Chicken macrophages are the most potent antigen-presenting cells capable of resistance to exogenous pathogenic microorganisms.1–6 Macrophages differentiate via classic or alternative pathways into 2 functional types: M1 or M2.7 Activated macrophages are critical antigen-presenting cells. The M1 type is activated by Th1 cells and can kill bacteria,8 viruses,9 and parasites.10 The M2 type is stimulated by cytokines10–12 secreted by Th2 cells and plays a role in tissue repair, immune regulation, and antitumor activity.13 The balance between M1 and M2 polarization influences immune responses in animals and is involved in some neurogenic diseases11 because both macrophage phenotypes have different roles in the development of disease.14 Moreover, polarization of M1 and M2 is dependent on several main factors, such as receptor-interacting protein 140,12 chemerin15 (which induces alternatively activated polarization of M2 macrophages and consequently suppresses inflammation),15 and sorafenib, which alters macrophage polarization and inhibits macrophage activation in vivo.13
Mouse macrophages can be induced to polarize when cultured in vitro with cytokines M-CSF or GM-CSF.16,17 The L929 cells secrete those cytokines; therefore, the cell supernatant can be used as the cytokine CSF in the medium to incubate macrophages.18,19 Macrophages can also be activated by Th1 cytokines to promote differentiation into M1, whereas Th2 cytokines trigger the alternative M2 phenotype.7,14,16,20 However, LPS is a stimulus that induces macrophages to express the M1 phenotype.21,22 There are differences in the cytokines secreted by the activated M1 or M2 phenotypes.23 All M1 and M2 cells express the surface marker CD11b gene,24,25 which is an important marker for macrophage identification.17 Moreover, activated macrophages also express the MHC, which is an important immune molecule that has a role in presenting endogenous and exogenous antigens.26 The MHC class I and II molecules are referred to as B-F and B-L, respectively, in chickens.27 Expression of MHC genes in macrophages is influenced by some cytokines.25–29
Macrophages have been extensively studied in several mammalian species and in zebrafish,30 but little attention has been given to the study of avian macrophages. Therefore, the purpose of the study reported here was to evaluate biological characteristics of chicken macrophages, including isolation, activation, and expression of immune-related genes, during polarization.
Materials and Methods
Animals
Five 15-day-old chickens were obtained from a breeding farm in Anhui Province. Two female BALB/c mice (10 weeks old) were obtained from the Animal Center of Anhui Medicine University; mice were bred under specific pathogen-free conditions at the facility. Experimental procedures were performed in accordance with the Anhui Medicine University animal care guidelines.
Preparation of L929M-CSF and HD-11M-CSF cells
Cells of a murine fibroblastic cell line (L929 cells)31 or chicken myelomonocytic cell line (HD11 cells)32,33 were seeded at 2 × 106 cells/mL onto 6-well tissue culture plates at 37°C and incubated in RPMI 1640 mediuma supplemented with 10% fetal bovine serum,b 100 U of penicillin/mL, and 0.1 mg of streptomycin/mL at 5% CO2 for 3 to 5 days. Culture supernatant was collected as cell-conditioned medium (L929M-CSF or HD-11M-CSF medium), which was used for the culture of chicken macrophages.
Isolation and culture of chicken macrophages derived from peripheral blood and bone marrow
Each 15-day-old chicken was anesthetized, and a blood sample (5 mL) was collected via cardiac puncture into a sterile tube containing 1 mL of anticoagulant (4% sodium citrate buffer). Lymphocytes were isolated by the use of chicken lymphocyte separation medium.c The chickens were euthanized via a method listed in the AVMA Guidelines for the Euthanasia of Animals,34 and femurs and tibias were harvested. Bone marrow cells of the femurs and tibias were collected by repeated aspiration with sterile PBS solution. Bone marrow cells were seeded at 2 × 106 cells/mL onto 6-well tissue culture plates. Cells were allocated into 3 wells: cells in the first well were cultured in medium containing 30% HD-11M-CSF, cells in the second well were cultured in medium containing 30% L929M-CSF, and cells in the third well were cultured in RPMI 1640 medium (control medium). Cells were cultured at 37°C and 5% CO2 for 5 to 7 days to allow differentiation of chicken macrophages; culture medium was then replaced with the corresponding condition medium containing 30% HD-11M-CSF, 30% L929M-CSF, or RPMI 1640 medium every day.
Examination of morphological features of macrophages
After macrophages were cultured with HD-11M-CSF or L929M-CSF for 5 days, the cells were washed 3 times with PBS solution and subsequently removed. Then 500 μL of Hoechst 33258 nuclear staind (5 μg/mL) was added to the cells, and cells were incubated for 10 minutes at approximately 22°C. Cells were washed with double-distilled H2O to remove excess dye and examined with a fluorescence microscopee by use of a 40× lens (excitation, 470 to 495 nm).
