The thymus is a primary lymphoid organ that provides a specialized microenvironment for T-cell maturation.1 Mature T cells migrate from the thymus to secondary lymphoid organs such as the spleen, hemal nodes, and lymph nodes,2 thereby providing an efficient immunologic defense against invading antigens. Depending on the molecules expressed on the cell surface, T lymphocytes are further differentiated into CD4+ T helper cells that bind to MHC class II molecules and CD8+ cytotoxic T cells that recognize MHC class I molecules.3,4 Those T helper cells have an important role in the adaptive immune system by orchestrating a cascade of reactions resulting in secretion of proinflammatory cytokines and cytotoxic molecules and the expression of CD4 glycoprotein at the cell surface.5 The cytotoxic T cells that express the CD8 glycoprotein at their surface eliminate virus-infected cells and tumor cells by means of cell-mediated cytotoxicity.6 Cell-mediated cytotoxicity is itself achieved through exocytosis of the cytotoxic T cells’ cytoplasmic granules, which are composed of a pore-forming protein (perforin) and enzymes (including granzymes) that induce the apoptotic death of the target cells. Additionally, the activation of helper T cells is a prerequisite for the responses of cytotoxic T lymphocytes and B cells.7 Overall, expression of CD4 and CD8 on the T-cell surface is critical for cell-mediated immune functions.
The yak (Bos grunniens) is an iconic symbol of Tibet and of life at high altitude. More than 14 million domestic yaks provide the basic resources (eg, meat, milk, transportation, dung for fuel, and hides for tented accommodation) that are necessary for Tibetans and other nomadic pastoralists living in high-altitude environments.8 Highland plateaus are characterized by strong UV radiation, and such environments induce hypoxia and hypothermia among resident mammals. It has been reported that hypoxia impairs T-cell activation, proliferation, and effector functions such as cytotoxicity and cytokine production.9,10 Interestingly, in contrast to the closely related low-altitude cattle (Bos taurus), yaks living on highland plateaus have evolved and adapted to the harsh environment and are less susceptible to disease.8,11 Additionally, results of epidemiological surveys11,12 suggest that highland-plateau yaks develop bacterial and parasitic infections only sporadically. Thus, an important question to ask is whether the T-cell markers (CD4 and CD8α) in highland-plateau yak lymphoid organs have a pattern of age-related changes that differs from those found in other mammals.
Many investigators have examined age-related changes in the markers of T-cell subsets in attempts to elucidate age-dependent changes in immune function for development of prophylactic vaccines and therapeutic approaches for various diseases. Presently, there is considerable information concerning the development of T cells in various species such as cattle,13 pigs,14,15 cats,16 dogs,17 and rabbits.18 However, no information is available regarding the ontogeny and development of CD4 and CD8α expression in yaks, to our knowledge. The objective of the study reported here was to investigate the distribution of T-cell markers (CD4 and CD8α) in lymphoid organs of newborn, juvenile, and adult highland-plateau yaks. The expression of CD4 and CD8α mRNAs and the distribution of CD4+ and CD8α+ cells in various lymphoid organs were assessed by quantitative RT-PCR assays and immunohistochemical analysis, respectively, to determine age-related changes. In addition, the morphological characteristics of lymphoid organs in newborn and older yaks were also studied. The intent was to enhance knowledge of the age-related development and tissue distribution of CD4 and CD8α in yak lymphoid organs, which may shed light on the T-cell-mediated immunity in highland-plateau yaks.
Materials and Methods
Animals
Fifteen highland-plateau yaks were used for the study. They were purchased at the same time from small holders in Datong County of Qinghai province, People's Republic of China. All experiments complied with the Regulation of Animal Experimentation of Qinghai province.
