Evaluation of ADAMTS17 in Chinese Shar-Pei with primary open-angle glaucoma, primary lens luxation, or both

James A. C. Oliver Canine Genetics Research Department, Animal Health Trust, Lanwades Park, Kentford, Newmarket, Suffolk, CB8 7UU, England

Search for other papers by James A. C. Oliver in
Current site
Google Scholar
PubMed
Close
 BVSc
,
Sophie Rustidge Canine Genetics Research Department, Animal Health Trust, Lanwades Park, Kentford, Newmarket, Suffolk, CB8 7UU, England

Search for other papers by Sophie Rustidge in
Current site
Google Scholar
PubMed
Close
,
Louise Pettitt Canine Genetics Research Department, Animal Health Trust, Lanwades Park, Kentford, Newmarket, Suffolk, CB8 7UU, England

Search for other papers by Louise Pettitt in
Current site
Google Scholar
PubMed
Close
 BSc
,
Christopher A. Jenkins Canine Genetics Research Department, Animal Health Trust, Lanwades Park, Kentford, Newmarket, Suffolk, CB8 7UU, England

Search for other papers by Christopher A. Jenkins in
Current site
Google Scholar
PubMed
Close
 MSc
,
Fabiana H. G. Farias Department of Pathobiology, College of Veterinary Medicine, University of Missouri, Columbia, MO 65211.

Search for other papers by Fabiana H. G. Farias in
Current site
Google Scholar
PubMed
Close
 PhD
,
Elizabeth A. Giuliano Department of Veterinary Medicine and Surgery, College of Veterinary Medicine, University of Missouri, Columbia, MO 65211.

Search for other papers by Elizabeth A. Giuliano in
Current site
Google Scholar
PubMed
Close
 DVM, MS
, and
Cathryn S. Mellersh Canine Genetics Research Department, Animal Health Trust, Lanwades Park, Kentford, Newmarket, Suffolk, CB8 7UU, England

Search for other papers by Cathryn S. Mellersh in
Current site
Google Scholar
PubMed
Close
 PhD

Abstract

OBJECTIVE To evaluate the coding regions of ADAMTS17 for potential mutations in Chinese Shar-Pei with a diagnosis of primary open-angle glaucoma (POAG), primary lens luxation (PLL), or both.

ANIMALS 63 Shar-Pei and 96 dogs of other breeds.

PROCEDURES ADAMTS17 exon resequencing was performed on buccal mucosal DNA from 10 Shar-Pei with a diagnosis of POAG, PLL, or both (affected dogs). A candidate causal variant sequence was identified, and additional dogs (53 Shar-Pei [11 affected and 42 unaffected] and 95 dogs of other breeds) were genotyped for the variant sequence by amplified fragment length polymorphism analysis. Total RNA was extracted from ocular tissues of 1 affected Shar-Pei and 1 ophthalmologically normal Golden Retriever; ADAMTS17 cDNA was reverse transcribed and sequenced, and ADAMTS17 expression was evaluated by quantitative reverse-transcription PCR assay.

RESULTS All affected Shar-Pei were homozygous for a 6-bp deletion in exon 22 of ADAMTS17 predicted to affect the resultant protein. All unaffected Shar-Pei were heterozygous or homozygous for the wild-type allele. The variant sequence was significantly associated with affected status (diagnosis of POAG, PLL, or both). All dogs of other breeds were homozygous for the wild-type allele. The cDNA sequencing confirmed presence of the expected variant mRNA sequence in ocular tissue from the affected dog only. Gene expression analysis revealed a 4.24-fold decrease in the expression of ADAMTS17 in ocular tissue from the affected dog.

CONCLUSIONS AND CLINICAL RELEVANCE Results supported that the phenotype (diagnosis of POAG, PLL, or both) is an autosomal recessive trait in Shar-Pei significantly associated with the identified mutation in ADAMTS17.

Abstract

OBJECTIVE To evaluate the coding regions of ADAMTS17 for potential mutations in Chinese Shar-Pei with a diagnosis of primary open-angle glaucoma (POAG), primary lens luxation (PLL), or both.

ANIMALS 63 Shar-Pei and 96 dogs of other breeds.

PROCEDURES ADAMTS17 exon resequencing was performed on buccal mucosal DNA from 10 Shar-Pei with a diagnosis of POAG, PLL, or both (affected dogs). A candidate causal variant sequence was identified, and additional dogs (53 Shar-Pei [11 affected and 42 unaffected] and 95 dogs of other breeds) were genotyped for the variant sequence by amplified fragment length polymorphism analysis. Total RNA was extracted from ocular tissues of 1 affected Shar-Pei and 1 ophthalmologically normal Golden Retriever; ADAMTS17 cDNA was reverse transcribed and sequenced, and ADAMTS17 expression was evaluated by quantitative reverse-transcription PCR assay.

RESULTS All affected Shar-Pei were homozygous for a 6-bp deletion in exon 22 of ADAMTS17 predicted to affect the resultant protein. All unaffected Shar-Pei were heterozygous or homozygous for the wild-type allele. The variant sequence was significantly associated with affected status (diagnosis of POAG, PLL, or both). All dogs of other breeds were homozygous for the wild-type allele. The cDNA sequencing confirmed presence of the expected variant mRNA sequence in ocular tissue from the affected dog only. Gene expression analysis revealed a 4.24-fold decrease in the expression of ADAMTS17 in ocular tissue from the affected dog.

CONCLUSIONS AND CLINICAL RELEVANCE Results supported that the phenotype (diagnosis of POAG, PLL, or both) is an autosomal recessive trait in Shar-Pei significantly associated with the identified mutation in ADAMTS17.