Examination of macrophage phagocytic function and stimulation with LPS or mouse erythrocytes
Each mouse was anesthetized, and a blood sample (1 mL) was collected via cardiac puncture into a sterile tube containing 0.2 mL of anticoagulant (4% sodium citrate buffer). Cells were washed with sterile PBS solution, and the mouse RBC suspension was added to the culture wells in which chicken macrophages had been cultured in the presence of HD-11M-CSF or L929M-CSF for 5 days; wells were incubated at 37°C and 5% CO2 for 1 to 3 hours. Then 1 mL of Wright stainf and 2 mL of PBS solution were added to each well. Wells were incubated for an additional 10 minutes, and cells then were washed 3 times with PBS solution and examined with a light microscope. Mature macrophages were stimulated by incubation with LPS or mouse erythrocytes for 24 hours, and nonstimulated cultured cells served as a control sample.
RNA extraction and cDNA generation
Macrophage RNA was extracted with an extraction reagentg used in accordance with the manufacturer's protocol. Briefly, cultured and control cells were lysed in 1 mL of guanidinium thiocyanate–phenol-chloroform reagent,h and 0.2 mL of chloroform was added to each sample. Samples were then centrifuged at 12,000 × g at 4°C for 15 minutes. The RNA in the aqueous phase was precipitated by the addition of 0.5 mL of isopropyl alcohol; centrifugation was performed at 12,000 × g at 4°C for 15 minutes, and the pellets were washed with 75% ethanol. Total RNA was incubated with RNase inhibitori at 37°C for 30 minutes and then extracted 3 times with a solution of phenol:chloroform:isopentanol (25:24:1). Reverse transcription was performed with a cDNA synthesis kit.j
Cloning of the CD11b gene with a PCR assay
Primers were designed by use of softwarek,l; primers were designed on the basis of known sequences for CD11b from other species (Mus musculus, GenBank accession No. NM_008401; Homo sapiens, GenBank accession No. BC099660; Bos taurus, GenBank accession No. NM_001039957; Rattus norvegicus, GenBank accession No. NM_012711; and Sus scrofa, GenBank accession No. JF709973). The PCR assay was performed at a volume of 50 μL, with 1 μL (20μM) each of forward and reverse primer, 2.5 ng of template cDNA, 4 μL (0.25mL) of deoxyribonucleotide triphosphates, 0.25 μL (5 U) of DNA polymerase,m and 5 μL of 10× PCR assay reaction buffer. The PCR assay was performed by use of DNA polymerasen and the following conditions: 30 cycles of denaturation for 10 seconds at 98°C, annealing for 30 seconds at 58°C, extension for 8 minutes at 72°C, and a final step for 10 minutes at 72°C. Products were electrophoresed for isolation in a 1.0% agarose gel by use of a DNA gel extraction kit.o Resulting PCR assay fragments were directionally inserted into vector pMD18-Tp to yield the PMD18-T/CD11b plasmid and sequencing.q The clone sequence of this chicken CD11b gene was deposited into a nucleotide sequence database (GenBank accession No. KT337505).
Relative transcription of BF, BL, and macrophage-related cytokine genes by qRT-PCR assay
Relative quantities for transcription of BF and BL genes, Ii chaperone genes (Ii1 and Ii2), genes of M1-distinctive cytokines (IL-2, IL-6, IL-12, iNOS, and TNF-α), and genes of M2-distinctive cytokines (TGF-β and IL-10) were detected by use of a qRT-PCR assay performed on a real-time system.r Gene-specific primers were designed by use of softwares to amplify PCR assay products of 80 to 250 bp (Appendix). Each reaction contained 10 μL of Taq mix,t 1 μL (80 ng) of diluted cDNA sample, and 0.4 μL (10μM) of gene-specific primers in a final volume of 20 μL. Thermal cycling conditions were 3 minutes at 95°C, and 40 cycles of 40 seconds at 94°C, 15 seconds at 62°C (extension phase), and 45 seconds at 72°C. Measurements were obtained at the end of the extension phase. Three replicates were performed for each gene. The gene for GAPDH was used as an internal control sample. Quantity of relative transcription was calculated as 2−ΔΔct.35
Statistical analysis
Gene transcription data were compared with a 1-way ANOVA by use of a statistical program.u Significance was defined as values of P < 0.05.
