Effects of enzyme and cryoprotectant concentrations on yield of equine adipose-derived multipotent stromal cells

Wei Duan Laboratory for Equine and Comparative Orthopedic Research, Department of Veterinary Clinical Sciences, School of Veterinary Medicine, Louisiana State University, Baton Rouge, LA 70803.

Search for other papers by Wei Duan in
Current site
Google Scholar
PubMed
Close
 PhD
and
Mandi J. Lopez Laboratory for Equine and Comparative Orthopedic Research, Department of Veterinary Clinical Sciences, School of Veterinary Medicine, Louisiana State University, Baton Rouge, LA 70803.

Search for other papers by Mandi J. Lopez in
Current site
Google Scholar
PubMed
Close
 DVM, PhD

Click on author name to view affiliation information

Abstract

OBJECTIVE To evaluate effects of various concentrations of collagenase and dimethyl sulfoxide (DMSO) on yield of equine adipose-derived multipotent stromal cells (ASCs) before and after cryopreservation.

SAMPLE Supragluteal subcutaneous adipose tissue from 7 Thoroughbreds.

PROCEDURES Tissues were incubated with digests containing 0.1%, 0.05%, or 0.025% type I collagenase. Part of each resulting stromal vascular fraction was cryopreserved in 80% fetal bovine serum (FBS), 10% DMSO, and 10% Dulbecco modified Eagle medium F-12 and in 95% FBS and 5% DMSO. Half of each fresh and cryopreserved heterogeneous cell population was not immunophenotyped (unsorted) or was immunophenotyped for CD44+, CD105+, and major histocompatability complex class II (MHCII; CD44+-CD105+-MHCII+ cells and CD44+-CD105+-MHCII cells). Cell proliferation (cell viability assay), plasticity (CFU frequency), and lineage-specific target gene and oncogene expression (reverse transcriptase PCR assays) were determined in passage 1 cells before and after culture in induction media.

RESULTS Digestion with 0.1% collagenase yielded the highest number of nucleated cells. Cell surface marker expression and proliferation rate were not affected by collagenase concentration. Cryopreservation reduced cell expansion rate and CD44+-CD105+-MHCII CFUs; it also reduced osteogenic plasticity of unsorted cells. However, effects appeared to be unrelated to DMSO concentrations. There were also variable effects on primordial gene expression among cell isolates.

CONCLUSIONS AND CLINICAL RELEVANCE Results supported the use of 0.1% collagenase in an adipose tissue digest and 5% DMSO in cryopreservation medium for isolation and cryopreservation, respectively, of equine ASCs. These results may be used as guidelines for standardization of isolation and cryopreservation procedures for equine ASCs.

Abstract

OBJECTIVE To evaluate effects of various concentrations of collagenase and dimethyl sulfoxide (DMSO) on yield of equine adipose-derived multipotent stromal cells (ASCs) before and after cryopreservation.

SAMPLE Supragluteal subcutaneous adipose tissue from 7 Thoroughbreds.

PROCEDURES Tissues were incubated with digests containing 0.1%, 0.05%, or 0.025% type I collagenase. Part of each resulting stromal vascular fraction was cryopreserved in 80% fetal bovine serum (FBS), 10% DMSO, and 10% Dulbecco modified Eagle medium F-12 and in 95% FBS and 5% DMSO. Half of each fresh and cryopreserved heterogeneous cell population was not immunophenotyped (unsorted) or was immunophenotyped for CD44+, CD105+, and major histocompatability complex class II (MHCII; CD44+-CD105+-MHCII+ cells and CD44+-CD105+-MHCII cells). Cell proliferation (cell viability assay), plasticity (CFU frequency), and lineage-specific target gene and oncogene expression (reverse transcriptase PCR assays) were determined in passage 1 cells before and after culture in induction media.

RESULTS Digestion with 0.1% collagenase yielded the highest number of nucleated cells. Cell surface marker expression and proliferation rate were not affected by collagenase concentration. Cryopreservation reduced cell expansion rate and CD44+-CD105+-MHCII CFUs; it also reduced osteogenic plasticity of unsorted cells. However, effects appeared to be unrelated to DMSO concentrations. There were also variable effects on primordial gene expression among cell isolates.

CONCLUSIONS AND CLINICAL RELEVANCE Results supported the use of 0.1% collagenase in an adipose tissue digest and 5% DMSO in cryopreservation medium for isolation and cryopreservation, respectively, of equine ASCs. These results may be used as guidelines for standardization of isolation and cryopreservation procedures for equine ASCs.

Equine MSCs from adipose tissue are increasingly used in treatment.1,2 Currently, there is no standard for MSC isolation, and numerous methods have been described.3,4 Collagenase digestion of adipose tissue is routinely used to isolate the stromal vascular fraction.5 The stromal vascular fraction contains ASCs as well as WBCs, fibroblasts, and other cells, many of which express MHCII.6,7 Subsequent culture on plastic selects for ASCs of various immunophenotypes owing to their plastic affinity.6 However, differences among isolates contribute to variable cell behavior and treatment efficacy.8

Collagenase digests have inconsistent effects on survival and behavior of ASC immunophenotypes.4,5,9 Concentrations of type I collagenase solutions used for tissue digestion range from as low as 0.02% to as high as 0.3%, and 0.1% is commonly used for isolation of equine ASCs.4,5,9 Protein residues from commercially available collagenase preparations increase with increases in enzyme concentrations.3 Additionally, high collagenase concentrations can alter expression of cell surface markers10 and reduce the ability to select for ASC immunophenotypes that do not express MHCII, which is a defining MSC characteristic.3 Optimization of the digestion of adipose tissue to support consistent and efficient isolation of equine ASC immunophenotypes will facilitate collection of robust cell populations with known behaviors by use of fluorescence-activated cell sorting.11

Cryopreservation makes it possible to maintain and transport cells12 and alleviates risks of long-term culture (eg, contamination and rapid cell aging).13–15 Cell cooling protocols and cryopreservation media are not standardized, and both select for cell immunophenotypes and alter cell behavior.16,17 Determination of cryopreservation effects on ASC populations isolated by use of defined methods is crucial to cell preparation. Gene expression is a useful tool to assess the impact of cryopreservation on cells.18 Representative genes associated with MSC plasticity and self-renewal are SOX2, Nanog, β-catenin, and Notch1.19–21 Another is FAS, which contributes to immunosuppressive effects of human ASCs.22 The chemical DMSO is commonly included in media used for cryopreservation of companion animal ASCs.17 Cryoprotectants are necessary to lower the freezing point of the cell-medium mixture, stabilize proteins, and balance intracellular and extracellular osmolality to prevent cell dehydration or rupture.23 However, DMSO is a carcinogen that can cause serious adverse effects when administered with cell preparations, so minimizing the concentration of DMSO in cryopreservation media will reduce potential complications.17,24

The primary objective of the study reported here was to determine the concentration of collagenase for tissue digestion and concentration of DMSO for cryopreservation that result in the highest yield of equine ASCs before and after cryopreservation. Specifically, we sought to quantify the effects of various collagenase concentrations on nucleated cell yield and ASC expansion as well as effects of DMSO concentration on postcryopreservation ASC expansion, differentiation capabilities, and gene expression. The hypotheses tested in the study were that equine ASC yield and expansion rate would decrease with increasing collagenase concentration and the postcryopreservation ASC expansion rate and plasticity would decrease with increasing concentrations of DMSO in the cryopreservation medium.