Primary open-angle glaucoma and PLL have been reported to occur as autosomal recessive traits in several dog breeds.1–7 The development of POAG, an optic neuropathy associated with increased intraocular pressure in the presence of an apparently normal iridocorneal angle, has been reported in Beagle, Norwegian Elkhound, Basset Hound, Basset Fauve de Bretagne, and Petit Basset Griffon Vendeen breeds.1,5,6,8,9 Primary lens luxation describes a spontaneous dislocation of the crystalline lens from the hyaloid fossa of the eye as a result of breakdown of the lens zonules and is mainly found in terrier breeds.4 Primary glaucoma and PLL have both been reported in Chinese Shar-Pei, but how these 2 breed-related diseases interrelate remains to be defined.4,7,10,11 Primary glaucoma has not been well characterized in Shar-Pei; anecdotally, the condition appears to be of the open-angle rather than closed-angle form.

To the authors’ knowledge, all forms of canine inherited POAG and PLL for which mutations have been identified to date are associated with independent homozygous mutations in ADAMTS10 or in ADAMTS17, which are genes known to be important in physiologic and pathological ocular processes. Two mutations in A DA MTS10 and 3 mutations in A DA M TS17 have been reported to be associated with POAG, and 1 mutation in ADAMTS17 has been reported to be associated with PLL, in various canine breeds.2–6,12,13 These 2 genes are also more generally implicated in connective tissue disorders, often being associated with > 1 phenotype in affected individuals. In Beagles, the same ADA MTS10 mutation associated with POAG is associated with reduced scleral rigidity, and in people, multiple ADAMTS17 mutations are each associated with multiple ocular phenotypes including ectopia lentis, spherophakia, myopia, and glaucoma in affected individuals along with systemic abnormalities including joint stiffness, brachydactyly, short stature, and cardiac abnormalities.12,14–20

The purpose of the study reported here was to investigate ADAMTS17 as a candidate gene for POAG and PLL in Shar-Pei. A secondary aim was to develop a DNA test that could be used to identify genetic variants significantly associated with either or both diseases in this breed.

Materials and Methods

Dogs, records review, and sample collection

Electronic records of the Animal Health Trust Canine Genetics Research Department sample database were searched for details of submitted DNA samples (buccal mucosal swab specimens) obtained from Shar-Pei of any age and either sex in which POAG, PLL, or both was diagnosed by a certified veterinary ophthalmologist. These dogs were categorized as affected Shar-Pei. Dogs with other concomitant ocular conditions were eligible for inclusion. Clinical notes in the database were reviewed, and age, sex, diagnoses, gonioscopic appearance of iridocorneal angle, and any other reported ocular anomalies were recorded.

Shar-Pei ≥ 72 months of age that underwent ophthalmic examination by 1 board-certified veterinary ophthalmologist (JACO) between November 8, 2016, and November 23, 2016, and were found to be free of clinical signs of POAG and PLL were enrolled in the study as unaffected Shar-Pei. The examination included slit-lamp biomicroscopy,a directb and indirectc ophthalmoscopy, and rebound tonometry.d Buccal mucosal swab specimens were collected from each dog. The minimum age of 72 months was selected because genetically affected dogs would be expected to show clinical signs of POAG, PLL, or both by this age.6 Age and sex of unaffected Shar-Pei were recorded.

Archived DNA samples (extracted from buccal mucosal swabs) from dogs of breeds other than Shar-Pei were used to assess whether any identified potential causal variant sequences were present in the wider canine population. No specific inclusion criteria were employed for these dogs; none had received ophthalmic examinations, and the number of samples used was determined by convenience alone.

Ocular tissue was obtained from 2 dogs. One of the dogs was an 8-year-old Shar-Pei in the affected group that had a diagnosis of POAG and underwent unilateral enucleation on welfare grounds. The other dog was a 12-year-old Golden Retriever that had been humanely euthanized for reasons unrelated to the study; prior to euthanasia, this dog underwent a complete ophthalmic examination to rule out the presence of POAG, PLL, or other suspected inherited ocular disorders. Enucleated globes from the affected Shar-Pei and the ophthalmologically normal Golden Retriever were used for confirmatory genetic analysis.

All dogs in the study were client-owned pets, and ophthalmic examination and buccal mucosal swabbing were performed after informed owner consent was obtained in writing. All experiments were conducted in accordance with the Association for Research in Vision and Ophthalmology statement for the Use of Animals in Ophthalmic and Vision Research and approved by the Animal Health Trust's Research and Ethical Approval Committee.

Buccal mucosal swab samples from individual dogs were placed in 2-mL polypropylene microcentrifuge tubes and stored at −20°C for up to 9 years until testing. The DNA was extracted from swabs with a commercially available kite used in accordance with the manufacturer's instructions. The enucleated eyes were transected along the sagittal plane, immersed in 30 mL of RNA stabilizing solution,f and stored at −80°C for up to 2 years until use. The iridocorneal angle tissues included ciliary body, iris, trabecular meshwork, and sclera and were isolated by microsurgical dissection with the aid of an operating microscopeg; RNA was extracted immediately prior to use with a commercially available kith used according to the manufacturer's instructions.

ADAMTS10 and ADAMTS17 candidate variant genotyping

An initial genetic investigation was performed on the first 10 samples from affected Shar-Pei received by our laboratory. These were genotyped for all 6 previously described canine POAG-associated and PLL-associated genetic mutations.2,3,5,6,12 Genotyping was performed by Sanger sequencing methodology, allelic discrimination, or AFLP, the choice of which was dependent on the nature of the mutation that was tested for (Appendix 1).