Results
Morphological characteristics and physiologic function of chicken macrophages
Chicken macrophages derived from peripheral blood and bone marrow were cultured in medium containing cytokines. After cells were cultured with HD-11M-CSF medium for 3 days, mature macrophages were large, and vacuoles were evident within the cells, with some cells being elliptical or having an elongated shape (Figure 1). Cells cultured with L929M-CSF medium for 3 days had short spindles or elliptical shapes and a markedly enlarged nucleus, as detected by use of nuclear staining, compared with that of the control cells.
Photomicrographs obtained by use of light microscopy (A, C, and E) and fluorescence microscopy (B, D, and F) of mature chicken macrophages isolated from peripheral blood and cultured for 3 days with RPMI 1640 medium (control cells; A and B), HD-11M-CSF (C and D), and L929M-CSF (E and F). Nuclear staining with Hoechst 33258 stain was performed for fluorescence microscopy (B, D, and F). Notice that cells cultured with L929M-CSF for 3 days had short spindles or elliptical shapes and a markedly larger nucleus, as detected by use of nuclear staining, compared with that of the control cells. Bar = 50 μm.
Citation: American Journal of Veterinary Research 79, 12; 10.2460/ajvr.79.12.1306
Photomicrographs obtained by use of light microscopy (A, C, and E) and fluorescence microscopy (B, D, and F) of mature chicken macrophages isolated from peripheral blood and cultured for 3 days with RPMI 1640 medium (control cells; A and B), HD-11M-CSF (C and D), and L929M-CSF (E and F). Nuclear staining with Hoechst 33258 stain was performed for fluorescence microscopy (B, D, and F). Notice that cells cultured with L929M-CSF for 3 days had short spindles or elliptical shapes and a markedly larger nucleus, as detected by use of nuclear staining, compared with that of the control cells. Bar = 50 μm.
Citation: American Journal of Veterinary Research 79, 12; 10.2460/ajvr.79.12.1306
Photomicrographs obtained by use of light microscopy (A, C, and E) and fluorescence microscopy (B, D, and F) of mature chicken macrophages isolated from peripheral blood and cultured for 3 days with RPMI 1640 medium (control cells; A and B), HD-11M-CSF (C and D), and L929M-CSF (E and F). Nuclear staining with Hoechst 33258 stain was performed for fluorescence microscopy (B, D, and F). Notice that cells cultured with L929M-CSF for 3 days had short spindles or elliptical shapes and a markedly larger nucleus, as detected by use of nuclear staining, compared with that of the control cells. Bar = 50 μm.
Citation: American Journal of Veterinary Research 79, 12; 10.2460/ajvr.79.12.1306
Furthermore, actively phagocytosing macrophages were detected. Activated macrophages cocultured with mouse erythrocytes had a strong phagocytic capacity. Phagocytosed mouse erythrocytes caused bulges in the macrophages, which appeared as red areas in the macrophages, whereas nonphagocytosed erythrocytes were distributed in the medium (Figure 2). Spindle-shaped cells appeared to have stronger phagocytic activity than did elliptical cells with respect to the ability to engulf mouse erythrocytes.
Photomicrographs of chicken macrophages isolated from peripheral blood and cultured for 3 days with HD-11M-CSF (A) or L929M-CSF (B) and then coincubated with mouse erythrocytes for 1 to 3 hours. Notice that phagocytosed mouse erythrocytes are evident within the macrophages. Bar = 50 μm.
Citation: American Journal of Veterinary Research 79, 12; 10.2460/ajvr.79.12.1306
Photomicrographs of chicken macrophages isolated from peripheral blood and cultured for 3 days with HD-11M-CSF (A) or L929M-CSF (B) and then coincubated with mouse erythrocytes for 1 to 3 hours. Notice that phagocytosed mouse erythrocytes are evident within the macrophages. Bar = 50 μm.
Citation: American Journal of Veterinary Research 79, 12; 10.2460/ajvr.79.12.1306
Photomicrographs of chicken macrophages isolated from peripheral blood and cultured for 3 days with HD-11M-CSF (A) or L929M-CSF (B) and then coincubated with mouse erythrocytes for 1 to 3 hours. Notice that phagocytosed mouse erythrocytes are evident within the macrophages. Bar = 50 μm.
Citation: American Journal of Veterinary Research 79, 12; 10.2460/ajvr.79.12.1306
Transcription of CD11b
The CD11b gene is largely expressed on the surface of mature macrophages24,25; thus, CD11b is a distinctive gene for identifying macrophages. Results of the qRT-PCR assay indicated that mature macrophages derived from peripheral blood or bone marrow and stimulated with HD-11M-CSF or L929M-CSF could transcribe CD11b (Figure 3).
