Cell-based treatments have potential as novel tools in the field of regenerative medicine, but experimental protocols must be adapted to generate clinically appropriate cell sources.1–5 Autologous cell transplantation has the advantage of negating the need for immunosuppression.6,7 However, for clinical use, it is critical to be able to harvest tissues to be used as stem cell sources without causing adverse effects to the patient.8,9 Adipose tissue-derived stromal cells are a promising cell source for autologous use because they are easily accessible without adverse consequences or ethical concerns.9,10 Several studies8,11,12 have demonstrated the transdifferentiation capacity of cells of mesenchymal lineage, such as bone marrow or adipose tissue-derived MSCs, to neural lineages. In addition, the results of experiments in laboratory animals and human clinical trials have shown that experimental transplantation of these cells as treatment for neurologic disorders such as stroke13,14 and spinal cord injury15,16 promotes recovery at the injury site.
In veterinary medicine, clinical use of MSCs derived from a variety of sources such as bone marrow, adipose tissues, or umbilical cords is increasing.17–19 Although therapeutic potential has been suggested in studies and in preliminary research17–19 in dogs, there is a paucity of objectively generated clinical data on their efficacy and limited information on the characteristics and behavior of MSCs derived from clinical patients. In addition, data on the chromosomal stability of such cells are lacking, and changes in this characteristic can potentially result in neoplastic transformation.20 In a previous study,17–19 we showed that neurosphere-like spheres (ie, clusters of neural progenitor-type cells in culture) could be generated from ADSCs from healthy dogs with the use of 2 mitogenic growth factors.12 The spheres had morphological and phenotypic characteristics similar to those of neurospheres isolated from the SVZ of the brain and generated both neuronal and glial lineage cells.12,21 To translate this experimental work to clinical use, there is a need to characterize such cells derived from clinical patients.22,23 Moreover, because these cells are generated by exposure to specific culture conditions including mitogens, examination of chromosomal stability is an important safety consideration.22,23 The purpose of the study reported here was to assess the gene expression and DNA copy number stability of ADSCs and ADSC-NSCs derived from chronically paraplegic canine patients. The study was planned as a preliminary investigation to help determine the viability of preparing canine ADSCs and generating ADSC-NSCs for clinical autologous applications.
Materials and Methods
Dogs
Client-owned dogs with severe spinal cord injury were recruited through the Canine Spinal Cord Injury Program at North Carolina State University College of Veterinary Medicine by use of the program website and by contacting owners in the patient pool of the program. The study protocol was approved by the Institutional Animal Care and Use Committee at North Carolina State University (#11–015-O). Dogs that had sustained an acute spinal cord injury in the region between T3 and L3 resulting in paraplegia with loss of pain perception in both pelvic limbs and the tail ≥ 3 months prior to the start of the study and with failure to recover motor and sensory function were eligible for enrollment. The time limit of 3 months from injury was used to include only dogs with chronic paralysis that were unlikely to undergo a spontaneous recovery. Evaluations performed prior to study enrollment included a general physical examination, neurologic examination, CBC, serum biochemical analysis, and microbial culture of a urine sample. Dogs were excluded if they had a systemic condition that might prevent general anesthesia. Owners gave informed consent prior to enrollment of any dog in the study.
Collection of tissue samples
Dogs were anesthetized according to a standard protocol. Briefly, after premedication with fentanyl (5 μg/kg) IV, anesthesia was induced via IV administration of propofol (3 to 5 mg/kg) and maintained with an inhalant isoflurane-oxygen mixture. After hair was clipped from the surgical site and the skin was aseptically prepared for surgery, patients were positioned in ventral recumbency, and subcutaneous adipose tissue (< 1 cm3) was collected from the region above the dorsal cervical epaxial muscles. After sample collection, the skin was closed routinely. Hydromorphone hydrochloride (0.05 mg/kg, IV) was administered every 6 hours for 24 hours after surgery, and then carprofen (2 mg/kg, PO) was given every 12 hours for 5 days. Dogs were discharged from the hospital the day after surgery.