ADAMTS17 amplification and resequencing

Primer pairs were designedi,21,22 to amplify the coding sequence and flanking splice sites for all 23 canine ADAMTS17 exons by use of gene sequences derived from the Ensembl genome browserj,23 (Appendix 2). The PCR assays were carried out with 12-μL reaction mixtures consisting of 0.6 U of rapid-start DNA Taq polymerase,k 1X PCR buffer,l 200 μM dNTP mix,m 0.83 μM forward and reverse primers,n and 10 ng of template genomic DNA. The thermal cycling program used was as follows: initial denaturation at 95°C for 10 minutes; 35 cycles of denaturation at 95°C for 30 seconds, annealing at an optimized temperature (56° to 58°C, determined by online softwarei) for 30 seconds, and extension at 72°C for 1 minute; and a final extension phase at 72°C for 10 minutes. Prior to sequencing, agarose gel electrophoresis was performed on PCR products for each primer pair to ensure adequate amplification. Exons 1 and 2 failed to amplify by this method.

Next-generation sequencing of the remaining ADAMTS17 exons was performed after PCR assay amplification of genomic DNA for the initial 10 samples from affected Shar-Pei. Multiplex PCR assays were carried out with 17-μL reaction mixtures consisting of 0.09 U of rapid-start DNA Taq polymerase,k 1X PCR buffer,l 200μM dNTP mix,m 0.2μM each of forward and reverse primers,n and 10 ng of template genomic DNA. The thermal cycling program was as follows: 95°C for 5 minutes; 30 cycles of 95°C for 30 seconds, annealing at an optimized temperature for 60 seconds, and 72°C for 1 minute; and 72°C for 5 minutes.6 Libraries for ADAMTS17 sequencing were prepared through the use of a commercially available kit.o Sequencing of DNA from the initial 10 affected dogs was performed on a benchtop sequencing platform,p generating a dataset of 75-bp paired-end reads.

Sanger sequencing was performed for exons that failed to amplify by initial PCR assay as assessed with agarose gel electrophoresis (exons 1 and 2) or that could not be sequenced with the benchtop analyzer following multiplex PCR assay (exon 16). Sanger sequencing was performed following PCR amplification as described. An additiveq to aid amplification of GC-rich regions (1X; 2.40 μL) was included for exons 1 and 2. The same primers used for initial PCR amplification were also used for the subsequent Sanger sequencing reactions, which were performed with forward and reverse primers used separately. Sanger sequencing reactions were performed with a commercially available kit.r The 6-μL reaction mixtures consisted of 0.2X reaction mix,r 1.7X sequencing buffer,r and 0.27μM forward or reverse primer and were prepared according to the manufacturer's instructions. The thermal cycling program was 96°C for 30 seconds, followed by 45 cycles of 92°C for 4 seconds, 55°C for 4 seconds, and 60°C for 110 seconds. Sequencing products were separated on a benchtop genetic analyzer.s Next-generation sequencing results were also confirmed for these 10 affected dogs by Sanger sequencing.

Next-generation output read alignments were examined with an open-source software program,t and the data were manually browsed for variants.24 Sanger sequencing results were analyzed with a sequence handling and analysis software program.u

For any variant predicted to alter protein sequence, the level of conservation of wild-type protein sequence among selected species was visually assessed. To enable this, the relevant regions of the ADAMTS17 protein sequence for 44 different species (including Canis lupus familiaris) were downloaded from a genome browser and aligned by use of a multiple sequence alignment tool before visual inspection for conservation of the relevant amino acids.j,v

Genotyping for the ADAMTS17 candidate causal variant

Genotyping for a candidate causal variant identified in exon 22 by resequencing of ADAMTS17 was performed with an AFLP approach for all dogs included in the study. Primer pairs were designedi to amplify the candidate causal variant with gene sequences derived from the University of California–Santa Cruz bioinformatics site.w The primers selected were as follows: a tailed forward primer (ie, a primer including an added, nonspecific utility sequence), 5′-GCAGCAAAATTGAGCCTCCTTGTCCTGCATTAT-3′; a reverse primer, 5′-TCTTGTCATTGCAGACCTCCT-3′; and a third fluorescence (FAM)-labeled tailed primer, 5′6-FAM-TGACCGGCAGCAAAATTG-3′. The expected amplicon size was 287 bp. Amplification was carried out by PCR assay. Reactions (12 μL) consisted of 0.5 U of rapid-start DNA Taq polymerase,k 1X PCR buffer,l 200μM dNTP mix,m 0.17 μM forward primer, 0.42μM of reverse primer, 0.5μM of the fluorescence-labeled primer,n and 10 ng of template genomic DNA. The thermal cycling program was 95°C for 5 minutes; 35 cycles of 95°C for 30 seconds, 60°C for 30 seconds, and 72°C for 30 seconds; and 72°C for 30 minutes. Dogs were genotyped for the candidate variant by capillary electrophoresis of 5′6-FAM–labeled PCR products on genetic analyzers,s and output data were scored by use of a genotyping software package.x On the basis of results for the entire genotyping data set, a P value for association of the candidate variant with affected status (ie, presence of POAG, PLL, or both) was calculated by the Fisher exact test through the use of an open-source whole genome association analysis tool25,y with a value of P < 0.05 accepted as significant.

Synthesis and sequencing of ADAMTS17 cDNA

To confirm the candidate causal variant was present in coding genomic ADAMTS17 DNA and that it affected mRNA transcription or sequence, cDNA was reverse-transcribed from the iridocorneal angle tissue RNA obtained from 1 affected Shar-Pei and 1 ophthalmologically normal Golden Retriever and then sequenced. The cDNA was synthesized with a reverse transcription kitz used in accordance with the manufacturer's instructions. A pair of primers spanning the potential mutation identified by resequencing was designedi in accordance with cDNA sequences derived from the genome browser database.j Primer selection was as follows: forward, 5′-CGAGGACTATTCAGGCTGCTA-3′; reverse, 5′-TCTTGTCATTGCAGACCTCCT-3′. The expected amplicon size for the control sample cDNA was 194 bp. Sanger sequencing of the target cDNA region and analysis of results was performed as described for genomic DNA, with an annealing temperature of 60°C.