Photographs of agarose gels after electrophoresis of segments of the CD11b gene (GenBank accession No. KT337505) after chicken macrophages were activated by various stimuli. Lanes were as follows: M, DNA marker; lane 1, macrophages from bone marrow cultured in HD-11M-CSF; lane 2, macrophages from bone marrow cultured in L929M-CSF; lane 3, macrophages from peripheral blood cultured in HD-11M-CSF; and lane 4, macrophages from peripheral blood cultured in L929M-CSF.
Citation: American Journal of Veterinary Research 79, 12; 10.2460/ajvr.79.12.1306
Photographs of agarose gels after electrophoresis of segments of the CD11b gene (GenBank accession No. KT337505) after chicken macrophages were activated by various stimuli. Lanes were as follows: M, DNA marker; lane 1, macrophages from bone marrow cultured in HD-11M-CSF; lane 2, macrophages from bone marrow cultured in L929M-CSF; lane 3, macrophages from peripheral blood cultured in HD-11M-CSF; and lane 4, macrophages from peripheral blood cultured in L929M-CSF.
Citation: American Journal of Veterinary Research 79, 12; 10.2460/ajvr.79.12.1306
Photographs of agarose gels after electrophoresis of segments of the CD11b gene (GenBank accession No. KT337505) after chicken macrophages were activated by various stimuli. Lanes were as follows: M, DNA marker; lane 1, macrophages from bone marrow cultured in HD-11M-CSF; lane 2, macrophages from bone marrow cultured in L929M-CSF; lane 3, macrophages from peripheral blood cultured in HD-11M-CSF; and lane 4, macrophages from peripheral blood cultured in L929M-CSF.
Citation: American Journal of Veterinary Research 79, 12; 10.2460/ajvr.79.12.1306
Transcription of BF and BL by activated chicken macrophages
Transcription of BF and BL by mature macrophages was assessed after cells were activated by culture with L929M-CSF for 3 days followed by coculture with LPS or mouse erythrocytes for 2 days. Results of the qRT-PCR assay indicated that transcription of Ii1 and Ii2 (isomers of chicken invariant chain, a chaperonin of MHC class II molecules),36 BFa, and BLb was significantly (P = 0.01) less for these cells, compared with transcription for the unstimulated control cells (Figure 4). However, the expression for cells activated by the soluble stimulus LPS was significantly (P = 0.01) greater than for cells activated by the granular stimulus mouse erythrocytes. This indicated that the type of stimulus also affected transcription of BF and BL.
Mean ± SD relative quantity of transcription for MHC and Ii chaperone genes, compared with results for the gene for GAPDH, in chicken macrophages incubated with RPMI 1640 medium (no stimulus [control sample]; black bars) or stimulated by incubation with mouse erythrocytes (gray bars) or LPS (white bars). Values reported represent results for 3 replicates. *Value differs significantly (P = 0.01) from the value for the control sample.
Citation: American Journal of Veterinary Research 79, 12; 10.2460/ajvr.79.12.1306
Mean ± SD relative quantity of transcription for MHC and Ii chaperone genes, compared with results for the gene for GAPDH, in chicken macrophages incubated with RPMI 1640 medium (no stimulus [control sample]; black bars) or stimulated by incubation with mouse erythrocytes (gray bars) or LPS (white bars). Values reported represent results for 3 replicates. *Value differs significantly (P = 0.01) from the value for the control sample.
Citation: American Journal of Veterinary Research 79, 12; 10.2460/ajvr.79.12.1306
Mean ± SD relative quantity of transcription for MHC and Ii chaperone genes, compared with results for the gene for GAPDH, in chicken macrophages incubated with RPMI 1640 medium (no stimulus [control sample]; black bars) or stimulated by incubation with mouse erythrocytes (gray bars) or LPS (white bars). Values reported represent results for 3 replicates. *Value differs significantly (P = 0.01) from the value for the control sample.
Citation: American Journal of Veterinary Research 79, 12; 10.2460/ajvr.79.12.1306
Cell types of mature macrophages activated by various stimuli
Transcription of macrophage-distinctive immune-active genes was measured. Results indicated that gene transcription of M1-distinctive cytokines by LPS-activated cells was significantly (IL2, IL6, IL12, and iNOS, P = 0.01; TNFα, P < 0.05) higher, but gene transcription of IL1β was significantly (P < 0.05) lower, than that of unstimulated control cells (Figure 5). However, transcription patterns for genes differed in cells stimulated by incubation with mouse erythrocytes. Only the gene for the M2-distinctive cytokine (TGF-β) was significantly (P = 0.01) increased in LPS-stimulated cells, whereas genes for other cytokines (IL-10 and TGF-β in mouse erythrocyte–stimulated and IL-10 in LPS-stimulated cells) were significantly reduced (Figure 6).