ADSC isolation and induction of ADSC-NSCs
The ADSCs and ADSC-NSCs were obtained from the harvested tissues according to a previously described protocol.12 Briefly, adipose tissues were minced and incubated in PBSa at room temperature (23°C) for 1 hour to promote phase separation, and the lower phase was digested with 0.1% collagen type Ib in PBS at 37°C for 1 hour with gentle agitation. Cells were pelleted by centrifugation at 10,000 × g and cultured (37°C, 5% humidity) up to the third passage in Dulbecco modified Eagle mediumc containing 10% fetal bovine serumd and 1% penicillin-streptomycin.e To induce development of ADSC-NSCs, third-passage ADSCs were plated in a basal mediumf designed for use with neural stem cells and embryonic neuronal cells with a supplement for neural cell cultureg (at a 2% concentration), a supplement formulated for growth of neurons in primary cultureh (1%), penicillin-streptomycin (1%), basic fibroblast growth factori (10 ng/mL), and epidermal growth factorj (100 ng/mL). Cultures were initiated with 5 × 105 nucleated cells in 10-cm2 plates,k and the cells were cultured until ADSC-NSC spheres formed. Half of the medium was replaced every 3 to 4 days. The ADSCs were harvested with 0.05% trypsinl digestion, and ADSC-NSCs were dissociated with a proteolytic and collagenolytic enzyme solutionm for subsequent analysis. For all cultures, the day of initial plating was considered day 0.
RT-PCR and qRT-PCR assays
Gene expression was assessed in ADSCs and ADSC-NSCs from 3 dogs (selected arbitrarily) and compared with that of naïve SVZ-NPCs from the brain of an adult dog (cells from frozen stock), the characterization of which has previously been reported by our laboratory group.21 Total RNA was isolated from ADSCs, ADSC-NSCs, and previously frozen SVZ-NPCs with a spin column-based RNA extraction kitn and treated with a DNaseo according to the manufacturer's instructions. Complementary DNA was synthesized with a cDNA synthesis kitp and oligo (dT) primers as described by the manufacturer. Canine-specific primer sets for RT-PCR and qRT-PCR assays were identified from previous studies21,24,25 and summarized (Appendix).
Expression of NPC and differentiation markers was tested by RT-PCR assay (1 assay/dog) with an enhanced (hot-start) DNA polymerase.q The RT-PCR assay protocol was as follows: 95°C for 5 minutes; 30 cycles of 95°C for 5 seconds, 62°C for 5 seconds, and 72°C for 5 seconds; and 72°C for 1 minute. Specific primers for a transcription factor (PAX6), NPC markers (nestin and SOX2), neuronal lineage markers (TUJ1, MAP2, and neurofilament heavy polypeptide), glial lineage markers (GFAP and myelin basic protein), synaptic (neuronal) markers (postsynaptic density protein 95, STX1A, STX1B, and synaptoporin), and a mesenchymal lineage marker (CD90 cell surface antigen) were used.
Relative expression of a representative NPC marker (nestin) and MSC marker (CD90) was assessed in ADSCs, ADSC-NSCs, and SVZ-NPCs by use of a qRT-PCR assay master mix kitr with a real-time PCR detection system.s Each assay was performed in triplicate for each of the 3 dogs. Conditions for the qRT-PCR assay were as follows: 95°C for 15 minutes, 40 cycles of 95°C for 15 seconds and 72°C for 30 seconds, and 72°C for 2 minutes, followed by melting curve analysis (90 cycles, starting at 50°C with 0.5°C increments). Relative gene expression was calculated with normalization to housekeeping gene (glyceraldehyde 3-phosphate dehydrogenase) expression by use of the 2−ΔΔCT method,26 and the mean of 3 replicates was calculated for each dog; data for all 3 dogs were expressed as mean ± SD.