Materials and Methods

Sample

Adipose tissue was collected from cadavers of 7 Thoroughbreds immediately after the horses were euthanized for reasons unrelated to the present study. The horses (4 mares and 3 geldings; mean ± SEM age, 13.7 ± 6.1 years) were part of a university research herd.

Study design

Supragluteal subcutaneous adipose tissue was aseptically collected from each equine cadaver. Equal portions of tissue from each horse were digested with type I collagenase at concentrations (wt/vol) of 0.1%, 0.05%, and 0.025%. Half of each resulting stromal vascular fraction was used fresh, and the other half was cryopreserved for 30 to 60 days in 80% FBS, 10% DMSO, and 10% DMEM F-12 (Cryo10 medium) or 95% FBS and 5% DMSO (Cryo5 medium). Fresh and cryopreserved cells were cultured, and results were obtained from passage 1 cells. Cells were unsorted (not immunophenotyped) or were sorted on the basis of immunophenotype (CD44+-CD105+-MHCII cells and CD44+-CD105+-MHCII+ cells). Cell doublings and doubling time were determined.

Cells then were cultured in induction or stromal medium. Frequency percentages (CFUs for fibroblastic, osteoblastic, and adipocytic cells) and lineage-specific target gene mRNA expression (adipogenesis, PPAR-γ and leptin; osteogenesis, ALP and BSP; and progenitor, SOX2 and Nanog) were assessed. Additionally, mRNA levels of β catenin, Notch1, and FAS were determined for cells after culture in stromal media. All assays were performed in duplicate.

Cell isolation

Cell isolation was performed as previously described,25 with modifications of the collagenase concentration. Adipose tissue was rinsed with PBS solution,a minced, and divided into 3 equal portions, each of which was combined with equivalent volumes of PBS solution. Mixtures were allowed to separate into a liquid and solid phase for 3 minutes. Each solid phase was digested for 90 minutes at 37°C with agitation in 1 of 3 solutions of type I collagenaseb (125 U/mg): 0.1% collagenase (125 U/mL), 1% bovine serum albumin,c and DMEM F-12a; 0.05% collagenase (62.5 U/mL), 0.5% bovine serum albumin, and DMEM F-12; or 0.025% collagenase (32.3 U/mL), 0.25% bovine serum albumin, and DMEM F-12. Digests were filtered through a nylon meshd (pore size, 100 μm) and centrifuged (260 × g for 5 minutes). The resulting cell pellet was suspended in 1% bovine serum albumin in DMEM F-12 and centrifuged again at 260 × g for 5 minutes. That pellet was resuspended in an equal volume of RBC lysis buffer (NH4Cl, 0.16 mol/L; KHCO3, 0.01 mol/L; and 0.01% EDTA). The mixture was allowed to sit undisturbed at room temperature (23°C) for 5 minutes; it then was centrifuged (260 × g for 5 minutes) to yield the stromal vascular fraction, which was resuspended in 1 mL of stromal medium (10% FBS, 1% antimicrobial-antimycotic solution, and DMEM F-12). The viable nucleated cell yield per gram of adipose tissue was quantified with a hemacytometer by exclusion of 0.1% trypan blue dye from live cells.

After cells were isolated, the stromal vascular fraction (the primary cells isolated) was cultured in stromal medium in T75 flasks.e Medium was changed at 24 hours and then every 72 hours thereafter. Seeding density (5 × 103 cells/cm2), detachment by the use of 0.025% trypsina at 37°C for 2 to 3 minutes, and culture conditions (5% CO2 at 37°C) were identical throughout the study unless otherwise indicated.

Treatment

Equal aliquots of each initial cell isolate were assigned to continuous stromal culture (fresh unsorted cells), fluorescence-activated cell sorting followed by stromal culture (fresh unsorted cells, fresh CD44+-CD105+-MHCII cells, and fresh CD44+-CD105+-MHCII+ cells), or cryopreservation (unsorted cells, CD44+-CD105+-MHCII cells, and CD44+-CD105+-MHCII+ cells; aliquots of 1 × 106 cells/mL in Cryo5 or Cryo10 medium).

Cryopreservation

Cell aliquots in cryopreservation medium were cooled to −80°C in a slow-freezing container,f maintained at that temperature overnight, and then transferred to liquid nitrogen. They were revitalized by submersion in a water bath (37°C) until thawed (1 to 2 minutes). Thawed cells were cultured in stromal medium (passage 0 cells). All assessments were performed on passage 1 cells.

Fluorescence-activated cell sorting

Cells with immunophenotype CD44+-CD105+-MHCII and CD44+-CD105+-MHCII+ were isolated from passage 0 cells for each fresh and cryopreserved isolate. Fluorescent labels were added to unlabeled equine-specific monoclonal antibodies against CD44g and MHCIIh in accordance with the manufacturer's instructions. Cells were then incubated with labeled antibodies (0.5 μg of antibody/106 cells) against CD44i (mouse anti-horse; dilution, 1:200), CD105j (mouse anti-human; dilution, 1:200), and MHCIIk (mouse anti-horse; dilution, 1:200) for 30 minutes in darkness at room temperature. Cell immunophenotypes were isolated and quantified with a flow cytometerl and associated software.m

Cell expansion

Duplicates of each collagenase isolate–cryopreservation treatment–immunophenotype combination were seeded in 12-well plates. After culture for 2, 4, and 6 days, cell numbers were quantified with the resazurin-based methodn used in accordance with the manufacturer's instructions. Cell doubling was calculated by use of the following equation26: cell doublings = (ln [Nf/Ni])/(ln 2), where Ni is the initial cell number and Nf is the final cell number; cell numbers for days 2 and 4 were used as the values of Ni for days 4 and 6, respectively. Doubling time was calculated as culture time divided by cell doublings.26 Statistical evaluation of expansion and immunophenotype data revealed that collagenase concentrations had minimal effects on those variables; therefore, collagenase concentrations were considered together as 1 treatment for limiting dilution assays and gene expression.