Experimental design
For each of the 3 age groups (newborn [1 to 7 days old], juvenile [5 to 7 months old], and adult [3 to 4 years old]), 5 highland-plateau yaks were randomly selected and euthanized by means of IV injection of pentobarbital sodium (200 mg/kg). The thymus, spleen, and 5 lymph nodes and 5 hemal nodes in the mesenteric region were collected. For the quantitative RT-PCR assays, the samples were placed in an aqueous, nontoxic tissue storage reagenta immediately and then stored in liquid nitrogen for RNA extraction. For immunohistochemical straining, the samples were immersion-fixed in 4% paraformaldehyde for 24 hours, dehydrated, and embedded in paraffin. The paraffin-embedded tissues were sectioned at 4 μm for subsequent staining.
Immunohistochemical analysis
The spatial distribution of T helper lymphocytes and cytotoxic T lymphocytes in the fixed lymphoid organs was evaluated by immunohistochemical staining. Immunohistochemical analysis was performed by use of the avidin-biotin-peroxidase method. Briefly, lymphoid tissue sections were deparaffinized in xylene and rehydrated through a graded series of alcohols. High-temperature antigen retrieval on section slides was performed in a microwave oven for 7 minutes, after which the slides were allowed to cool to room temperature (approx 20°C) over a period of 30 minutes. Subsequently, the sections were incubated in 3% H2O2 for 10 minutes at 37°C. After 3 rinses with 0.01M PBS solution, tissue sections were blocked for 10 minutes in normal goat serumb and blotted dry. Primary antibodies (mouse anti-bovine CD4 antibody [clone CC30] and mouse anti-bovine CD8α antibody [clone CC63])c,d were applied, and sections were incubated at 4°C overnight (approx 16 hours). These antibodies were commercially available products and were developed in mice against bovine CD4c and CD8αd molecules. Antibodies were used at a dilution of 1:50. Bovine serum albumin was used as a negative control specimen, mouse IgG at a dilution of 1:200 in 2% normal goat serum was used as an isotype control specimen, yak heart tissue was used as a tissue control, and bovine spleen tissue was used as a positive control specimen to ensure that the antibodies and kits were working as specified. After incubation, the slides were washed and blotted 3 times, and the biotinylated secondary antibodyb was applied for a 15-minute incubation period at room temperature. Section slides were washed in the diluted PBS solution and incubated with peroxidase complexb for 10 minutes at room temperature. Sections were treated with 3-amino-9-ethylcarbazole for 30 minutes, lightly counterstained with hematoxylin, and mounted on slides.19
Quantitative RT-PCR assays of yak CD4 and CD8α transcripts
Total RNA was isolated from fresh frozen thymic tissues to determine expression of the genes for CD4, CD8α, and β-actin. Briefly, RNA was eluted in 30 μl of RNase-free water, and its quality and quantity were assessed with a commercial analysis kite for automated electrophoresisf as described.20 First-strand cDNA was synthesized by use of oligo (dT) priming and reverse transcriptase.g The RT-PCR primers (Appendix) used to determine the relative quantitative expressions of those genes were designed on the basis of B grunniens sequences (GenBank accession Nos. KP030826, KP030823, and DQ838049.1). A thermocyclerh was used for all RT-PCR reactions. Each reaction had a volume of 20 μL, which contained 200 ng of total cDNA and 100nM each of the appropriate forward and reverse primers. The RT-PCR reaction conditions were 3 minutes at 95°C, then 40 cycles of each of the following: 20 seconds at 95°C, 20 seconds at 60°C, and 15 seconds at 72°C. A melting curve analysis was performed from 65° to 95°C in 0.5°C increments, each of which lasted 5 seconds, to confirm the presence of a single product and the absence of primer-dimers. The threshold was determined automatically by the thermocycler software.h The gene expression levels were quantified by use of β-actin as a reference gene expression for cDNA normalization. The comparative cycle threshold method was used to quantify the relative expression of each gene as described.21 Each sample was tested in duplicate, and a nontemplate control was used to monitor for contamination.