ADAMTS17 expression analysis

To investigate the potential effect of the candidate causal variant on the level of ADAMTS17 gene expression, relative quantification was performed by qRT-PCRaa assay. Assays were designed for the target ADAMTS17 gene and for a ubiquitously expressed housekeeping gene (TBP) for comparison. For ADAMTS17, the forward primer was 5′-GGTCT-CAATTTGGCCTTTACC-3′, and the reverse primer was 5′-CTTTACCCACTCTCCTGACATG-3′; a 5′FAM-labeled probe with the sequence ATCCTGTGCTGGC was used. For TBP, the forward primer was 5′-AGC-GAGGAAATATGCCAGAG-3′, the reverse primer was 5′-GGGAACTTCACATCACAGCTC-3′, and the probe was 5′-TTCAAGATTCAGAACATGGTGGG-3′. The qRT-PCR assay was carried out in triplicate for iridocorneal angle tissue cDNA from the affected Shar-Pei and from the ophthalmologically normal Golden Retriever (used as a control sample). Mean CT values were calculated from the triplicate samples for ADAMTS17 and TBP from both dogs. The difference between ADAMTS17 and TBP CT values (ΔCT) was calculated for each sample. The difference between the mean ΔCT values (derived from 3 samples) for the 2 dogs (ΔΔCT) was then calculated. From the ΔΔCT values, the fold change in ADAMTS17 expression in tissue from the affected dog versus that in the control sample was calculated (2−ΔΔCT), and a 2-tailed t test was performed with a value of P < 0.05 considered significant.

Results

Review of the sample database identified buccal mucosal swab specimens collected from 21 Shar-Pei affected with PLL, POAG, or both. The amount of clinical information recorded for dogs from which samples were obtained varied substantially (Supplementary Table S1, available at http://avmajournals.avma.org/doi/suppl/10.2460/ajvr.79.1.98). However, 10 dogs had a diagnosis of PLL with secondary glaucoma, 9 had a diagnosis of POAG with secondary buphthalmos and lens subluxation, and 1 had a diagnosis of POAG in one eye and PLL in the other eye. The record for 1 dog indicated that the veterinary ophthalmologist could not decide between a diagnosis of POAG and PLL. The affected Shar-Pei group comprised 11 females (10 sexually intact and 1 spayed) and 10 males (5 sexually intact and 5 neutered). The mean ± SD of the dogs at initial diagnosis was 84.9 ± 31.8 months.

The unaffected Shar-Pei group included 42 dogs (26 females [11 sexually intact and 15 spayed] and 15 males [10 sexually intact and 5 neutered]). The mean ± SD age of these dogs at the time of examination was 93.5 ± 24.7 months.

A total of 95 dogs of breeds other than Shar-Pei were selected for genotyping, including 31 breeds represented by ≤ 5 dogs each. This group comprised 49 males and 46 females; mean ± SD age was 64.1 ± 50.3 months.

Initial ADAMTS10 and ADAMTS17 candidate variant genotyping

The initial genetic investigation of samples from 10 affected Shar-Pei revealed that all were homozygous for the wild-type alleles at the chromosomal locations of both previously described canine POAG-associated variants for ADAMTS10.2,12 All 10 dogs were also homozygous for the wild-type alleles at chromosomal locations for the 4 previously described PLL-associated3 and POAG-associated5,6 ADAMTS17 variants.

ADAMTS17 resequencing and genotyping by AFLP

Visual scanning of the ADAMTS17 sequence read alignments revealed only 1 variant that segregated with disease in the first 10 affected Shar-Pei tested. The variant was identified by next-generation sequencing as a homozygous 6-bp deletion in exon 22 (Ensembl CanFam 3.1,j chromosome 3: bases 40,935,387 through 40,935,393), and this result was confirmed by Sanger sequencing (Figure 1). The variant represented an in-frame deletion predicted to result in the loss of 2 valine residues in the ancillary domain of the resultant protein (Figure 2). These residues were found to be highly conserved in this domain across species (Figure 3).

Figure 1—
Figure 1—

Representative screen capture images of output from a DNA sequence viewing program used after next-generation sequencing (A) and electropherograms produced by Sanger sequencing (B) in a study to evaluate the coding regions of ADAMTS17 for potential mutations associated with POAG, PLL, or both in Chinese Shar-Pei. Both images depict the site of a 6-bp deletion in exon 22 of ADAMTS17; Shar-Pei that had a diagnosis of POAG, PLL, or both (affected dogs) were homozygous for this variant sequence. In panel A, DNA sequence from an affected Shar-Pei is compared with the wild-type canine sequence; horizontal gray bars represent consensus with the wild-type nucleotide sequence, white bars indicate deleted nucleotide sequence, and vertical black marks depict the position of nucleotide centering at the time of screen capture. The location of the deletion was chromosome 3: bases 40,935,387 through 40,935,393 (determined by use of Ensembl CanFam3.1). In panel B, the red box delineates the same region in DNA from an affected Shar-Pei and an ophthalmologically normal (unaffected) Shar-Pei in the study.

Citation: American Journal of Veterinary Research 79, 1; 10.2460/ajvr.79.1.98

Figure 2—
Figure 2—

Depiction of DNA sequence for the ADAMTS17 region of interest identified in Figure 1 and corresponding predicted protein sequence. Sequence is shown for representative samples from an unaffected (top) and an affected (bottom) Shar-Pei. The box indicates the bases present in the unaffected dog and absent in the affected dog, and the arrow indicates the site of the deletion, which was predicted to result in the loss of 2 valine residues in the resultant protein sequence.