Multipotentiality

Limiting dilution assays were used to evaluate frequencies for the fibroblastic, osteoblastic, and adipocytic CFUs of each cryopreservation treatment and immunophenotype as described elsewhere.5 Eight replicates of serial dilutions (5,000, 2,500, 1,250, 625, 312, and 156 cells/well) were seeded in 96-well plates. Cells were cultured in stromal medium for 7 days, and colonies for evaluation of fibroblastic CFUs then were fixed with 4% paraformaldehyde and stained with 0.1% toluidine blue. Cells for evaluation of osteoblastic CFUs were cultured in stromal medium for 7 days followed by culture in osteoblastic medium (DMEM F-12, 10% FBS, 1% antimicrobial-antimycotic solution, β-glycerophosphate [10 mmol/L], dexamethasone [20 nmol/L], and sodium 2-phosphate ascorbate [50 μg/mL]) for 4 days. Colonies were rinsed with 150mM NaCl, fixed by incubation with 70% ethanol at 4°C overnight, and then stained by immersion in 2% alizarin red for 10 minutes at room temperature, which was followed by a rinse with distilled water. Cells for evaluation of adipocytic CFUs were cultured in stromal medium for 7 days and then in adipocytic induction medium (DMEM F-12, 3% FBS, 5% rabbit serum, 1% antimicrobial-antimycotic solution, biotin [33 μmol/L], pantothenate [17 μmol/L], insulin [100 nmol/L], dexamethasone [1 μmol/L], isobutylmethylxanthine [500 μmol/L], and rosiglitazone [5 μmol/L]) for 3 days. For the next 3 days, cells were cultured in the same medium without isobutylmethylxanthine and rosiglitazone. Colonies were fixed by immersion in 1% paraformaldehyde for 1 hour at room temperature and then stained by immersion in 0.3% oil red O for 15 minutes. Wells with ≥ 10 colonies stained with toluidine blue, ≥ 10 colonies stained with oil red O, or ≥ 1 colony stained with alizarin red were considered to have positive results for fibroblastic, adipocytic, or osteoblastic colonies, respectively. The CFU frequency was calculated in accordance with Poisson's ratio as follows: F = e−x; where F was the ratio of the number of wells with negative results to the total number of wells in a row, e was the natural logarithm, and x was the number of CFUs per well. The CFU frequency percentage was calculated as 1/CFU frequency × 100.5,26

Gene expression

Total RNA was extracted,o quantified,p and transcribed to cDNA.q Target genes were quantified with a reverse transcriptase PCR assayr by use of a DNA dyes (Appendix). The ΔCt values were determined relative to the reference gene GAPDH. The fold change in a target gene (2−ΔΔCt) was determined relative to that for fresh unsorted cells cultured in stromal medium, with GAPDH as the reference gene.

Statistical analysis

Statistical analyses were performed with statistical software.t Mixed-model ANOVAs were used to evaluate cell yield, immunophenotype percentages, cell doublings, doubling time, CFU frequency percentages, and gene expression (ΔCt and fold change) among treatment groups. Fixed effects included collagenase concentration (0.1%, 0.05%, and 0.025%), cryopreservation treatment (fresh and cryopreserved), DMSO concentration (5% and 10%), and immunophenotype (unsorted cells, CD44+-CD105+-MHCII+ cells, and CD44+-CD105+-MHCII– cells). Horse was included as a random effect. Tukey post hoc tests were used for comparisons among multiple groups. Results were reported as least squares means ± SEM. Values were considered significant at P < 0.05.

Results

Cell isolation

Cell yield was 2.6 × 105 ± 0.5 × 105 nucleated cells/g of adipose tissue, 2.1 × 105 ± 0.5 × 105 nucleated cells/g of adipose tissue, and 1.2 × 105 ± 0.5 × 105 nucleated cells/g of adipose tissue for type I collagenase concentrations of 0.1%, 0.05%, and 0.025%, respectively (Figure 1). Cell yield for the type I collagenase concentration of 0.025% was significantly lower than that for the concentration of 0.1%.

Figure 1—
Figure 1—

Viable nucleated cell yield (A) and percentages of passage 1 CD44+-CD105+-MHCII cells (B) and CD44+-CD105+-MHCII+ cells (C) isolated by use of type I collagenase concentrations of 0.1% (white bars), 0.05% (gray bars), or 0.025% (black bars) and then cultured in stromal medium (fresh) or cryopreserved in medium containing 80% FBS, 10% DMSO, and 10% DMEM F-12 (Cryo10 medium) or 95% FBS and 5% DMSO (Cryo5 medium) and then cultured in stromal medium. Values reported are least squares mean ± SEM for samples obtained from 7 horses (2 replicates/sample). a,bValues with different letters differ significantly (P < 0.05) among treatments.

Citation: American Journal of Veterinary Research 79, 10; 10.2460/ajvr.79.10.1100

Immunophenotype

Most fresh and cryopreserved passage 1 cells were CD44+-CD105+-MHCII– (Figure 1). For cell isolates from tissue digests with 0.05% type I collagenase, the percentage of fresh CD44+-CD105+-MHCII–cells was higher than that in cryopreserved cells, and the percentage of CD44+-CD105+-MHCII+ cells was significantly higher for cells cryopreserved in the Cryo5 medium than in fresh cells.

Cell expansion

Cell doublings and doubling time were not significantly different among collagenase concentrations within fresh or cryopreserved unsorted cells, but cell doublings were significantly greater and doubling time was significantly less for fresh versus cryopreserved cells (Figure 2). Cell doublings and doubling time of fresh unsorted cells were significantly greater and less, respectively, than for all other preservation or immunophenotype groups. The CD44+-CD105+-MHCII+ cells did not expand well after cryopreservation. This finding as well as the low number of cells with that immunophenotype precluded further evaluation of the CD44+-CD105+-MHCII+ cells.

Figure 2—
Figure 2—

Cell doublings (A, C, and E) and doubling time (B, D, and F) of unsorted cells isolated by use of 3 type I collagenase concentrations and then cultured in stromal medium (fresh) or after cryopreservation in Cryo10 or Cryo5 medium and cell doublings (G) and doubling time (H) for unsorted cells (white bars), CD44+-CD105+-MHCII+ cells (gray bars), and CD44+-CD105+-MHCII cells (black bars) cultured in stromal medium or cryopreserved and then cultured in stromal medium. Values reported are least squares mean ± SEM for samples obtained from 7 horses (2 replicates/sample). *Value differs significantly (P < 0.05) from the value for the fresh cells of each cell type. a,bValues with different letters differ significantly (P < 0.05) among cell types in fresh or cryopreserved cells.

Citation: American Journal of Veterinary Research 79, 10; 10.2460/ajvr.79.10.1100

Multipotentiality

All cell isolates displayed typical trilineage differentiation potential. Cells maintained a fibroblastic-like morphology when cultured in stromal medium (Figure 3). Cells cultured in osteoblastic medium had calcium deposits stained with alizarin red. Cells cultured in adipocytic medium had lipid droplets stained with oil red O. Fresh CD44+-CD105+-MHCII–cells had a significantly higher percentage of fibroblastic CFUs than did cryopreserved cells of the same immunophenotype. Cryopreserved unsorted cells had significantly lower percentages of osteoblastic CFUs than did fresh unsorted cells and cryopreserved CD44+-CD105+-MHCII cells.