Statistical analysis
The distributions of immunohistochemically stained cells among all lymphoid organs from the 3 age groups were assessed subjectively by microscopic observation.1–3 The relative mRNA expressions among groups are reported as mean ± SD. Statistical analysis was performed with a statistical software.i Normality of data distribution was assessed via the Shapiro-Wilk test before each test, and values of P > 0.05 were considered indicative of data distribution normality. Analyses of differences were performed with a 1-way ANOVA, followed by a Tukey multiple group comparisons test. Overall, values of P < 0.05 were considered significant.
Results
Thymus
In the thymus of newborn yaks (1 to 7 days old), the lobule formation was completed, and it was possible to distinguish the medulla from the cortex (Figure 1). The CD4+ cells were located in the cortex and medulla of the newborn thymus. However, only a few CD8α+ cells were detected. In juvenile yaks (5 to 7 months old), the thymic septum was infiltrated by discrete fat cells. The number of CD8α+ cells was increased, compared with the number in newborn yak thymus, and these cells were mostly located in the thymic cortex and medulla. Thymic CD4+ cells were also present. Sections of the thymus of adult yaks (3 to 4 years old) had an unclear corticomedullary delineation and an increase in the amount of adipose and connective tissue, compared with thymic tissues of newborn and juvenile yaks. The CD4+ and CD8α+ cells were assembled in the cortex and medulla of the thymus. However, the CD8α+ cells were more prevalent than CD4+ cells in the adult thymus. Overall, the number of CD4+ cells in the yak thymus decreased in an age-related manner, whereas the number of CD8α+ cells increased in an age-related manner.
Representative photomicrographs of thymus sections from healthy male highland-plateau yaks in 3 age groups (newborn [1 to 7 days old; A, D, and G], juvenile [5 to 7 months old; B, E, and H], or adult [3 to 4 years old; C, F, and I]) illustrating histologic changes (A through C) and the localization of CD4+ cells (D through F) and CD8α+ cells (G through I). To assess the histologic changes, sections were stained with H&E stain. To assess the localization of CD4+ cells and CD8α+ cells, primary antibodies (mouse anti-bovine CD4 antibody and mouse anti-bovine CD8α antibody) were applied and sections were counterstained with hematoxylin; cells positive for CD4 or CD8α antigen appear red. Bar = 100 μm. Inserts in panels D through I—Higher-magnification views of the thymic CD4+ cells and CD8α+ cells. Bar = 20 μm. Co = Cortex. F = Fat tissue. M = Medulla.
Citation: American Journal of Veterinary Research 78, 5; 10.2460/ajvr.78.5.609
Spleen
In spleen of newborn yaks, the boundary between red pulp and white pulp was clear, but follicles could not be detected in white pulp (Figure 2). The number of CD4+ cells was much greater than the number of CD8α+ cells; the CD4+ cells were mostly located around the periarteriolar lymphoid sheaths and red pulp of the spleen. In the sections of juvenile and adult spleen, follicles were detected. The CD4+ and CD8α+ cells were mostly scattered in the periarteriolar lymphoid sheaths and the lymphatic cords and sinuses; a few positive cells were also located in the center of follicular areas. In the adult spleen, the CD8α+ cells were more prevalent than CD4+ cells. Overall, the number of CD4+ cells in the yak spleen decreased in an age-related manner, whereas the number of CD8α+ cells slightly increased in an age-related manner.
Representative photomicrographs of spleen sections from healthy male highland-plateau yaks in 3 age groups (newborn [A, D, and G], juvenile [B, E, and H], or adult [C, F, and I]) illustrating histologic changes (A through C) and the localization of CD4+ cells (D through F) and CD8α+ cells (G through I). To assess the histologic changes, sections were stained with H&E stain; immunohistochemical staining was used to identify CD4+ cells and CD8α+ cells, which appear red. Bar = 100 μm. Inserts in panels D through I—Higher-magnification views of the splenic CD4+ cells and CD8α+ cells. Bar = 20 μm. A = Central artery. Fo = Follicle. RP = Red pulp. See Figure 1 for remainder of key.