Citation: American Journal of Veterinary Research 79, 1; 10.2460/ajvr.79.1.98

The AFLP genotyping for the remaining 11 affected Shar-Pei revealed that all were homozygous for the same variant. Genotyping of the 42 unaffected Shar-Pei revealed that all were either homozygous (n = 18) or heterozygous (24) for the wild-type allele. The association between the deletion and affected status (ie, diagnosis of POAG, PLL, or both) calculated on the basis of results for the entire genotyping dataset (n = 63 Shar-Pei) was significant (P = 3.79 × 10 −14). Finally, the 95 dogs of breeds other than Shar-Pei that were genotyped by the same method were found to be homozygous for the wild-type allele.

ADAMTS17 cDNA sequencing and gene expression analysis

Examination of sequencing alignments confirmed that the identified 6-bp deletion was present in ADAMTS17 cDNA derived from iridocorneal angle tissue of the affected Shar-Pei and absent in that of the ophthalmologically normal Golden Retriever. This confirmed that the deletion occurred in coding genomic DNA and that the variant sequence was transcribed into mRNA.

Figure 3—
Figure 3—

Comparisons of protein sequence for a selected region of the ancillary domain of ADAMTS17 for 44 species. The 2 valine residues (delineated in red) predicted to be lost as a result of the 6-bp deletion identified in the ADAMTS17 gene of affected Shar-Pei were highly conserved among species.

Citation: American Journal of Veterinary Research 79, 1; 10.2460/ajvr.79.1.98

Mean ΔCT for ADAMTS17 relative to the housekeeping gene TBP was 3.76 for the sample from the affected Shar-Pei and 1.68 for that from the Golden Retriever, resulting in a ΔΔCT of 2.08. This corresponded to a 4.24-fold decrease in ADAMTS17 expression in the ocular tissue from the affected dog (P < 0.001).

Discussion

Primary glaucoma and PLL have previously been reported in Chinese Shar-Pei, but to the authors’ knowledge, there has been no evidence previously reported in the literature to indicate whether these 2 conditions are interrelated.7,11 We selected ADAMTS17 as a candidate gene for investigation in Shar-Pei with POAG, PLL, or both (ie, affected dogs) because this gene has previously been associated with POAG and with PLL in other dog breeds. Our results showed that all 21 affected Shar-Pei in the study were homozygous for a 6-bp deletion in exon 22 of ADAMTS17, and all 42 unaffected Shar-Pei were either homozygous or heterozygous for the wild-type allele. This provided evidence that the phenotype (POAG, PLL, or both) is inherited as an autosomal recessive trait in Shar-Pei, which is in line with all other previously published ADAMTS17 mutations associated with POAG or PLL in other dog breeds.3–8

It remains unclear whether this single mutation could cause both PLL and POAG. In the authors’ opinion, the most likely explanation for both conditions to have been diagnosed in dogs with this genotype is that it can be difficult to differentiate between them. Either POAG or PLL can cause increased intraocular pressure and lens subluxation, with an apparently normal globe size in some dogs on initial clinical examination.26 There was evidence for this in the present study; 1 ophthalmologist was unable to decide between a diagnosis of POAG and PLL in an affected dog, and another ophthalmologist diagnosed POAG in one eye and PLL in the other eye of an affected dog. However, in the latter dog, buphthalmos of both eyes was detected, and the authors believe that the observed posterior lens luxation could have been attributable to secondary lens zonule rupture, which would be more consistent with a primary diagnosis of POAG than with PLL. Furthermore, after the initial genetic investigation, an author (JACO) had the opportunity to examine 2 of the dogs that had a previous diagnosis of PLL; in this author's opinion, both dogs were affected by POAG with secondary lens instability. Both eyes in each dog were subjectively buphthalmic and had iridodonesis without anterior lens displacement. Detailed gonioscopic examination was only possible for 1 eye of 1 dog at that time and revealed an open iridocorneal angle. Thus, although it is possible that both phenotypes exist and are associated with the identified ADAMTS17 variant in this breed, it is also possible that POAG is the only primary disease which, as described in other breeds, is often seen as a chronic disease with secondary buphthalmos and resultant lens subluxation or luxation as a result of lens zonule stretching.5,6 In terriers with PLL, the lens is usually acutely displaced into the anterior chamber, causing glaucoma through obstruction of the pupil, the iridocorneal angle, or both.26 In Shar-Pei, however, the most common clinical sign of PLL has been reported to be iridodonesis, with some dogs also having buphthalmos.7 This is not consistent with the classic clinical signs of PLL and is more consistent with a chronic disease process.4,6 However, we can only speculate as to whether confusion between these conditions commonly occurs, and further characterization of these conditions is warranted.

An alternative, and perhaps less likely, explanation is that POAG and PLL are 2 distinct phenotypes in Shar-Pei that are genetically indistinguishable. In this scenario, the ADAMTS17 variant would have a deleterious effect on the lens zonules and on aqueous outflow pathways of the eye. It has been shown that individual mutations in ADAMTS17 are associated with multiple ocular phenotypes that exist simultaneously in people, including ectopia lentis (equivalent to PLL in dogs) and glaucoma, and these conditions likely relate to the function of the protein the gene encodes.17–20 Until POAG and PLL in Shar-Pei can be further characterized, we suggest they might be considered together as POAG-PLL in this breed.