Figure 3—
Figure 3—

Photomicrographs of equine ASCs after culture in fibroblastic medium (A), osteoblastic medium (B), and adipocytic medium (C) and the CFU frequency percentage after culture of unsorted cells (white bars), CD44+-CD105+-MHCII+ cells (gray bars), and CD44+-CD105+-MHCII cells (black bars) in fibroblastic medium (D), osteoblastic medium (E), and adipocytic medium (F). Toluidine blue stain, alizarin red stain, and oil red O stain for panels A, B, and C, respectively; bar = 200 μm. Values reported are least squares mean ± SEM for samples obtained from 7 horses (2 replicates/sample). See Figure 2 for remainder of key.

Citation: American Journal of Veterinary Research 79, 10; 10.2460/ajvr.79.10.1100

Gene expression

Unsorted cells had the lowest SOX2 expression after cryopreservation in Cryo10 medium, followed by expression in fresh cells and cells cryopreserved with Cryo5 medium (Figure 4). The SOX2 expression in CD44+-CD105+-MHCII cells was lowest in fresh cells, followed by expression in cells cryopreserved in Cryo10 medium and then by expression in cells cryopreserved in Cryo5 medium. Expression of SOX2 was higher in fresh unsorted cells than in fresh CD44+-CD105+-MHCII (immunophenotyped) cells. The opposite result was found for cells cryopreserved with Cryo10 medium. Nanog expression was highest in immunophenotyped cells cryopreserved with Cryo5 medium. Nanog expression was higher in unsorted than in immunophenotyped fresh cells and cells cryopreserved in Cryo10 medium, but Nanog expression was higher in immunophenotyped than in unsorted cells cryopreserved with Cryo5 medium. After cells were cultured with osteoblastic medium, ALP expression was higher in fresh immunophenotyped cells than in cryopreserved immunophenotyped cells, and BSP expression for cells cryopreserved with Cryo5 medium was highest for immunophenotyped cells. Additionally, ALP ex-pression was highest in fresh immunophenotyped cells, and BSP expression was highest in immunophenotyped cells cryopreserved in Cryo5 medium. After cells were cultured with adipocytic medium, leptin expression was lower in fresh immunophenotyped cells than in cryopreserved immunophenotyped cells. Expression of PPAR-γ and leptin was lower in immunophenotyped than unsorted fresh cells and in immunophenotyped than unsorted cells cryopreserved with Cryo10 medium.

Figure 4—
Figure 4—

Relative expression of stromal (SOX2 [A] and Nanog [B]), osteoblastic (ALP [C] and BSP [D]), and adipocytic (PPAR-γ [E] and leptin [F]) target genes in unsorted (white bars) and CD44+-CD105+-MHCII (black bars) cells. The ΔCt values were determined relative to the reference gene GAPDH. Values reported are least squares mean ± SEM for samples obtained from 5 horses (2 replicates/sample). *Within a cell type, value differs significantly (P < 0.05) from the value for the fresh cells. †Within a cell type, value differs significantly (P < 0.05) from the value for Cryo10 cells. See Figure 2 for remainder of key.

Citation: American Journal of Veterinary Research 79, 10; 10.2460/ajvr.79.10.1100

Regardless of whether cells were fresh or cryopreserved, unsorted and immunophenotyped cells had significantly lower expression of SOX2, Nanog, β-catenin, Notch1, and FAS after culture in induction media, and there were no significant differences among cryopreservation-immunophenotype combinations (Table 1). Expression of SOX2 for cells cultured in stromal medium was highest for cells cryopreserved in Cryo5 medium and greater in unsorted than in immunophenotyped cells in Cryo5 medium (Figure 5). Gene expression was decreased in most cryopreservation-immunophenotype combinations. Nanog expression was significantly increased in immunophenotyped cells cryopreserved in Cryo5 medium, but it was decreased in the other cells. Expression of β-catenin was decreased in all cell groups. Expression of Notch1 was decreased in immunophenotyped cells cryopreserved in Cryo10 and Cryo5 medium and unsorted cells cryopreserved in Cryo10 medium. Expression of FAS was increased in most cryopreservation and immunophenotype cells. Specifically, expression was higher in immunophenotyped fresh cells and immunophenotyped cells cryopreserved in Cryo10 medium, compared with expression in immunophenotyped cells cryopreserved in Cryo5 medium. Expression also was higher in unsorted cryopreserved cells than in fresh cells. Immunophenotyped fresh cells had higher expression than did unsorted fresh cells, and immunophenotyped cells cryopreserved in Cryo10 medium had higher expression than did unsorted cells cryopreserved in Cryo10 medium; however, unsorted cells cryopreserved in Cryo5 medium had higher expression than did immunophenotyped cells cryopreserved in Cryo5 medium.

Figure 5—
Figure 5—

Gene expression of SOX2 (A), Nanog (B), β-catenin (C), Notch1 (D), and FAS (E) in unsorted (white bars) and CD44+-CD105+-MHCII (black bars) cells after culture in stromal medium. Results represent the least squares mean ± SEM fold change for samples obtained from 5 horses (2 replicates/sample). The fold change in a target gene (2−ΔΔCt) was determined relative to that for fresh unsorted cells cultured in stromal medium, with GAPDH as the reference gene. See Figures 2 and 4 for remainder of key.

Citation: American Journal of Veterinary Research 79, 10; 10.2460/ajvr.79.10.1100

Table 1—

Gene expression for equine ASCs after culture in adipocytic or osteoblastic induction media performed before and after cryopreservation.