Flow cytometry analysis of neural lineage markers
The ADSC-NSCs and their source (passage 3) ADSCs from all study dogs were analyzed by flow cytometry for CD90, nestin, TUJ1, and GFAP protein expression. Briefly, cells were harvested, fixed with 4% paraformaldehyde solution for 15 minutes at 4°C, and washed 3 times with ice-cold PBS solution. Cells were then resuspended at a concentration of 1 × 106 cells/100 μl in PBS solution with each antibody. As an additional step for intracellular staining (for nestin, TUJ1, and GFAP), cells were permeabilized in PBST with a nonionic detergent solution added to a 0.1% concentration for 15 minutes at 4°C. Following this, all cells were blocked by incubation in PBST supplemented with 1% bovine serum albumin for 30 minutes at room temperature (23°C). Cells were incubated in PBST with primary mouse antibodies directed against the following antigens: CD90t (1:50, isotype IgG1), nestinu (1:100, isotype IgG1), TUJ1v (1:200, isotype IgG2a), and GFAPw (1:200, isotype IgG1) for 30 minutes at 4°C. Cells were then incubated for 30 minutes at room temperature with a goat anti-mouse IgG fluorochrome-conjugated secondary antibodyx (1:1,000). Appropriate isotype-matched unconjugated primary controls with the secondary antibody alone were used to identify nonspecific staining. Between all steps (with the exception of the blocking step), cells were washed 3 times in ice-cold PBST. Samples were analyzed with commercially available flow cytometry acquisition and analysis software.y Data from all study dogs (1 sample type/antibody/dog) were expressed as mean ± SD.
Immunocytochemical analysis of neural lineage markers in ADSC-NSCs
Immunocytochemical analysis was performed to quantify ADSC-NSCs expressing various neural lineage markers. The ADSC-NSC spheres from 6 arbitrarily selected dogs were dissociated as described, plated on an 8-chamber slidez at a density of 1 × 104 cells/chamber in the basal medium used for inducing ADSC-NSC without any supplements, and incubated overnight at 37°C. Cells were fixed with 4% paraformaldehyde solution (pH 7.4) for 15 minutes at room temperature, rinsed 3 times in PBS solution, and permeabilized with 0.3% nonionic detergent solution for 50 minutes. Cells were then incubated overnight in PBST at 4°C with rabbit anti-nestinaa (1:50) and mouse anti-TUJ1v (1:100) antibodies or with rabbit anti-GFAPbb (1:1,000) and mouse anti-TUJ1v (1:100) antibodies. The following day, cells were incubated for 1 hour at 23°C with goat anti-mouse IgG fluorochrome-conjugatedx and goat anti-rabbit IgG fluorophoreconjugatedcc secondary antibodies (1:500). Cells were washed in PBST 3 times, counterstained with 4′,6-diamidino-2-phenylindoledd-containing mounting solution, and then covered with a coverslip. Immunolabeling was visualized with an epifluorescence microscope.ee Quantification of ADSC-NSCs expressing neural lineage markers was determined by examination of photographs obtained from 5 arbitrarily selected fields under 20× magnification with a camera-equipped epifluorescence microscope. The total number of cells (determined by 4′,6-diamidino-2-phenylindole counterstaining) and the number of cells expressing each antibody were counted. Immunoreactive cells exposed to antibodies against nestin and TUJ1 were categorized as neural progenitors (nestin-positive and TUJ1-negative), immature neural lineage cells (nestin-positive and TUJ1-positive), or differentiated neuronal cells (nestin-negative and TUJ1-positive), and those exposed to antibodies against GFAP and TUJ1 were categorized as differentiated glial cells (GFAP-positive and TUJ1-negative), immature neural lineage cells (GFAP-positive and TUJ1-positive), or differentiated neuronal cells (GFAP-negative and TUJ1-positive). Data were expressed as percentages of the total number of cells within the same magnification field and reported as mean ± SD.