Proteins of the ADAMTS family are secreted enzymes that have important roles in extracellular matrix degradation and turnover and are involved in the assembly, stability, and anchorage of microfibrils that are known to be essential components of mammalian aqueous humor outflow pathways and lens zonules.27–31 The effect that the mutation identified in the present study has on protein function remains unknown. The 6-bp deletion in exon 22 is an in-frame deletion predicted to result in the loss of 2 valine residues in the ancillary domain of the resultant protein. This domain is thought to determine substrate specificity and binding to the extracellular matrix.30 In people, mutations affecting this domain have been shown to be strongly associated with ectopia lentis and other ocular phenotypes.17,29,32 Our qRT-PCR assay data were also consistent with reduced ADAMTS17 expression in ocular tissue from an affected dog. Thus, is it possible that the mutation has deleterious qualitative (ie, functional) and quantitative effects on the protein produced. The significant association between the variant sequence and affected status (diagnosis of POAG, PLL, or both) in this study and the finding that these residues are highly conserved in the ancillary domain of the ADAMTS17 protein across species support that the deletion is causative of POAG-PLL in Shar-Pei.

Although detailed phenotypic characterization was beyond the scope of the present study, the AFLP genotyping used represents a test for a genetic mutation significantly associated with POAG-PLL in Shar-Pei, and the existence of this test can enable longitudinal clinical assessment of Shar-Pei that are homozygous for the variant allele, and thus enhance our understanding of the pathogenesis of these ocular abnormalities in the breed. Monitoring of genetically affected dogs for early signs of disease could also allow earlier interventions, which may improve the prognosis for vision; however, at this time, the most appropriate treatment remains unknown. The DNA test may also enable breeders to eliminate the variant allele, and potentially the disease, from the Shar-Pei breed over time, while allowing judicious breeding of carriers that have other, desirable genetic characteristics that are advantageous to retain.

Acknowledgments

Funded by the Dog Welfare Trust and Dogs Trust. Funding sources did not have any involvement in the study design, data analysis and interpretation, or writing and publication of the manuscript.

The authors declare that there were no conflicts of interest.

ABBREVIATIONS

AFLP

Amplified fragment length polymorphism

cDNA

Complementary DNA

CT

Cycle threshold

dNTP

Deoxynucleotide triphosphate

PLL

Primary lens luxation

POAG

Primary open-angle glaucoma

qRT-PCR

Quantitative reverse-transcription PCR

Footnotes

a.

Keeler PSL Classic, Keeler Ltd, Windsor, Berkshire, England.

b.

Keeler standard ophthalmoscope, Keeler Ltd, Windsor, Berkshire, England.

c.

Keeler Vantage Plus, Keeler Ltd, Windsor, Berkshire, England.

d.

TonoVet, ICare Finland, Vantaa, Finland.

e.

QIAmp DNA blood Midi Kit, Qiagen, Manchester, England.

f.

RNAlater, Ambion Ltd, Huntingdon, Cambridgeshire, England.

g.

Leica M841 C40, Leica Microsystems Ltd, Milton Keynes, Buckinghamshire, England.

h.

Qiagen RNeasy Midi Kit, Qiagen, Manchester, England.

i.

Primer3, version 4.0, Whitehead Institute for Biomedical Research, Cambridge, Mass. Available at: www.bioinfo.ut.ee/primer3-0.4.0/. Accessed Jul 17, 2016.

j.

Ensembl genome browser, release No. 86. Available at: www.ensembl.org/index.html. Accessed Nov 30, 2016.

k.

HotStarTaq DNA polymerase, Qiagen, Manchester, England.

l.

Qiagen PCR buffer, Qiagen, Manchester, England.

m.

dNTP mix, Fisher Scientific UK Ltd, Loughborough, Leicestershire, England.

n.

Integrated DNA Technologies, Leuven, Belgium.

o.

Nextera XT DNA Library Preparation Kit, Illumina, San Diego, Calif.

p.

MiSeq, Illumina, San Diego, Calif.

q.

Q solution, Qiagen, Manchester, England.

r.

BigDye Terminator version 3.1 Cycle Sequencing Kit, Fisher Scientific UK Ltd, Loughborough, Leicestershire, England.

s.

ABI 3130xl, Applied Biosystems, Forest City, Calif.

t.

Integrative Genomics Viewer, version 2.3, Broad Institute, Cambridge, Mass.

u.

Staden Gap4, version 2.0, Medical Research Council Laboratory of Molecular Biology, Cambridge, Cambridgeshire, England.

v.

Clustal Omega multiple sequence alignment tool. Available at www.ebi.ac.uk/Tools/msa/clustalo/. Accessed Nov 30, 2016.

w.

UCSC Genome Browser. Available at: www.genome.ucsc.edu/. Accessed Nov 30, 2016.

x.

GeneMapper, version 5.0, Life Technologies Ltd, Paisley, Renfrewshire, Scotland.

y.

Purcell S. PLINK, version 1.07. Available at: zzz.bwh.harvard.edu/plink/. Accessed Nov 30, 2016.

z.

QuantiTect Reverse Transcription Kit, Qiagen, Manchester, England.

aa.

StepOne Real-Time PCR System, Fisher Scientific UK Ltd, Loughborough, Leicestershire, England.

References

  • 1. Gelatt KN, Gum GG, Gwin RM, et al. Primary open angle glaucoma: inherited primary open angle glaucoma in the Beagle. Am J Pathol 1981; 102: 292295.