Citation: American Journal of Veterinary Research 78, 5; 10.2460/ajvr.78.5.609
Mesenteric lymph nodes
In mesenteric lymph nodes of newborn yaks, the boundary between cortex and medulla was clearly defined, but lymphoid follicles were not identified (Figure 3). The number of CD4+ cells was much greater than the number of CD8α+ cells; the CD4+ cells were mostly located in the lymphatic cords along the sinus of the medulla. The cortex of mesenteric lymph nodes of juvenile and adult yaks was filled with follicles, which were flattened and oval. Most CD4+ and CD8α+ cells were also mainly scattered in the lymphatic cords and the sinuses of the medulla, with only a few cells in the follicles. The CD8α+ cells were more prevalent than CD4+ cells in the mesenteric lymph nodes of adult yaks. Overall, the number of CD4+ cells in yak mesenteric lymph nodes decreased in an age-related manner, whereas the number of CD8α+ cells increased in an age-related manner.
Representative photomicrographs of mesenteric lymph node sections from healthy male highland-plateau yaks in 3 age groups (newborn [A, D, and G], juvenile [B, E, and H], or adult [C, F, and I]) illustrating histologic changes (A through C) and the localization of CD4+ cells (D through F) and CD8α+ cells (G through I). To assess the histologic changes, sections were stained with H&E stain; immunohistochemical staining was used to identify CD4+ cells and CD8α+ cells, which appear red. Bar = 100 μm. Inserts in panels D through I—Higher-magnification views of the splenic CD4+ cells and CD8α+ cells. Bar = 20 μm. See Figures 1 and 2 for remainder of key.
Citation: American Journal of Veterinary Research 78, 5; 10.2460/ajvr.78.5.609
Hemal nodes
In hemal nodes of newborn yaks, the distinction between cortex and medulla was clearly defined, but lymphoid follicles were not identified (Figure 4). The number of CD4+ cells was much greater than the number of CD8α+ cells; the CD4+ cells were mostly located in the lymphatic cords and the sinuses of the medulla. The cortex of hemal nodes of juvenile and adult yaks was fully developed, and primary and secondary follicles were visible in the cortex. Most CD4+ and CD8α+ cells were also mainly scattered in the lymphatic cords and the sinuses, with only a few cells in the follicles that had germinal centers. The CD8α+ cells were more prevalent than CD4+ cells in the hemal nodes of adult yaks. Overall, the number of CD4+ cells in yak hemal nodes decreased in an age-related manner, whereas the number of CD8α+ cells increased in an age-related manner.
Representative photomicrographs of hemal node sections from healthy male highland-plateau yaks in 3 age groups (newborn [A, D, and G], juvenile [B, E, and H], or adult [C, F, and I]) illustrating histologic changes (A through C) and the localization of CD4+ cells (D through F) and CD8α+ cells (G through I). To assess the histologic changes, sections were stained with H&E stain; immunohistochemical staining was used to identify CD4+ cells and CD8α+ cells, which appear red. Bar = I00 μm. Inserts in panels D through I—Higher-magnification views of the hemal node CD4+ cells and CD8α+ cells. Bar = 20 μm. See Figures 1 and 2 for remainder of key.
Citation: American Journal of Veterinary Research 78, 5; 10.2460/ajvr.78.5.609
Analysis of yak CD4 and CD8α mRNA expressions
Results of the analysis of yak CD4 mRNA or CD8α mRNA expression in the lymphoid organs of newborn, juvenile, and adult yaks were summarized as the relative expression of each gene in relation to β-actin expression (Figure 5). Among all the yak lymphoid organs examined, the thymus had the highest expressions of CD4 and CD8α mRNA in each age group. The expression of CD4 mRNA in the thymus, spleen, mesenteric lymph nodes, and hemal nodes of newborn and juvenile yaks was higher than the expression level in the corresponding tissue in adult yaks. Furthermore, the expression of CD8α mRNA in the 4 lymphoid organs was higher in juvenile and adult yaks, compared with findings for the respective organs in newborn yaks. Results indicated that compared with findings in newborn yaks, CD4 mRNA expression in the thymus, spleen, mesenteric lymph nodes, and hemal nodes each decreased significantly and CD8α mRNA expression in each of those lymphoid organs increased significantly in adult yaks. Overall, CD4 mRNA expression in the thymus, spleen, mesenteric lymph nodes, and hemal nodes of yaks decreased in an age-related manner, whereas CD8α mRNA expression in each of those lymphoid organs increased in an age-related manner.