Array-CGH analysis
Array-CGH analysis was performed to evaluate the genome-wide DNA copy number profiles of the ADSC and ADSC-NSC populations obtained from a subset of dogs with acute spinal cord injury. This subset was selected on the basis of adequate numbers of cells generated to perform the analysis. The purpose was to determine whether aneuploidy emerged during low-passage culture of ADSCs and whether neural cell induction or rapid expansion with fibroblast and epidermal growth factors induced aneuploidy in ADSC-NSCs from a given patient. To account for these possibilities while simultaneously enabling detection of any preexisting constitutional aneuploidy that might exist in a given patient, DNA copy numbers in both ADSCs and ADSC-NSCs were compared with blood-derived DNA copy numbers. The methodology and resources used for array-CGH analysis have been described elsewhere.27 Briefly, 500 ng of total genomic DNA was extracted from each cell type from each dog (test samples) with a commercial kitff and labeled separately with cyanine-3-dUTP by means of a genomic DNA labeling kitgg in accordance with the manufacturers’ instructions. Blood was not available from all study dogs, so blood-derived DNA from 100 healthy dogs of the same sex as each dog with spinal cord injury in the analysis (regardless of neuter status) was labeled with cyanine-5-dUTP and used as the reference sample for evaluation of ADSCs and ADSC-NSCs. These reference DNA pools have been described elsewhere.20,27 Labeled probes were cohybridized in 2 independent pairwise (test vs reference) assays onto a canine microarrayhh comprising repeat-masked 60-mer (approx size) oligonucleotides distributed at approximately 13-kb intervals throughout the dog genome sequence assembly.ii Arrays were scanned with a microarray scanner,jj and image data were processed with software obtained from the scanner manufacturerkk and then imported into a program for DNA copy number variation analysis profiling.ll Raw data were filtered to exclude probes with nonuniform hybridization or signal saturation. Regions of relative genomic imbalance between test and reference probes were identified through use of the fast adaptive state segmentation technology (commonly described as FASST2) algorithm on the basis of ≥ 3 consecutive probes with log2 test:reference values ≥ 0.201 (copy number gain) or ≤ −0.234 (copy number loss), resulting in an effective resolution of approximately 26 kb (2 intervals of approx 13 kb). Data from ADSCs and ADSC-NSCs from the same dog were then overlaid to identify any deviations in their DNA copy number profiles.
Results
Culture of ADSCs and ADSC-NSCs
Adipose tissue was obtained from 14 dogs with paraplegia due to spinal cord injury (Supplemental Table S1, available online at avmajournals.avma.org/doi/suppl/10.2460/ajvr.78.3.371). The causes of spinal cord injury were intervertebral disk extrusion (n = 11) and vertebral fractures (3). There were 7 females (5 spayed and 2 sexually intact) and 7 males (6 neutered and 1 sexually intact). Ages at the time of sample collection ranged from 3 to 11 years, and the duration of paraplegia at that time ranged from 4 to 74 months. Both ADSCs and ADSC-NSCs were successfully generated from all study dogs. Primary ADSCs from all dogs expanded up to > 90% confluence in 10-cm2 plates within 7 to 10 days of culture. The ADSC-NSCs were generated from third-passage ADSCs 10 to 14 days after plating in neural induction medium as described. The ADSC-NSCs had sphere-like morphology as previously described in samples from healthy dogs12 (Figure 1). The number of ADSC-NSCs obtained by plating 5 × 105 ADSCs/10-cm2 dish ranged from approximately 1 × 107 cells to 2 × 107 cells.
Representative photomicrographs (A) of canine ADSCs obtained from 1 of 14 chronically paraplegic dogs and cultured in neural induction medium for 1 (left), 7 (center), or 14 (right) days. Spherical cellular aggregates (spheres of ADSC-NSCs; arrows) were formed by day 14. Bar = 50 μm (left) or 100 μm (center and right). The relative expression of CD90 (B) and nestin (C) was substantially higher in ADSC-NSCs and SVZ-NPCs than in ADSCs as determined by qRT-PCR assays. Relative gene expression (mean of 3 replicates for each of 3 dogs [ADSCs and ADSC-NSCs] or for previously frozen stock from 1 dog [SVZ-NPCs]) was determined with normalization to housekeeping gene (glyceraldehyde 3-phosphate dehydrogenase) expression by use of the 2−ΔΔCT method26 and data were expressed as mean ± SD.