Mean ± SD relative quantity of transcription of genes for M1-distinctive cytokines, compared with results for the gene for GAPDH, in chicken macrophages incubated with RPMI 1640 medium or stimulated by incubation with mouse erythrocytes or LPS. †Value differs significantly (P < 0.05) from the value for the control sample. See Figure 4 for remainder of key.
Citation: American Journal of Veterinary Research 79, 12; 10.2460/ajvr.79.12.1306
Mean ± SD relative quantity of transcription of genes for M1-distinctive cytokines, compared with results for the gene for GAPDH, in chicken macrophages incubated with RPMI 1640 medium or stimulated by incubation with mouse erythrocytes or LPS. †Value differs significantly (P < 0.05) from the value for the control sample. See Figure 4 for remainder of key.
Citation: American Journal of Veterinary Research 79, 12; 10.2460/ajvr.79.12.1306
Mean ± SD relative quantity of transcription of genes for M1-distinctive cytokines, compared with results for the gene for GAPDH, in chicken macrophages incubated with RPMI 1640 medium or stimulated by incubation with mouse erythrocytes or LPS. †Value differs significantly (P < 0.05) from the value for the control sample. See Figure 4 for remainder of key.
Citation: American Journal of Veterinary Research 79, 12; 10.2460/ajvr.79.12.1306
Mean ± SD relative quantity of transcription for genes of M2-distinctive cytokines, compared with results for the gene for GAPDH, in chicken macrophages incubated with RPMI 1640 medium or stimulated by incubation with mouse erythrocytes or LPS. See Figure 4 for remainder of key.
Citation: American Journal of Veterinary Research 79, 12; 10.2460/ajvr.79.12.1306
Mean ± SD relative quantity of transcription for genes of M2-distinctive cytokines, compared with results for the gene for GAPDH, in chicken macrophages incubated with RPMI 1640 medium or stimulated by incubation with mouse erythrocytes or LPS. See Figure 4 for remainder of key.
Citation: American Journal of Veterinary Research 79, 12; 10.2460/ajvr.79.12.1306
Mean ± SD relative quantity of transcription for genes of M2-distinctive cytokines, compared with results for the gene for GAPDH, in chicken macrophages incubated with RPMI 1640 medium or stimulated by incubation with mouse erythrocytes or LPS. See Figure 4 for remainder of key.
Citation: American Journal of Veterinary Research 79, 12; 10.2460/ajvr.79.12.1306
Discussion
Results of the present study indicated that the type of stimulus influenced the type of cytokine gene and quantity of transcription in polarized chicken macrophages. Characteristics of chicken macrophages in the study reported here were similar to those of mammalian macrophages. In the present study, methods for isolating chicken macrophages derived from bone marrow and peripheral blood and detection of morphological features and phagocytic function were described. Use of these methods enabled assessment of the biological characteristics of chicken macrophages. Results indicated that for the culture conditions of the present study, chicken macrophages could be activated to display a classic fusiform phenotype and to express distinctive CD11b and cytokine genes. This evidence suggested that there would be no phenotypic differences between avian and mammalian macrophages.
Transcription of chicken BF and BL genes was reduced, but that of cytokine genes was increased, in activated macrophages. In addition, transcription of the gene for IL-1β was significantly reduced. Macrophages are multifunctional; these cells can phagocytose materials, present antigens, and regulate immune responses via the direct secretion of cytokines. During antigen presentation, MHC class I and II molecules have an important role for recognizing, transporting, and presenting exogenous and endogenous antigen peptides to T cells.9,10 Results for the present study indicated that chicken macrophages activated by LPS or mouse erythrocytes could transcribe immune genes, including the BF, BL, and CD11b genes and genes for cytokines. However, transcription was not increased for all genes: the quantity transcribed for BF and BL was markedly reduced. In contrast, macrophages at various stages of activation performed a primary function rather than several synchronous tasks; thus, gene transcription of classic MHC genes for presenting antigen peptides and genes of the various cytokines responsible for regulating the immune response should exhibit diversity by downregulating MHC molecules26 and upregulating distinctive cytokines.37
The diversity of distinctive cytokines secreted by LPS- and mouse erythrocyte–activated macrophages revealed plasticity and complexity with regard to polarization. Results of the present study indicated that chicken macrophages were activated by simulation with LPS or mouse erythrocytes and consequently formed the M1 or M2 phenotypes, which secreted cytokines with distinctive profiles. Lipopolysaccharide is a potent inducer of inflammation and M1 polarization7,16; in mice, IL-1β, TNF-α, IL-12, and iNOS2 can be upregulated by the M1 phenotype, and IL-10, YM1, Arg-1, and MRC-1 can be downregulated by the M2 phenotype.10,16 Macrophage polarization is also influenced by other factors. In vitro culture conditions, the receptor for advanced glycation end products,38 proteases,39 chemerin15,15 and even age40 can influence polarization. Multiple factors affect the plasticity and complexity of polarization, which depend on the pathogens encountered and the phase of inflammation and do not correspond to the unitary M1-versus-M2 polarization model.7 Therefore, the present study described differences among these cytokine genes regarding the type of cytokine and quantity transcribed.