Expression of CD4 (A) and CD8α (B) mRNA (relative to β-actin mRNA expression) determined by quantitative RT-PCR assays in samples of the thymus (blue bars), spleen (red bars), mesenteric lymph node (green bars), and hemal node (purple bars) obtained from healthy male highland-plateau yaks in 3 age groups (newborn, juvenile, or adult; 5 yaks/group). Yak β-actin was amplified as an internal control. Data are reported as mean ± SD. a–fFor a given variable, mean values with different letters are significantly different (P < 0.05).
Citation: American Journal of Veterinary Research 78, 5; 10.2460/ajvr.78.5.609
Discussion
The T cells are most important for cellular immunity and are involved in cell-mediated cytotoxic adaptive immunity.22 Even though yaks are an important domestic animal in the highland plateaus, little is known about the tissue distribution profile and the ontogeny of T lymphocytes in this species. To address these questions, the quantitative and qualitative measurements of CD4 and CD8α expressions in newborn, juvenile, and adult yaks were undertaken.
During aging, the morphological changes of yak lymphoid organs were evident. In the thymus of yaks, the prominent change was characterized by a replacement of the functional lymphoepithelial tissue with adipose and connective tissues. This finding was basically concordant with results of other studies in humans23 and other mammals.19,24–26 In secondary lymphoid organs, no obvious follicles and germinal centers were observed in newborn yaks, whereas visible lymphoid follicles were detected in juvenile and adult yaks. All the aforementioned characteristics could relate to stages of development of secondary lymphoid organs; as yaks gradually mature, their lymphoid organs become better developed. Additionally, the absence of germinal centers in secondary lymphoid organs in the early postnatal period of life may be explained by minimal antigen stimulation.
The distribution of immunocompetent cells in the thymus, spleen, lymph nodes, and hemal nodes has been established.18,27–31 In yak thymus, the highest numbers of CD4+ or CD8α+ cells were always found in cortex and medulla, in keeping with findings in other eutherian mammals18,30,31 and marsupials.27 In secondary lymphoid organs, CD4+ or CD8α+ cells were located predominantly in the T-cell-dependent areas, namely the medulla of the lymph nodes and hemal nodes, periarteriolar lymphoid sheaths, and red pulp of the spleen. The same finding was obtained in the studies of other ruminants,30,31 rabbits,18 and tammar wallabies.27 It is likely that the medulla might be a major antigen-trapping site, in which many antigen-presenting cells such as macrophages and dendritic cells are distributed in the cords and sinuses to encompass the external antigen from lymphatic and blood vessels.31 Moreover, it was concluded that the distributions of CD4+ and CD8+ T-cells were related to the occurrence of external antigen trapping.31 Interestingly, an unusual finding in the present study was the appearance of CD8α+ cells at the germinal center of the secondary lymphoid tissues in the adult yaks. This observation is in sharp contrast to the situation in secondary lymphoid tissues in other mammals, including humans,29 sheep,28 and cattle,31 where CD4+ T cells are commonly observed and CD8+ T cells are rarely found in the germinal centers of follicles. It is known that follicular CD4+ helper T cells are able to induce B cells to differentiate, proliferate, and synthesize immunoglobulin.32 The CD8+ cytotoxic T cells are not capable of providing this same helper function to B cells, but instead can suppress immunoglobulin secretion by B cells along with T-cell responses.33 It is unknown whether this observation is representative of secondary lymphoid tissues in the adult yaks, and further analysis of this tissue type is required to confirm these findings.