 AdipogenicOsteogenic
CellsSOX2Nanogβ-cateninNotch1FASSOX2Nanogβ-cateninNotch1FAS
Fresh
  Unsorted0.01 ± 0.260.01 ± 0.075.0 × 10−6 ± 0.05 × 10−60.01 ± 0.110.21 ± 0.660.01 ± 0.310.04 ± 0.0086 × 10−6 ± 0.05 × 10−60.01 ± 0.130.39 ± 0.77
 CD44+−6 × 10−30.02 ± 0.073 × 10−52 × 10−30.02 ± 0.663 × 10−34 × 10−32 × 10−73 × 10−30.02 ± 0.66
 CD105+−± 0.26 × 10−3 ± 0.05 × 10−5± 0.11 × 10−3 ± 0.27 × 10−3± 0.07 × 10−3± 0.05 × 10−7± 0.11 × 10−3 
 MHCII
 Cryo10
 Unsorted2 × 10−38 × 10−35 × 10−68 × 10−30.21 ± 0.685 × 10−30.04 ± 0.079 × 10−60.02 ± 0.110.24 ± 0.66
 ± 0.31 × 10−3± 0.07 × 10−3± 0.04 × 10−6± 0.11 × 10−3 ± 0.26 × 10−3 ± 0.05 × 10−6  
 CD44+−3 × 10−30.03 ± 0.073 × 10−67 × 10−30.06 ± 0.663 × 10−30.02 ± 0.074 × 10−46 × 10−30.51 ± 0.66
CD105+−± 0.31 × 10−3 ± 0.05 × 10−6± 0.11 × 10−3 ± 0.26 × 10−3 ± 0.05 × 10−4± 0.11 × 10−3 
 MHCII
Cryo5
 Unsorted8 × 10−3 ± 0.29 × 10−30.02 ± 0.083 × 10−4 ± 0.05 × 10−40.01 ± 0.110.09 ± 0.661 × 10−3 ± 0.29 × 10−38 × 10−3 ± 0.08 × 10−37 × 10−7 ± 0.05 × 10−70.02 ± 0.110.13 ± 0.66
 CD44+−4 × 10−34 × 10−35 × 10−40.03 ± 0.110.03 ± 0.661 × 10−37 × 10−34 × 10−79 × 10−30.04 ± 0.66
 CD105+−± 0.28 × 10−3± 0.08 × 10−3± 0.05 × 10−4  ± 0.37 × 10−3± 0.09 × 10−3± 0.05 × 10−7± 0.11 × 10−3 
 MHCII

Results represent least squares mean ± SEM fold change for samples obtained from 7 horses (2 replicates/sample). The fold change in a target gene (2−ΔΔCt) was determined relative to that for fresh nonimmunophenotyped (unsorted) cells cultured in stromal medium, with GAPDH as the reference gene. Cryopreservation medium consisted of 80% FBS, 10% DMSO, and 10% DMEM F-12 (Cryo10 medium) or 95% FBS and 5% DMSO (Cryo5 medium).

Discussion

Results of the study reported here supported the use of 0.1% collagenase in the adipose tissue digest and 5% DMSO in the cryopreservation medium for isolation and cryopreservation, respectively, of equine ASCs. Collagenase concentration did not affect the percentage of CD105+-CD44+-MHCII cells or the expansion rate, which was contrary to our hypothesis. Cryopreservation reduced the cell expansion rate, number of CFUs of CD105+-CD44+-MHCII cells, and osteogenic plasticity of unsorted cells, but effects did not appear to be related to the DMSO concentrations. Hence, we also rejected the second hypothesis. Increased FAS expression after cryopreservation suggested that reduced cell expansion may have been a result of cell apoptosis, despite retention of plasticity and proliferation capabilities in the cell population. This concept was further supported by increased SOX2 and Nanog expression after cryopreservation in medium containing 5% DMSO. Overall, the direct comparisons in the present study may be used to establish guidelines for standardization of equine ASC isolation and cryopreservation.

Digests that contain 0.1% collagenase are routinely used to dissociate equine cells from the fibrous adipose tissue matrix.3,5,27 We sought to lower the collagenase concentration to reduce effects (eg, protein residues, reduced cell viability, and alteration of cell surface proteins) that interfere with immunophenotype identification.10 However, decreased nucleated cell yield without increases in immunophenotype percentages or cell expansion rates at lower concentrations supported the use of 0.1% collagenase as the best choice among the concentrations used in the present study. A concentration of 0.05% collagenase may be an acceptable alternative to potentially decrease protein residues because the cell yield for that concentration was lower than, but not significantly different from, that of 0.1% collagenase. The yield of distinct ASC immunophenotypes with 0.1% collagenase will need to be confirmed for each individual immunophenotype; however, it is a reasonable concentration to use for standard isolation of equine ASCs. Additionally, digestion time affects both ASC yield and viability,28 and it is one of the most variable components among isolation protocols.5,29,30 We elected to digest tissue for 90 minutes. It is likely that different digestion times will yield outcomes that differ from those reported here.

Lower proliferation rates of immunophenotyped (CD105+-CD44+-MHCII+ and CD105+-CD44+-MHCII) fresh cells than unsorted fresh cells and of cryopreserved than fresh cells are valuable for estimating the number of cells that can be produced from a given cell isolate. Unsorted fresh cell isolates contain cells with distinct lineages that include preadipocytes and endothelial progenitors,6–8 both of which reportedly have higher proliferation rates than for heterogenous isolates.7 The surface markers CD44 and CD105, which are nonintegrin receptors established for MSC identification,31,32 are not expressed on preadipocytes or endothelial cells. Absence of preadipocytes and endothelial cells, among others, after sorting may have contributed to lower proliferation rates.32 Lower proliferation of immunophenotyped cells may also have indicated that other cells were an important part of the progenitor cell tissue niche. Proliferation capabilities of immature ASCs may be reduced if there is no direct contact through cognate ligands with cells that have distinct ASC immunophenotypes or tissue lineages.33

Cryoprotectants are necessary for cell survival in liquid nitrogen. It has been reported that DMSO inhibits postrevitalization expansion rates in canine and human ASCs, potentially as a result of altered gene expression of SOX2 and surface markers CD29 and CD44,18,26 although the exact mechanisms are unclear. An increase in cell proliferation in fresh porcine bone marrow stem cells cryopreserved in 10% DMSO and 10% FBS in DMEM was attributed to over-expression of SOX2,34 but higher SOX2 expression in human ASCs cryopreserved in 5% DMSO was not associated with altered cell proliferation.35 Hydrophobic interactions between permeable DMSO and intracellular and extracellular proteins can denature and deactivate proteins as well as protect them.17,23,36–38 Future studies may help identify cell signaling pathways to enhance proliferation of fresh and cryopreserved equine ASC immunophenotypes via protein epitopes or cell extracts in the culture medium.39 It is also possible that less toxic cryoprotectants in the freezing medium may improve postcryopreservation expansion rates.40

Although values were not significantly different, lower numbers of CFUs in unsorted than in CD105+-CD44+-MHCII cells before cryopreservation indicated that the cell selection process concentrated immature ASCs. Reduction in CFU numbers in the sorted cells after cryopreservation may have indicated susceptibility of ASCs at earlier stages of development to adverse effects attributable to cryopreservation and DMSO exposure.18,26 The reduction of CFU numbers may also have been attributable to mechanical cell damage. Larger, immature cells have comparably less room for expansion during the freezing process than do smaller, more mature cells.41 Cryopreservation effects on MSC osteogenesis are inconsistent, potentially because of differences among isolates.18,42 Fewer osteoblastic CFUs in unsorted cells after cryopreservation in the present study indicated that the CD105+-CD44+-MHCII immunophenotype had better osteogenic plasticity or was at an earlier stage of differentiation than most of the unsorted cells.43,44 Higher expression of osteoblastic genes in CD105+-CD44+-MHCII cells before and after cryopreservation and increased SOX2 expression in cells after cryopreservation supported the CFU findings.45 Differences in the number of CFUs and osteoblastic CFUs are not unusual.18 Given the longer culture period for osteogenic differentiation, some cell proliferation can occur; hence, comparisons should be limited to treatment groups within each lineage.46 The number of adipocytic CFUs was consistent with results of other studies,7,35 which indicated that there were no effects of cell sorting or cryopreservation on adipocytic plasticity. Higher leptin expression by unsorted cells may have indicated the presence of pericytes and preadipocytes.6,32 Considered together, these results highlighted the benefits of cell sorting as a method to increase the number of ASCs with greater osteoblastic differentiation potential after cryopreservation.

