions and pathophysiological aspects. Lab Invest 2000;80:617653.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 52. Dagleish MP, Pemberton AD, Brazil TJ, et al. Kinetics of equine neutrophil elastase release and superoxide anion generation following secretagogue activation: a potential mechanism for antiproteinase inactivation. Vet Immunol Immunopathol 1999;72:257275.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 53. McFarlane D, Sellon DC, Gaffney D, et al. Hematologic and serum biochemical variables and plasma corticotropin concentration in healthy aged horses. Am J Vet Res 1998;59:12471251.

    • Search Google Scholar
    • Export Citation
  • 54. McFarlane D, Hill K, Anton J. Neutrophil function in healthy aged horses and horses with pituitary dysfunction. Vet Immunol Immunopathol 2015; 165:99106.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 55. Tremblay GM, Ferland C, Lapointe JM, et al. Effect of stabling on bronchoalveolar cells obtained from normal and COPD horses. Equine Vet J 1993;25:194197.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 56. Leclere M, Lavoie-Lamoureux A, Gelinas-Lymburner E, et al. Effect of antigenic exposure on airway smooth muscle remodeling in an equine model of chronic asthma. Am J Respir Cell Mol Biol 2011;45:181187.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 57. Lavoie-Lamoureux A, Leclere M, Lemos K, et al. Markers of systemic inflammation in horses with heaves. J Vet Intern Med 2012;26:14191426.

    • Crossref
    • Search Google Scholar
    • Export Citation

Appendix

Primers used in a real-time PCR assay for the quantification of cytokines expressed by equine neutrophils.

GeneForward primerReverse primerAmplicon size (bp)
GAPDHAAGTGGATATTGTCGCCATCAATAACTTGCCATGGGTGGAATC88
IL-10GCTGAGAACCACGGCCCAGACACAGGGCAGAAATCGATGACAGCG105
IL-8TGGGCCACACTGCGAAAACTCAATGGATTTTGCCCCTCAGCTCTCT134
TNF-αAAGTGACAAGCCTGTAGCCCATGTATGAGGTACAGCCCATCCAATGGT150
UbiquitinAGATGGCCGCACTCTTTCCGATTAATCCTGGATCTTGGCCTTGACGTT172

Contributor Notes

Address correspondence to Dr. Jean (daniel.jean@umontreal.ca).