    • Search Google Scholar
    • Export Citation
  • 2. Ahonen SJ, Kaukonen M, Nussdorfer FD, et al. A novel missense mutation in ADAMTS10 in Norwegian Elkhound primary glaucoma. PLoS One 2014;9:e111941.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 3. Farias FH, Johnson GS, Taylor JF, et al. An ADAMTS17 splice donor site mutation in dogs with primary lens luxation. Invest Ophthalmol Vis Sci 2010; 51: 47164721.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 4. Gould D, Pettitt L, McLaughlin B, et al. ADAMTS17 mutation associated with primary lens luxation is widespread among breeds. Vet Ophthalmol 2011; 14: 378384.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 5. Forman OP, Pettitt L, Komaromy AM, et al. A novel genome-wide association study approach using genotyping by exome sequencing leads to the identification of a primary open angle glaucoma associated inversion disrupting ADAMTS17. PLoS One 2015;10:e0143546.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 6. Oliver JA, Forman OP, Pettitt L, et al. Two independent mutations in ADAMTS17 are associated with primary open angle glaucoma in the Basset Hound and Basset Fauve de Bretagne breeds of dog. PLoS One 2015;10:e0140436.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 7. Lazarus JA, Pickett JP, Champagne ES. Primary lens luxation in the Chinese Shar Pei: clinical and hereditary characteristics. Vet Ophthalmol 1998; 1: 101107.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 8. Bedford PG. Open-angle glaucoma in the Petit Basset Griffon Vendeen. Vet Ophthalmol 2017; 20: 98102.

  • 9. Oshima Y, Bjerkas E, Peiffer RL Jr. Ocular histopathologic observations in Norwegian Elkhounds with primary open-angle, closed-cleft glaucoma. Vet Ophthalmol 2004; 7: 185188.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 10. Curtis R. Lens luxation in the dog and cat. Vet Clin North Am Small Anim Pract 1990; 20: 755773.

  • 11. Gelatt KN, MacKay EO. Prevalence of the breed-related glaucomas in pure-bred dogs in North America. Vet Ophthalmol 2004; 7: 97111.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 12. Kuchtey J, Kunkel J, Esson D, et al. Screening ADAMTS10 in dog populations supports Gly661Arg as the glaucoma-causing variant in Beagles. Invest Ophthalmol Vis Sci 2013; 54: 18811886.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 13. Kuchtey J, Olson LM, Rinkoski T, et al. Mapping of the disease locus and identification of ADAMTS10 as a candidate gene in a canine model of primary open angle glaucoma. PLoS Genet 2011;7:e1001306.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 14. Boote C, Palko JR, Sorensen T, et al. Changes in posterior scleral collagen microstructure in canine eyes with an ADAMTS10 mutation. Mol Vis 2016; 22: 503517.

    • Search Google Scholar
    • Export Citation
  • 15. Palko JR, Iwabe S, Pan X, et al. Biomechanical properties and correlation with collagen solubility profile in the posterior sclera of canine eyes with an ADAMTS10 mutation. Invest Ophthalmol Vis Sci 2013; 54: 26852695.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 16. Palko JR, Morris HJ, Pan X, et al. Influence of age on ocular biomechanical properties in a canine glaucoma model with ADAMTS10 mutation. PLoS One 2016;11:e0156466.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 17. Morales J, Al-Sharif L, Khalil DS, et al. Homozygous mutations in ADAMTS10 and ADAMTS17 cause lenticular myopia, ectopia lentis, glaucoma, spherophakia, and short stature. Am J Hum Genet 2009; 85: 558568.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 18. Shah MH, Bhat V, Shetty JS, et al. Whole exome sequencing identifies a novel splice-site mutation in ADAMTS17 in an Indian family with Weill-Marchesani syndrome. Mol Vis 2014; 20: 790796.

    • Search Google Scholar
    • Export Citation
  • 19. Khan AO, Aldahmesh MA, Al-Ghadeer H, et al. Familial spherophakia with short stature caused by a novel homozygous ADAMTS17 mutation. Ophthalmic Genet 2012; 33: 235239.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 20. Radner FP, Marrakchi S, Kirchmeier P, et al. Mutations in CERS3 cause autosomal recessive congenital ichthyosis in humans. PLoS Genet 2013;9:e1003536.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 21. Untergasser A, Cutcutache I, Koressaar T, et al. Primer3–new capabilities and interfaces. Nucleic Acids Res 2012;40:e115.

  • 22. Koressaar T, Remm M. Enhancements and modifications of primer design program Primer3. Bioinformatics 2007; 23: 12891291.

  • 23. Yates A, Akanni W, Amode MR, et al. Ensembl 2016. Nucleic Acids Res 2016;44:D710D716.

  • 24. Thorvaldsdóttir H, Robinson JT, Mesirov JP. Integrative Genomics Viewer (IGV): high-performance genomics data visualization and exploration. Brief Bioinform 2013; 14: 178192.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 25. Purcell S, Neale B, Todd-Brown K, et al. PLINK: a tool set for whole-genome association and population-based linkage analyses. Am J Hum Genet 2007; 81: 559575.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 26. Davidson MG, Nelms SR. Diseases of the lens and cataract formation. In: Gelatt KN, ed. Veterinary ophthalmology. Ames, Iowa: Blackwell Publishing, 2013;11991233.

    • Search Google Scholar
    • Export Citation
  • 27. Alexander JP, Samples JR, Van Buskirk EM, et al. Expression of matrix metalloproteinases and inhibitor by human trabecular meshwork. Invest Ophthalmol Vis Sci 1991; 32: 172180.

    • Search Google Scholar
    • Export Citation
  • 28. Bradley JM, Vranka J, Colvis CM, et al. Effect of matrix metalloproteinases activity on outflow in perfused human organ culture. Invest Ophthalmol Vis Sci 1998; 39: 26492658.

    • Search Google Scholar
    • Export Citation
  • 29. Kelwick R, Desanlis I, Wheeler GN, et al. The ADAMTS (A Disintegrin and Metalloproteinase with Thrombospondin motifs) family. Genome Biol 2015;16:113.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 30. Hubmacher D, Apte SS. ADAMTS proteins as modulators of microfibril formation and function. Matrix Biol 2015; 47: 3443.