Among all the yak lymphoid organs evaluated in the present study, CD4 and CD8α mRNA expressions in the thymus were always higher than those of the spleen, mesenteric lymph node, or hemal node in any age group. These patterns were similar to those found in cattle,13 pigs,14,15 dogs,17 and rabbits.18 These expression discrepancies among lymphoid tissues were a consequence of most thymocytes expressing CD4 and CD8α markers. The thymus is responsible for T-lymphocyte differentiation and maturation. The cells in the thymic cortex productively rearrange their T-cell receptor and complete the transition to single-positive CD4+ or CD8+ T lymphocytes. These cells then pass into the thymic medulla to further differentiate, mature, and migrate to the blood and lymphatic systems.34 After leaving the thymus, these T cells begin the process of trafficking through the secondary lymphoid tissues (ie, lymph nodes, mucosa-associated lymphoid tissue, and spleen). Thus, 2 factors—thymic production of T lymphocytes and lymphocyte trafficking—may influence the expression level of CD4 and CD8α mRNA in secondary lymphoid tissues. However, the migration mechanisms of the CD4+ and CD8+ T cells in lymphoid tissues require further study.
In newborn yaks, CD4 mRNA expression and the number of CD4+ lymphocytes were high, whereas cytotoxic T cells represented a minor subset in the T-lymphoid compartment. Similar findings have also been described for cattle, the most closely related species studied.13 This phenomenon is usually interpreted as high availability of naïve T-helper lymphocytes in the early stage of life because of the blocking effect of passive maternal immunity with subsequent reduced antigenic stimulation and lymphoid traffic and recruitment. In addition, on the basis of investigation of the postnatal development of T-cell subsets in piglets, Borghetti et al35 and Basha et al36 concluded that the fetoplacental environment produces growth hormone, cytokines (interleukin-4, interleukin-5, and interleukin-10), prostaglandin E2, and progesterone, which are likely to influence the fetus and subsequently the newborn animal, thereby resulting in enhancement toward T helper cell production.
Among the highland-plateau yaks used in the present study, the most obvious change during maturation was an increase of CD8α mRNA and protein expression. A considerably high level of CD8α mRNA expression and the predominant distribution of CD8α+ cells were found in lymphoid organs of juvenile and adult yaks, whereas CD4 mRNA and protein expression occurred in a relative minor cell subset in the T-lymphoid compartment. This appears to be an age-related event that is common to all mammals and is most evident in old individuals. A similar finding was obtained in studies of pigs,14,15 cats,16 dogs,17 and rabbits.18 Bortnik et al16 concluded from results of their study of cats that the maturation of CD8+ T cells had been promoted, compared with maturation of their CD4+ counterparts, during postnatal thymopoiesis. Without any kinetics data, such a conclusion remains in the field of speculation. Because huge expansion and redistribution of peripheral lymphocytes occur on exposure to external antigens, including intracellular bacteria and viruses, it is probable that not only thymic but also peripheral regulatory mechanisms are involved in the increased number of MHC class I-restricted CD8+ T cells detected as mammals age.
To our knowledge, the present study was the first in which the development and tissue distribution of CD4+ and CD8α+ cells in lymphoid organs of highland-plateau yaks were evaluated. The CD4 mRNA expression and subjectively determined number of CD4+ T cells in yak lymphoid organs decreased in an age-related manner, whereas the CD8α mRNA expression and subjectively determined number of CD8α+ T cells increased in an age-related manner. Additionally, CD8+ cells were detected in the follicles of yak secondary lymphoid organs, a finding that differs from findings in other mammals. The present study has provided data for further investigation of immunologically adaptive mechanisms in mammals in the highland-plateau environment.
Acknowledgments
Supported by The National Natural Science Foundation of China (grant No. 31572478).
ABBREVIATIONS
| MHC | Major histocompatibility complex |
| RT-PCR | Real-time PCR |
Footnotes
RNA later, Invitrogen, Carlsbad, Calif.
SP Kit (Mouse), Bioss, Beijing, China.
CD4 monoclonal antibodies (MCA834GA), AbD Serotec, BioRad, Munich, Germany.
CD8 monoclonal antibodies (MCA837GA), AbD Serotec, BioRad, Munich, Germany.