Acknowledgments
Supported by a grant from the National Natural Science Foundation of China (award Nos. 31372417 and 31572496).
The authors declare that there were no conflicts of interest.
ABBREVIATIONS
| CSF | Colony-stimulating factor |
| GAPDH | Glyceraldehyde-3-phosphate dehydrogenase |
| GM-CSF | Granulocyte-macrophage colony-stimulating factor |
| IL | Interleukin |
| iNOS | Inducible nitric oxide synthase |
| M-CSF | Macrophage colony-stimulating factor |
| MHC | Major histocompatibility complex |
| qRT-PCR | Quantitative reverse transcription PCR |
| TGF | Transforming growth factor |
| Th | T helper |
| TNF | Tumor necrosis factor |
Footnotes
Hyclone, Thermo, Beijing, People's Republic of China.
Gibco, VIC, Australia.
Lymphocyte separation liquid, TBD, Tianjin, People's Republic of China.
Life Technologies Corp, Boston, Mass.
IX71, Olympus, Guangzhou, People's Republic of China.
Beyotime, Shanghai, People's Republic of China.
RNAiso Plus, Takara, Dalian, People's Republic of China.
Trizol, Takara, Dalian, People's Republic of China.
RNase inhibitor, Takara, Dalian, People's Republic of China.
PrimeScript 1st cDNA strand, Takara, Dalian, People's Republic of China.
Oligo, version 6.0, Life Technologies, Boston, Mass.
DNAStar, version 5.0, DNASTAR Co, Madison, Wis.
EX Taq DNA polymerase, Takara, Dalian, People's Republic of China.
LA Taq, Takara, Dalian, People's Republic of China.
DNA gel extraction kit, Dongsheng Biotech, Guangzhou, People's Republic of China.
Takara, Dalian, People's Republic of China.
Sengon, Shanghai, People's Republic of China.
StepOne PLUS real-time system, Applied Biosystems, Boston, Mass.
Primer Express, version 3.0, Applied Biosystems, Boston, Mass.
2* SYBR Green premix Ex Taq II, Takara, Dalian, People's Republic of China.
Excel, version 2013, Microsoft Corp, Redmond, Wash.
References
1. He H, Arsenault RJ, Genovese KJ, et al. Chicken macrophages infected with Salmonella (S.) enteritidis or S. Heidelberg produce differential responses in immune and metabolic signaling pathways. Vet Immunol Immunopathol 2018;195:46–55.
2. Dai M, Feng M, Xie T, et al. ALV-J infection induces chicken monocyte death accompanied with the production of IL-1β and IL-18. Oncotarget 2017;8:99889–99900.
3. Han X, Tian Y, Guan R, et al. Infectious bronchitis virus infection induces apoptosis during replication in chicken macrophage HD11 cells. Viruses 2017;9:1–14.
4. Amarasinghe A, Abdul-Cader MS, Nazir S, et al. Infectious bronchitis corona virus establishes productive infection in avian macrophages interfering with selected antimicrobial functions. PLoS One 2017;12:e0181801.
5. Arayan LT, Reyes AWB, Hop HT, et al. The bactericidal effect of high temperature is an essential resistance mechanism of chicken macrophage against brucella abortus infection. J Microbiol Biotechnol 2017;27:1837–1843.
6. Sanjaya A, Elder JR, Shah DH. Identification of new CpG oligodeoxynucleotide motifs that induce expression of interleukin-1beta and nitric oxide in avian macrophages. Vet Immunol Immunopathol 2017;192:1–7.
7. Katsura Y, Harada N, Harada S, et al. Characteristics of alveolar macrophages from murine models of OVA-induced allergic airway inflammation and LPS-induced acute airway inflammation. Exp Lung Res 2015;41:370–382.
8. Sei JJ, Haskett S, Kaminsky LW, et al. Peptide-MHC-I from endogenous antigen outnumber those from exogenous antigen, irrespective of APC phenotype or activation. PLoS Pathog 2015;11:e1004941.