Citation: American Journal of Veterinary Research 78, 3; 10.2460/ajvr.78.3.371
Gene expression of ADSCs and ADSC-NSCs
Results of RT-PCR analysis of cells from 3 study dogs revealed that ADSCs expressed the MSC marker CD90 and the transcription factor PAX6, as well as the NPC markers nestin and SOX2, the neuronal cell lineage marker TUJ1, and synaptic markers STX1A and synaptoporin. The ADSC-NSCs expressed CD90, PAX6, nestin, SOX2, TUJ1, STX1A, and synaptoporin; they also expressed the neuronal and glial cell lineage markers MAP2 and GFAP. The SVZ-NPCs (previously frozen stock from the brain of 1 dog) expressed CD90, PAX6, nestin, SOX2, TUJ1, GFAP, MAP2, STX1A, and synaptoporin and additionally expressed STX1B and NEFH. Myelin basic protein and postsynaptic density protein 95 were not detected in any of the 3 cell types.
Results of the qRT-PCR assay revealed that relative expression of CD90 in ADSC-NSCs and in SVZ-NPCs was 14.3 ± 0.1 and 12.2 ± 8.3 times that in ADSCs, respectively. Relative expression of nestin in ADSC-NSCs was 7.5 ± 0.08 times that in ADSCs, whereas that in SVZ-NPCs was 2,268.3 ± 21.73 times that in ADSCs (Figure 1).
Flow cytometry and immunocytochemical analysis
Flow cytometry analysis data for each dog were summarized (Supplemental Table S2, available online at avmajournals.avma.org/doi/suppl/10.2460/ajvr.78.3.371). Not all markers were evaluated for all dogs because of technical difficulties. When analyzed by flow cytometry, 97.12 ± 1.55% of ADSCs (n = 9 dogs) and 96.39 ± 4.38% of ADSC-NSCs (8 dogs) expressed CD90. The percentage of ADSCs expressing nestin, GFAP, and TUJ1 was 5.91 ± 7.47 (n = 10 dogs), 3.18 ± 2.15 (10 dogs), and 1.59 ± 1.64 (10 dogs), respectively. The percentage of ADSC-NSCs expressing nestin, GFAP, and TUJ1 was 73.73 ± 18.19 (n = 13 dogs), 78.58 ± 13.32 (11 dogs), and 57.53 ± 34.95 (11 dogs).
Immunocytochemical analysis was performed on samples from 6 dogs. On evaluation, ADSC-NSC spheres were a mixture of cells that expressed the markers for various stages of maturity and differentiation alone or in combination (Figure 2). Results indicated that 58.2 ± 22.3%, 26.8 ± 24.9%, and 2.8 ± 2.6% of immunoreactive cells were NPCs (nestin-positive and TUJ1-negative), immature neural lineage cells (nestin-positive and TUJ1-positive), or differentiated neuronal cells (nestin-negative and TUJ1-positive), respectively. The remaining neural lineage marker experiments indicated that 26.7 ± 25.9%, 51.7 ± 24.0%, and 2.9 ± 2.6% of immunoreactive cells were differentiated glial cells (GFAP-positive and TUJ1-negative), immature neural lineage cells (GFAP-positive and TUJ1-positive), or differentiated neuronal cells (GFAP-negative and TUJ1-positive), respectively.