Experion RNA StdSens Analysis Kit, BioRad, Munich, Germany.
BioRad, Munich, Germany.
SuperScript II RNase H reverse transcriptase, Gibco, BRL, Life Technologies GmbH, Eggenstein, Germany.
LightCycler480 thermocycler, Invitrogen, Carlsbad, Calif.
IBM SPSS Statistics, version 20.0, IBM SPSS Inc, Armonk, NY.
References
1. Rodewald HR. Thymus organogenesis. Annu Rev Immunol 2008; 26:355–388.
2. Linton PJ, Dorshkind K. Age-related changes in lymphocyte development and function. Nat Immunol 2004; 5:133–139.
3. Germain RN. T-cell development and the CD4-CD8 lineage decision. Nat Rev Immunol 2002; 2:309–322.
4. König R, Germain RN. MHC class II interaction with CD4 mediated by a region analogous to the MHC class I binding site for CD8. Nature 1992; 356:796–798.
5. Abbas AK, Murphy KM, Sher A. Functional diversity of helper T lymphocytes. Nature 1996; 383:787–793.
6. Shresta S, Pham CT, Thomas DA, et al. How do cytotoxic lymphocytes kill their targets? Curr Opin Immunol 1998; 10:581–587.
7. Takata H, Naruto T, Takiguchi M. Functional heterogeneity of human effector CD8+ T cells. Blood 2012; 119:1390–1398.
8. Wiener G, Han JL, Long RJ. Production characteristics of yak. In: The yak. 2nd ed. Bangkok, Thailand: Regional Office for Asia and the Pacific Food and Agriculture Organization of the United Nations, 2003; 136–137.
9. Mancino A, Schioppa T, Larghi P, et al. Divergent effects of hypoxia on dendritic cell functions. Blood 2008; 112:3723–3734.
10. Ohta A, Diwanji R, Kini R, et al. In vivo T cell activation in lymphoid tissues is inhibited in the oxygen-poor microenvironment. Front Immunol 2011; 2:27–39.
11. Ji QM. Advances in research of yak resources in China. J Nat Resour 2001; 16:564–570.
12. Yin MY, Zhou DH, Liu JZ. Prevalence of yak main parasitic diseases in China and strategies for its control. China Anim Husb Vet Med 2014; 41:227–230.
13. Wilson RA, Zolnai A, Rudas P, et al. T-cell subsets in blood and lymphoid tissues obtained from fetal calves, maturing calves, and adult bovine. Vet Immunol Immunopathol 1996; 53:49–60.
14. Bianchi ATJ, Zwart RJ, Jeurissen SHM, et al. Development of the B-and T-cell compartments in porcine lymphoid organs from birth to adult life: an immunohistological approach. Vet Immunol Immunopathol 1992; 33:201–221.
15. Joling P, Bianchi AT, Kappe AL, et al. Distribution of lymphocyte subpopulations in thymus, spleen, and peripheral blood of specific pathogen free pigs from 1 to 40 weeks of age. Vet Immunol Immunopathol 1994; 40:105–117.
16. Bortnick SJ, Orandle MS, Papadi GP, et al. Lymphocyte subsets in neonatal and juvenile cats: comparison of blood and lymphoid tissues. Lab Anim Sci 1999; 49:395–400.
17. Faldyna M, Sinkora J, Knotigova P, et al. Lymphatic organ development in dogs: major lymphocyte subsets and activity. Vet Immunol Immunopathol 2005; 104:239–247.
18. Jeklova E, Leva L, Faldyna M. Lymphoid organ development in rabbits: major lymphocyte subsets. Dev Comp Immunol 2007; 31:632–644.
19. Lubis I, Ladds PW, Reilly LR. Age associated morphological changes in the lymphoid system of tropical cattle. Res Vet Sci 1982; 32:270–277.
20. Fleige S, Pfaffl MW. RNA integrity and the effect on the realtime qRT-PCR performance. Mol Aspects Med 2006; 27:126–139.