9. Bressler B, Bethel KP, Kleef R, et al. Site-specific immunomodulator: a novel treatment for Crohn's disease. Gastroenterol Res Pract 2015;2015:1–7.
10. Bhattacharya P, Dey R, Dagur PK, et al. Genetically modified live attenuated Leishmania donovani parasites induce innate immunity through classical activation of macrophages that direct the th1 response in mice. Infect Immun 2015;83:3800–3815.
11. Nakagawa Y, Chiba K. Diversity and plasticity of microglial cells in psychiatric and neurological disorders. Pharmacol Ther 2015;154:21–35.
12. Liu P-S, Lin Y-W, Burton FH, et al. M1–M2 balancing act in white adipose tissue browning—a new role for RIP140. Adipocyte 2015;4:146–148.
13. Wei X, Tang C, Lu X, et al. MiR-101 targets DUSP1 to regulate the TGF-β secretion in sorafenib inhibits macrophage-induced growth of hepatocarcinoma. Oncotarget 2015;6:18389–18405.
14. Li F, Yang Y, Zhu X, et al. Macrophage polarization modulates development of systemic lupus erythematosus. Cell Physiol Biochem 2015;37:1279–1288.
15. Chang C, Ji Q, Wu B, et al. Chemerin15-ameliorated cardiac ischemia-reperfusion injury is associated with the induction of alternatively activated macrophages. Mediators Inflamm 2015;2015:1–9.
16. Chinetti-Gbaguidi G, Baron M, Bouhlel MA, et al. Human atherosclerotic plaque alternative macrophages display low cholesterol handling but high phagocytosis because of distinct activities of the PPAR and LXR pathways. Circ Res 2011;108:985–995.
17. Wagner M, Koester H, Deffge C, et al. Isolation and intravenous injection of murine bone marrow derived monocytes. J Vis Exp 2014;27:1–8.
18. Moore RN, Oppenheim JJ, Farrar JJ, et al. Production of lymphocyte-activating factor (interleukin 1) by macrophages activated with colony-stimulating factors. J Immunol 1980;125:1302–1305.
19. Nascimento FRF, Gomes EA, Russo M, et al. Interferon regulatory factor (IRF)-1 is a master regulator of the cross talk between macrophages and L929 fibrosarcoma cells for nitric oxide dependent tumoricidal activity. PLoS One 2015;10:e0117782.
20. Almatroodi SA, McDonald CF, Darby IA, et al. Characterization of M1/M2 tumour-associated macrophages (TAMs) and Th1/Th2 cytokine profiles in patients with NSCLC. Cancer Microenviron 2016;9:1–11.
21. Pena OM, Pistolic J, Raj D, et al. Endotoxin tolerance represents a distinctive state of alternative polarization (M2) in human mononuclear cells. J Immunol 2011;186:7243–7254.
22. Beirão BCB, Raposo T, Pang LY, et al. Canine mammary cancer cells direct macrophages toward an intermediate activation state between M1/M2. BMC Vet Res 2015;11:151.
23. Novoselov VV, Sazonova MA, Ivanova EA, et al. Study of the activated macrophage transcriptome. Exp Mol Pathol 2015;99:575–580.
24. Melgar-Lesmes P, Edelman ER. Monocyte-endothelial cell interactions in the regulation of vascular sprouting and liver regeneration in mouse. J Hepatol 2015;63:917–925.
25. Solhaug A, Wisbech C, Christoffersen TE, et al. The mycotoxin alternariol induces DNA damage and modify macrophage phenotype and inflammatory responses. Toxicol Lett 2015;239:9–21.
26. Mittal SK, Cho KJ, Ishido S, et al. Interleukin 10 (IL-10)-mediated immunosuppression: march-I induction regulates antigen presentation by macrophages but not dendritic cells. J Biol Chem 2015;290:27158–27167.
27. Chen F, Pan L, Chao W, et al. Character of chicken polymorphic major histocompatibility complex class II alleles of 3 Chinese local breeds. Poult Sci 2012;91:1097–1104.
28. Helft J, Böttcher J, Chakravarty P, et al. GM-CSF mouse bone marrow cultures comprise a heterogeneous population of CD11c+MHCII+ macrophages and dendritic cells. Immunity 2015;42:1197–1211.
29. Leroux L-P, Dasanayake D, Rommereim LM, et al. Secreted Toxoplasma gondii molecules interfere with expression of MHC-II in interferon gamma-activated macrophages. Int J Parasitol 2015;45:319–332.