  • 31. Acott TS, Kelley MJ. Extracellular matrix in the trabecular meshwork. Exp Eye Res 2008; 86: 543561.

  • 32. Dubail J, Apte SS. Insights on ADAMTS proteases and ADAMTS-like proteins from mammalian genetics. Matrix Biol 2015;4446:24–37.

Appendix 1

Previously described mutations in canine ADAMTS10 and ADAMTS17, the breeds and ocular phenotypes of dogs in which they were identified, and the methods used to test for their presence in DNA samples from 10 of 21 Chinese Shar-Pei with a diagnosis of POAG, PLL, or both (affected dogs) in a study to evaluate the coding regions of ADAMTS17 for potential mutations associated with these conditions.

BreedOcular phenotypeGeneExon or intronMutation site and typeNature of mutationMethod of genotypingSource
BeaglePOAGADAMTS10Exon 15c.1981 G > AMissenseSanger sequencingKuchtey et al12
Norwegian ElkhoundPOAGADAMTS10Exon 9c.1441 G > AMissenseSanger sequencingAhonen et al2
Multiple terrier breedsPLLADAMTS17Intron 10c.1473 G > ASplice siteAllelic discriminationFarias et al3
Basset HoundPOAGADAMTS17Exon 2c.194 19-bp deletionDeletionAFLPOliver et al6
Basset Fauve de BretagnePOAGADAMTS17Exon 11c.1552 G > AMissenseAllelic discriminationOliver et al6
Petit Basset Griffon VendeenPOAGADAMTS17Intron 12Large-scale rearrangementInversionAllelic discriminationForman et al5

G > A = G-to-A transition.

Appendix 2

Primer pairs used for ADAMTS17 resequencing.

TargetPrimer sequences (5′–3′)Amplicon size (bp)Annealing temperature (°C)
Exon 1Forward: TGATTTACCACGTTGGGTTTG  
 Reverse: AGCTGGAACTGGATCCGAAG43656
Exon 2 (5’ site)*Forward: GCTGACGCGTCTCCTCTCTCCC  
 Reverse: CCGCCTCCTCCACCTCGAA28556
Exon 2 (3’ site)*Forward: CCCCGGACCCCGAAAGC  
 Reverse: GCGACTAAGCGACGGGCAGA33456
Exon 3Forward: ACATGAGGACCAGGCCAGA  
 Reverse: AGGGCTGCTACACATGAAATG47456
Exon 4Forward: TTCGATGTGCCTCAGCTCTAC  
 Reverse: GACCCAGGCACTGAAACTACA59156
Exon 5Forward: CCAACATCTTCCTCTGTTCCA  
 Reverse: GGAGAGCAGACAAGACTGACAA30056
Exon 6Forward: CATGACCTGATCAACCACTGA  
 Reverse: TTACTGATGAGGATGCCAAGG55856
Exon 7Forward: ATTGCTATGTGCAGGATGACC  
 Reverse: GCAACAGGAAAGGCAGAGTTT29356
Exon 8Forward: GGTGAATCCCAAAGCATTACA  
 Reverse: GTAATCTCTCCCGTTCCCTGA48856
Exon 9Forward: GTAGCCAAGTACAGGGCATCA  
 Reverse: CCTGGGAGAAATGAAGTAGGG56756
Exon 10Forward: TCCAATGCCTGAGTCATCTTC  
 Reverse: AACTGCCTGTGAGGGTGTATG43456
Exon 11Forward: TGAATTCCAAGTCCAAACCAG  
 Reverse: CCAGTGGAGCTTTAGGCACTAT31556
Exon 12Forward: TGCAGTGATCTGGTGAGTGAG  
 Reverse: GCTTTGTTGAAGCTGAGATGC42656
Exon 13Forward: GGAGGTTGCTTTGGAAACTCT  
 Reverse: ACTCTCCCAGAGTTGGGTCAT49056
Exon 14Forward: GAACATGTGCTGGGTTTCTGT  
 Reverse: GTGGGCTTTATGCTCAGTCAC49056
Exon 15Forward: CCTAGGCACCAACACTTGCT  
 Reverse: GCCTTTCAGCAAGCATAACAC45058
Exon 16Forward: CTGTGAGCCAGTCTTCCATTC  
 Reverse: ACCAGAACCCAGGTGATCTCT43256
Exon 17Forward: GGAGGGGGAATATTCTCAGG  
 Reverse: GCCAGTCTTCCATTCTCAGC53656
Exon 18Forward: TCTGAGGAACCCAAGAGTGAA  
 Reverse: GTTCCTGTGGAGAGACAGGTG44956
Exon 19Forward: GCCATGTCTTACACACCCTCA  
 Reverse: GCAAGCAGAAGTCACTTAGCAA46856
Exon 20Forward: TGAGTACATTTCCCTCCCTCA  
 Reverse: GGCAAGGACTGTGATACTTGG45856
Exon 21Forward: TCAGACTCTAGATGCCCAGGA  
 Reverse: CTCTAGGGAGCATTGGGTTTC49056
Exon 22Forward: AGCCTCCTTGTCCTGCATTAT  
 Reverse: AATCCCATCTCTGCAACCTCT48956
Exon 23Forward: CGAGTGAGGGCAGCTTAGAGT  
 Reverse: TCAGGTTCACGCTCAAGTTCT46956

The 2 primer pairs amplified overlapping regions of this exon.

Supplementary Materials

All Time Past Year Past 30 Days
Abstract Views 260 0 0
Full Text Views 1403 808 39
PDF Downloads 815 303 32
Advertisement