21. Pfaffl MW, Horgan GW, Dempfle L. Relative expression software tool (REST) for group-wise comparison and statistical analysis of relative expression results in real-time PCR. Nucleic Acids Res 2002; 30:e36.
22. Bluestone JA, Mackay CR, O'Shea JJ, et al. The functional plasticity of T cell subsets. Nat Rev Immunol 2009; 9:811–816.
23. Haynes BF, Sempowski GD, Wells AF, et al. The human thymus during aging. Immunol Res 2000; 22:253–261.
24. Contreiras EC, Lenzi HL, Meirelles MN, et al. The equine thymus microenvironment: a morphological and immunohistochemical analysis. Dev Comp Immunol 2004; 28:251–264.
25. Hale LP, Clark AG, Li J, et al. Age-related thymic atrophy in the guinea pig. Dev Comp Immunol 2001; 25:509–518.
26. Plecaš-Solarovic B, Pešic V, Radojevic K, et al. Morphometrical characteristics of age-associated changes in the thymus of old male Wistar rats. Anat Histol Embryol 2006; 35:380–386.
27. Duncan LG, Nair SV, Deane EM. Immunohistochemical localization of T-lymphocyte subsets in the developing lymphoid tissues of the tammar wallaby (Macropus eugenii). Dev Comp Immunol 2012; 38:475–486.
28. Maddox JF, Mackay CR, Brandon MR. Surface antigens, SBU-T4 and SBUT8, of sheep T-lymphocyte subsets defined by monoclonal antibodies. Immunology 1985; 55:739–787.
29. Poppema S, Bhan AK, Reinherz EL, et al. Distribution of T cell subsets in human lymph nodes. J Exp Med 1981; 153:30–41.
30. Thorp BH, Seneque S, Staute K, et al. Characterization and distribution of lymphocyte subsets in sheep haemal nodes. Dev Comp Immunol 1991; 15:393–400.
31. Zhang W, Nasu T, Hosaka YZ, et al. Comparative studies on the distribution and population of immunocompetent cells in bovine haemal node, lymph node and spleen. J Vet Med Sci 2012; 74:405–411.
32. Breitfeld D, Ohl L, Kremmer E, et al. Follicular B helper T cells express CXC chemokine receptor 5, localize to B cell follicles, and support immunoglobulin production. J Exp Med 2000; 192:1545–1552.
33. Effros RB, Cai Z, Linton PJ. CD8 T cells and aging. Crit Rev Immunol 2003; 23:1–2.
34. Halkias J, Melichar HJ, Taylor KT, et al. Tracking migration during human T cell development. Cell Mol Life Sci 2014; 71:3101–3117.
35. Borghetti P, De Angelis E, Saleri R, et al. Peripheral T lymphocyte changes in neonatal piglets: relationship with growth hormone (GH), prolactin (PRL) and cortisol changes. Vet Immunol Immunopathol 2006; 110:17–25.
36. Basha S, Surendran N, Pichichero M. Immune responses in neonates. Expert Rev Clin Immunol 2014; 10:1171–1184.
Appendix
Primers used in the RT-PCR analysis of CD4 and CD8α gene expression in samples of lymphoid organs obtained from healthy male highland-plateau yaks in 3 age groups (newborn [1 to 7 days old], juvenile [5 to 7 months old], or adult [3 to 4 years old]).
| PCR product size (bp) | Primer name | Primer composition (5′–3′) |
|---|---|---|
| 220 | Yak CD4 realtime F | GTTCCTTTGGGCTTGTTT |
| Yak CD4 realtime R | TGTTAGTCATGTCCGACTTTT | |
| 213 | Yak CD8α realtime F | CCCCAGACCCACCTTCCTAA |
| Yak CD8α realtime R | GGCAAGAAGACAGGCACGA | |
| 207 | Yak β-actin realtime F | AGGCTGTGCTGTCCCTGTATG |
| Yak β-actin realtime R | GCTCGGCTGTGGTGGTAAA |
F = Forward. R =bReverse.