As indicated previously, associations between cell behavior and gene expression are not straightforward, and gene expression does not necessarily parallel protein expression.47 Intersecting cell signaling pathways drive cell behavior, so it is important to consider gene expression in light of other genes and quantifiable cell outcomes. As expected, primordial and lineage-specific gene expression consistently decreased and increased, respectively, with culture induction. However, relationships between primordial gene expression, cell sorting, and cryopreservation were less clear. Increased expression of SOX2 and Nanog in cryopreserved equine ASCs implied that primordial characteristics were enhanced or selected for, whereas increases in expression of FAS and decreases in expression of β-catenin and Notch1 might appear to suggest otherwise.35 Specifically, β-catenin, Notch1, SOX2, and Nanog cell signaling sustain cell pluripotency and proliferation, whereas enhanced FAS expression induces apoptosis in surrounding cells (including T cells) via the FAS/FAS-ligand pathway.19,22,48–51 Results may be explained by interactions among cell signaling pathways (eg, SOX2 attenuation of the wingless-integrated/β-catenin pathway via fibroblast growth factor50 or SOX2 and octamer binding transcription factor 4 regulation of Nanog expression).52 Conclusions about cell signaling are beyond the scope of the study reported here; however, it is important to mention that cryopreservation and cell sorting, separately and in combination, had variable effects on primordial gene expression. This confirmed that there are potential effects of isolation and cryopreservation on cells.

Another consideration is that higher primordial gene expression is associated with uncontrolled cell growth during neoplasia.19,53–59 Expression of SOX2 is upregulated by FAS via signaling in breast cancer cells.56 Also, β-catenin modulates the wingless-integrated signaling pathway and gene transcription of oncogenes in squamous cell carcinomas.60 Results for gene expression in the present study highlighted cell signaling in equine ASCs and emphasized the importance of further delineation to enable researchers to confidently direct and predict cell behavior. Safety and efficacy should be determined for specific cell immunophenotypes of equine ASCs isolated and cryopreserved by distinct mechanisms.

Standardization of isolation and cryopreservation procedures for equine ASCs will contribute to reproducible results for targeted cell treatments and tissue generation. Results of the study reported here indicated the use of 0.1% collagenase in the tissue digest and 5% DMSO in cryopreservation medium for isolation and cryopreservation, respectively, of equine ASCs. The results also highlighted the potential advantages of cell sorting for isolation and characterization of specific cell immunophenotypes for generation of specific tissues and confirmed that the natural cell niche includes complex interactions within a diverse cell population. It is clear that the response to environmental factors differs among immunophenotypes; hence cryopreservation differentially impacts cell isolates and may be influenced by the cryoprotectants. Variable effects on primordial gene expression were an important finding that should encourage additional studies to quantify potential short- and long-term effects on cell activity. Consistency in MSC isolation, cryopreservation, and characterization will improve results of and expand the use of equine cell treatments.

Acknowledgments

This manuscript represents a portion of a dissertation submitted by Dr. Duan to the Louisiana State University School of Veterinary Medicine as partial fulfillment for a Doctor of Philosophy degree.

Supported in part by the Grayson Jockey Club Research Foundation, Louisiana State University Equine Health Studies Program, and Louisiana State University School of Veterinary Medicine Competitive Organized Research Program.

The authors thank Dr. Chin-Chi Liu for assistance with the statistical analyses.

ABBREVIATIONS

ALP

Alkaline phosphatase

ASC

Adipose-derived multipotent stromal cell

BSP

Bone sialoprotein

Ct

Cycle threshold

DMEM

Dulbecco modified Eagle medium

DMSO

Dimethylsulfoxide

FAS

Tumor necrosis factor receptor superfamily member-6

FBS

Fetal bovine serum

GAPDH

Glyceraldehyde-3-phosphate dehydrogenase

MHCII

Major histocompatability complex class II

MSC

Multipotent stromal cell

Nanog

Nanog homeobox

Notch1

Notch homolog 1, translocation-associated

PPAR-γ

Peroxisome proliferator-activated receptor γ

SOX2

Sex determining region Y-box 2

Footnotes

a.

Hyclone, Logan, Utah.

b.

Worthington Biochemical Corp, Lakewood, NJ.

c.

Fisher Bioreagents, Fair Lawn, NJ.

d.

BD Falcon, Bedford, Mass.

e.

Fisher Scientific, Fair Lawn, NJ.

f.

CoolCell, Biocision, Larkspur, Calif.

g.

Dylight 488 NHS-Ester, Thermo Fisher Scientific, Somerset, NJ.

h.

Dylight 633 NHS-Ester, Thermo Fisher Scientific, Somerset, NJ.

i.

CD44–488, Monoclonal Antibody Center, College of Veterinary Medicine, Washington State University, Pullman, Wash.

j.

CD105-PE, eBioscience, San Diego, Calif.

k.

MHCII-633, CD44–488, Monoclonal Antibody Center, College of Veterinary Medicine, Washington State University, Pullman, Wash.

l.

FACS Calibur, BD Biosciences, San Jose, Calif.

m.

Cell Quest Pro, BD Biosciences, San Jose, Calif.

m.

almarBlue, Thermo Fisher Scientific, Somerset, NJ.

o.

E.Z.N.A. total RNA kit II, Omega Bio-tek, Norcross, Ga.

p.

NanoDrop ND-1000, NanoDrop Technologies, Montchanin, Del.

q.

Maxima First Strand cDNA synthesis kit, Thermo Fisher Scientific, Somerset, NJ.

r.

HT7900, Applied Biosystems, Darmstadt, Germany.

s.

ABsolute Blue qPCR, SYBR Green mix, ROX, Thermo Fisher Scientific, Somerset, NJ.

t.

JMP Pro, version 13, SAS Institute Inc, Cary, NC.

References

  • 1. Frisbie DD, Smith RK. Clinical update on the use of mesenchymal stem cells in equine orthopaedics. Equine Vet J 2009;42:8689.

  • 2. Marx C, Silveira MD, Beyer Nardi N. Adipose-derived stem cells in veterinary medicine: characterization and therapeutic applications. Stem Cells Dev 2015;24:803813.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 3. Millan A, Landerholm T, Chapman J. Comparison between collagenase adipose digestion and Stromacell mechanical dissociation for mesenchymal stem cell separation. McNair Sch J CSUS 2014;15:86101.