30. Nguyen-Chi M, Laplace-Builhe B, Travnickova J, et al. Identification of polarized macrophage subsets in zebrafish. eLife 2015;4:e07288.
31. Englen MD, Valdez YE, Lehnert NM, et al. Granulocyte/macrophage colony-stimulating factor is expressed and secreted in cultures of murine L929 cells. J Immunol Methods 1995;184:281–283.
32. Beug H, von Kirchbach A, Döderlein G, et al. Chicken hematopoietic cells transformed by seven strains of defective avian leukemia viruses display three distinct phenotypes of differentiation. Cell 1979;18:375–390.
33. Adams JS, Beeker TG, Hongo T, et al. Constitutive expression of a vitamin D 1-hydroxylase in a myelomonocytic cell line: a model for studying 1,25-dihydroxyvitamin D production in vitro. J Bone Miner Res 1990;5:1265–1269.
34. AVMA. AVMA guidelines for the euthanasia of animals: 2013 edition. Available at: www.avma.org/KB/Policies/Documents/euthanasia.pdf. Accessed Jan 22, 2017.
35. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2-ΔΔCT method. Methods 2001;25:402–408.
36. Zhong D, Yu W, Liu Y, et al. Molecular cloning and expression of two chicken invariant chain isoforms produced by alternative splicing. Immunogenetics 2004;56:650–656.
37. Wlodarczyk A, Cédile O, Jensen KN, et al. Pathologic and protective roles for microglial subsets and bone marrow- and blood-derived myeloid cells in central nervous system inflammation. Front Immunol 2015;6:463.
38. Rojas A, Delgado-Lopez F, Perez-Castro R, et al. HMGB1 enhances the protumoral activities of M2 macrophages by a Rage-dependent mechanism. Tumour Biol 2016;37:3321–3329.
39. White MJV, Gomer RH. Trypsin, tryptase, and thrombin polarize macrophages towards a pro-fibrotic M2a phenotype. PLoS One 2015;10:e0138748.
40. Gonzalez OA, Novak MJ, Kirakodu S, et al. Differential gene expression profiles reflecting macrophage polarization in aging and periodontitis gingival tissues. Immunol Invest 2015;44:643–664.
Appendix
Primers used to assess gene expression in activated chicken macrophages.
| Gene | Sequence (5′→3′) | Amplified sequence | Amplicon size (bp) |
|---|---|---|---|
| Ii1 | F–GGTGAAAGCCAAGTAGAAG | Ii segment | 138 |
| R–TCAGGAAAGCAAGGTAAG | |||
| Ii2 | F–AGCAGAATACAATCCCAGCG | Ii segment | 109 |
| R–TCACCGTTCTCATCGCACT | |||
| BFα | F–GTGGAATACGGGAAGGCT | BFα segment | 138 |
| R–CCCAGGTGTGGTAGGTG | |||
| BLβ | F–GAGCGTGGAGCCCAAGGTG | BLβ segment | 69 |
| R–GCCAGACGGTCGGTTTCGG | |||
| GAPDH | F–CAGAACATCATCCCAGCGTC | GAPDH segment | 133 |
| R–GGCAGGTCAGGTCAACAAC | |||
| IL1β | F–GCATCAAGGGCTACAAGCTC | IL1β segment | 131 |
| R–CAGGCGGTAGAAGATGAAGC | |||
| IL2 | F–GCAACGCTAATGACTACAGCT | IL2 segment | 135 |
| R–AGTTGGTGTGTAGAGCTCGA | |||
| IL6 | F–CTCCTCGCCAATCTGAAGTC | IL6 segment | 100 |
| R–CCCTCACGGTCTTCTCCATA | |||
| IL10 | F–AGAGATGCTGCGCTTCTACA | IL10 segment | 189 |
| R–TCGAACGTCTCCTTGATCTGC | |||
| IL12 | F–TATCCCAAGACCTGGAGCAC | IL12 segment | 133 |
| R–GCCCAGTCTTTGGAATCTGA | |||
| iNOS | F–ATCCTGGAGGTCCTGGAAGAGT | iNOS segment | 84 |
| R–CCTGGGTTTCAGAAGTGGCA | |||
| TNFα | F–ACTCAGGACAGCCTATGCCAACA | TNFα segment | 172 |
| R–CACGACAGCCAAGTCAACGC | |||
| TGFβ | F–CACAATGAGTTGGGCATTTG | TGFβ segment | 106 |
| R–GGAACTCTGCTCGAAACAGG | |||
| CD11b | F–CAAATCCCGCTCCGAAAGGC | CD11b segment | 237 |
| R–GCTCCCAAACAACCACCCCAC |
F = Forward. R = Reverse.