    • Search Google Scholar
    • Export Citation
  • 4. Oberbauer E, Steffenhagen C, Wurzer C, et al. Enzymatic and non-enzymatic isolation systems for adipose tissue-derived cells: current state of the art. Cell Regen (Lond) 2015;4:721.

    • Search Google Scholar
    • Export Citation
  • 5. Vidal MA, Kilroy GE, Lopez MJ, et al. Characterization of equine adipose tissue-derived stromal cells: adipogenic and osteogenic capacity and comparison with bone marrow-derived mesenchymal stromal cells. Vet Surg 2007;36:613622.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 6. Bourin P, Bunnell BA, Casteilla L, et al. Stromal cells from the adipose tissue-derived stromal vascular fraction and culture expanded adipose tissue-derived stromal/stem cells: a joint statement of the International Federation for Adipose Therapeutics and Science (IFATS) and the International Society for Cellular Therapy (ISCT). Cytotherapy 2013;15:641648.

    • Search Google Scholar
    • Export Citation
  • 7. Li H, Zimmerlin L, Marra KG, et al. Adipogenic potential of adipose stem cell subpopulations. Plast Reconstr Surg 2011;128:663672.

  • 8. Zuk PA, Zhu M, Mizuno H, et al. Multilineage cells from human adipose tissue: implications for cell-based therapies. Tissue Eng 2001;7:211228.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 9. de Mattos Carvalho A, Alves AL, Golim MA, et al. Isolation and immunophenotypic characterization of mesenchymal stem cells derived from equine species adipose tissue. Vet Immunol Immunopathol 2009;132:303306.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 10. Shen C, Xu H, Alvarez X, et al. Reduced expression of CD27 by collagenase treatment: implications for interpreting b cell data in tissues. PLoS One 2015;10:e0116667.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 11. Mattanovich D, Borth N. Applications of cell sorting in biotechnology. Microb Cell Fact 2006;5:1223.

  • 12. Garvican ER, Cree S, Bull L, et al. Viability of equine mesenchymal stem cells during transport and implantation (Erratum published in Stem Cell Res Ther 2016;7:161). Stem Cell Res Ther 2014;5:94.

    • Search Google Scholar
    • Export Citation
  • 13. Saadeh PB, Brent B, Mehrara BJ, et al. Human cartilage engineering: chondrocyte extraction, proliferation, and characterization for construct development. Ann Plast Surg 1999;42:509513.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 14. Kretlow JD, Jin YQ, Liu W, et al. Donor age and cell passage affects differentiation potential of murine bone marrow-derived stem cells. BMC Cell Biol 2008;9:6072.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 15. Thirumala S, Gimble JM, Devireddy RV. Cryopreservation of stromal vascular fraction of adipose tissue in a serum-free freezing medium. J Tissue Eng Regen Med 2010;4:224232.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 16. Gao D, Critser JK. Mechanisms of cryoinjury in living cells. ILAR J 2000;41:187196.

  • 17. Fuller BJ. Cryoprotectants: the essential antifreezes to protect life in the frozen state. Cryo Letters 2004;25:375388.

  • 18. James AW, Levi B, Nelson ER, et al. Deleterious effects of freezing on osteogenic differentiation of human adipose-derived stromal cells in vitro and in vivo. Stem Cells Dev 2011;20:427439.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 19. Valenta T, Hausmann G, Basler K. The many faces and functions of β-catenin. EMBO J 2012;31:27142736.

  • 20. Lin GL, Hankenson KD. Integration of BMP, Wnt, and Notch signaling pathways in osteoblast differentiation. J Cell Biochem 2011;112:34913501.

  • 21. Lange-Consiglio A, Corradetti B, Meucci A, et al. Characteristics of equine mesenchymal stem cells derived from amnion and bone marrow: in vitro proliferative and multilineage potential assessment. Equine Vet J 2013;45:737744.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 22. Davis TA, Anam K, Lazdun Y, et al. Adipose-derived stromal cells promote allograft tolerance induction. Stem Cells Transl Med 2014;3:14441450.

  • 23. Duan W, Lopez MJ, Hicok K. Adult multipotent stromal cell cryopreservation: pluses and pitfalls. Vet Surg 2018;47:1929.

  • 24. Quimby JM, Webb TL, Habenicht LM, et al. Safety and efficacy of intravenous infusion of allogeneic cryopreserved mesenchymal stem cells for treatment of chronic kidney disease in cats: results of three sequential pilot studies. Stem Cell Res Ther 2013;4:4869.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 25. Xie L, Zhang N, Marsano A, et al. In vitro mesenchymal trilineage differentiation and extracellular matrix production by adipose and bone marrow derived adult equine multipotent stromal cells on a collagen scaffold. Stem Cell Rev 2013;9:858872.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 26. Duan W, Lopez MJ. Effects of cryopreservation on canine multipotent stromal cells from subcutaneous and infrapatellar adipose tissue. Stem Cell Rev 2015;12:257268.

    • Search Google Scholar
    • Export Citation
  • 27. Kershaw EE, Flier JS. Adipose tissue as an endocrine organ. J Clin Endocrinol Metab 2004;89:25482556.

  • 28. Seaman SA, Tannan SC, Cao Y, et al. Differential effects of processing time and duration of collagenase digestion on human and murine fat grafts. Plast Reconstr Surg 2015;136:189e199e.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 29. Toupadakis CA, Wong A, Genetos DC, et al. Comparison of the osteogenic potential of equine mesenchymal stem cells from bone marrow, adipose tissue, umbilical cord blood, and umbilical cord tissue. Am J Vet Res 2010;71:12371245.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 30. Nixon AJ, Dahlgren LA, Haupt JL, et al. Effect of adipose-derived nucleated cell fractions on tendon repair in horses with collagenase-induced tendinitis. Am J Vet Res 2008;69:928937.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 31. Docheva D, Popov C, Mutschler W, et al. Human mesenchymal stem cells in contact with their environment: surface characteristics and the integrin system. J Cell Mol Med 2007;11:2138.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 32. Cawthorn WP, Scheller EL, MacDougald OA. Adipose tissue stem cells meet preadipocyte commitment: going back to the future. J Lipid Res 2011;53:227246.

    • Search Google Scholar
    • Export Citation
  • 33. Kolf CM, Cho E, Tuan RS. Mesenchymal stromal cells. Biology of adult mesenchymal stem cells: regulation of niche, self-renewal and differentiation. Arthritis Res Ther 2007;9:204213.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 34. Ock SA, Rho GJ. Effect of dimethyl sulfoxide (DMSO) on cryopreservation of porcine mesenchymal stem cells (pMSCs). Cell Transplant 2011;20:12311239.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 35. Yong KW, Pingguan-Murphy B, Xu F, et al. Phenotypic and functional characterization of long-term cryopreserved human adipose-derived stem cells. Sci Rep 2015;5:95969605.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 36. Liu Y, Xu X, Ma X, et al. Cryopreservation of human bone marrow-derived mesenchymal stem cells with reduced dimethylsulfoxide and well-defined freezing solutions. Biotechnol Prog 2010;26:16351643.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 37. Scheinkönig C, Kappicht S, Kolb H, et al. Adoption of long-term cultures to evaluate the cryoprotective potential of trehalose for freezing hematopoietic stem cells. Bone Marrow Transplant 2004;34:531536.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 38. Fahy GM, Lilley TH, Linsdell H, et al. Cryoprotectant toxicity and cryoprotectant toxicity reduction: in search of molecular mechanisms. Cryobiology 1990;27:247268.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 39. Dromard C, Bourin P, Andre M, et al. Human adipose derived stroma/stem cells grow in serum-free medium as floating spheres. Exp Cell Res 2011;317:770780.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 40. Matsumura K, Bae JY, Hyon SH. Polyampholytes as cryoprotective agents for mammalian cell cryopreservation. Cell Transplant 2010;19:691699.

  • 41. Dumont F, Marechal P-A, Gervais P. Cell size and water permeability as determining factors for cell viability after freezing at different cooling rates. Appl Environ Microbiol 2004;70:268272.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 42. Liu G, Zhou H, Li Y, et al. Evaluation of the viability and osteogenic differentiation of cryopreserved human adipose-derived stem cells. Cryobiology 2008;57:1824.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 43. Grottkau BE, Lin Y. Osteogenesis of adipose-derived stem cells. Bone Res 2013;1:133145.

  • 44. Pierantozzi E, Badin M, Vezzani B, et al. Human pericytes isolated from adipose tissue have better differentiation abilities than their mesenchymal stem cell counterparts. Cell Tissue Res 2015;361:769778.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 45. Duan W, Haque M, Kearney MT, et al. Collagen and hydroxyapatite scaffolds activate distinct osteogenesis signaling pathways in adult adipose-derived multipotent stromal cells. Tissue Eng Part C Methods 2017;23:592603.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 46. Baksh D, Yao R, Tuan RS. Comparison of proliferative and multilineage differentiation potential of human mesenchymal stem cells derived from umbilical cord and bone marrow. Stem Cells 2007;25:13841392.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 47. Vogel C, Marcotte EM. Insights into the regulation of protein abundance from proteomic and transcriptomic analyses. Nat Rev Genet 2012;13:227232.

  • 48. Greco SJ, Liu K, Rameshwar P. Functional similarities among genes regulated by OCT4 in human mesenchymal and embryonic stem cells. Stem Cells 2007;25:31433154.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 49. Akiyama K, Chen C, Wang D, et al. Mesenchymal-stem-cell-induced immunoregulation involves FAS-ligand-/FAS-mediated T cell apoptosis. Cell Stem Cell 2012;10:544555.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 50. Seo E, Basu-Roy U, Zavadil J, et al. Distinct functions of Sox2 control self-renewal and differentiation in the osteoblast lineage. Mol Cell Biol 2011;31:45934608.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 51. Meier E, Lam MT. Role of mechanical stimulation in stem cell differentiation. JSM Biotechnol Biomed Eng 2016;3:10601072.

  • 52. Rodda DJ, Chew JL, Lim LH, et al. Transcriptional regulation of nanog by OCT4 and SOX2. J Biol Chem 2005;280:2473124737.

  • 53. Leis O, Eguiara A, Lopez-Arribillaga E, et al. Sox2 expression in breast tumours and activation in breast cancer stem cells. Oncogene 2011;31:13541365.

    • Search Google Scholar
    • Export Citation
  • 54. Jeter CR, Badeaux M, Choy G, et al. Functional evidence that the self-renewal gene NANOG regulates human tumor development. Stem Cells 2009;27:9931005.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 55. Ezeh UI, Turek PJ, Reijo RA, et al. Human embryonic stem cell genes OCT4, NANOG, STELLAR, and GDF3 are expressed in both seminoma and breast carcinoma. Cancer 2005;104:22552265.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 56. Qadir AS, Ceppi P, Brockway S, et al. CD95/Fas increases stemness in cancer cells by inducing a STAT1-dependent type I interferon response. Cell Reports 2017;18:23732386.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 57. Chen L, Park SM, Tumanov AV, et al. CD95 promotes tumour growth. Nature 2010;465:492496.

  • 58. Benvenuto F, Ferrari S, Gerdoni E, et al. Human mesenchymal stem cells promote survival of T cells in a quiescent state. Stem Cells 2007;25:17531760.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 59. Reya T, Morrison SJ, Clarke MF, et al. Stem cells, cancer, and cancer stem cells. Nature 2001;414:105111.

  • 60. Rodriguez-Pinilla M, Rodriguez-Peralto J, Hitt R, et al. β-Catenin, NF-κB and FAS protein expression are independent events in head and neck cancer: study of their association with clinical parameters. Cancer Lett 2005;230:141148.

    • Crossref
    • Search Google Scholar
    • Export Citation

Appendix

Primer sequences used to quantify genes in equine ASCs.

LineageGeneSequenceGenBank accession No.
StromalSOX2F: CTCTGGTAGTGCTGGGACATGTGXM_003363345.3
  R: AGTACAACTCCATGACCAGCTC 
 NanogF: ACTGTCTCTCCTCTGCCTTCXM_014740545.1
  R: TCTTCCTTCTTTGCCTCG 
OsteoblasticALPF: GGAGTATGAGATGGACGAGXM_005607380.2
  R: GTAGTGAGAGTGCTTGTGCC 
 BSPF: GAAGAATCGGACGCTGAGXM_001496125.4
  R: ATCGTAGACAGGGTGGTG 
AdipocyticPPAR-γF: CCACTGACCAAAGCGAAGXM_001492430.3
  R: TGAGCGAAACTGACACCC 
 LeptinF: GTTGAAGCTGTGCCAATCCGXM_014738998.1
  R: CATCTTGGACAAACTCAGGAC 
OncogenicFASF: ACACAGACAAGCCACATCXM_014733084.1
  R: GCAATCAGTAACAGGAACAG 
 Notch1F: TTCGTGCTGCTCTTCTTCXM_014736246.1
  R: TGGTCTGTCTGGTCATCC 
 β-cateninF: CAGGTGGTGGTGAATAAGGNM_001122762.1
  R: GTTGTGGAGAGTTGTAATGG 
NAGAPDHF: AAGAAGGTGGTGAAGCAGGNM_001163856.1
  R: CTCAGTGTAGCCCAGGATG 

F = Forward. NA = Not applicable; reference gene. R = Reverse.

All Time Past Year Past 30 Days
Abstract Views 63 0 0
Full Text Views 1534 1360 197
PDF Downloads 165 57 12
Advertisement