Representative photomicrographs showing results of immunocytochemistry (immunofluorescence staining) of ADSC-NSCs for neural lineage markers nestin and TUJ1 (A) or GFAP and TUJ1 (B). A—Immunoreactive cells exposed to antibodies against nestin (red) and TUJ1 (green) were categorized as neural progenitors (nestin-positive and TUJ1-negative), immature neural lineage cells (nestin-positive and TUJ1 -positive), or differentiated neuronal cells (nestin-negative and TUJ1 -positive). B—Immunoreactive cells exposed to antibodies against GFAP (green) and TUJ 1 (red) were categorized as differentiated glial cells (GFAP-positive and TUJ1-negative), immature neural lineage cells (GFAP-positive and TUJ1-positive), or differentiated neuronal cells (GFAP-negative and TUJ 1 -positive). Nuclei were counterstained with 4′,6-diamidino-2-phenylindole (blue). Dual-stained cells appear as yellow-orange. Bar = 50 μm.
Citation: American Journal of Veterinary Research 78, 3; 10.2460/ajvr.78.3.371
Array-CGH analysis in ADSCs and ADSC-NSCs
Evaluation by array-CGH analysis of ASDCs and ADSC-NSCs from 6 dogs with spinal cord injury revealed that, for all patients, ADSCs had global genomic balance, compared with blood-derived DNA from healthy dogs. Discrete regions of apparent relative imbalance (ranging from 15 to 30 regions/dog) coincided with known natural copy number polymorphisms reported previously for domestic dog populations.28,29 These regions were highly localized, ranged from 9.2 kb to 1.8 Mb in size, and involved ≤ 0.33% of the genome for ADSCs from any given dog. In turn, apparent imbalances detected in ADSC-NSCs were restricted to those present in the third-passage ADSCs from which they were derived. There was no evidence for broad contiguous regions of DNA copy number instability in any ADSC or ADSC-NSC population, indicating that, under the conditions described, culture of ADSCs up to the third passage and induction of NPCs with mitotic growth factors did not result in detectable genomic imbalance according to standard criteria30 for defining clinically important nonrandom DNA copy number gain or loss in array-CGH analysis.
Discussion
In the present study, ADSCs and ADSC-NSCs were successfully cultured from tissues obtained from 14 chronically paraplegic dogs of various breeds and ages, and numbers of ADSC-NSCs deemed adequate for clinical use18,19 were generated within 10 to 14 days after plating of 5 × 105 ADSCs in neural induction condition medium. Both ADSCs and ADSC-NSCs expressed MSC markers, NPC markers, and 1 (ADSCs) or more (ADSC-NSCs) neural lineage differentiation markers as assessed by mRNA concentrations. Although no statistical comparisons were performed, relative gene expression of CD90 and nestin (evaluated in samples from a subset of 3 dogs) was subjectively increased after neural induction of ADSCs, and the percentage of ADSCs and ADSC-NSCs expressing CD90 as assessed by flow cytometry (for all dogs that had samples available [n = 8 to 13]) was consistently high. Flow cytometry data also indicated that the percentage of cells expressing the neural lineage markers nestin, GFAP, and TUJ1 was substantially increased after neural induction. Immunocytochemical analysis of ADSC-NSCs (performed for 6 dogs) revealed that these included cells in the progenitor stage that expressed nestin without TUJ1 and cells in intermediate stages of differentiation within the neural lineage with mixed expression of both nestin and TUJ1 or GFAP and TUJ1. Importantly, in regard to potential clinical use, there was no detectable alteration in genomic DNA copy number after neural induction in medium that included fibroblast growth factor and epidermal growth factor.
When contemplating use of autologous cells for cellular therapy, it is critical to consider factors resulting in variant data experimentally and to evaluate these variables using tissues obtained from patients.31 It has been shown that donor age, sex, and disease status; sample collection sites; and in vitro culture conditions influence cellular behavior.32–36 It has been reported that studies in people and in rodents33 have shown that donor age has less influence on changes in cell morphology, proliferation capacity, telomerase activity, and telomere length than does aging in vitro (ie, the number of cell divisions in culture). Also, there was no difference in differentiation capacity in bone marrow MSCs from young and old donor groups.36 Similar results were reported for dogs, with no difference in cell yield and differentiation capacities in ADSCs collected by biopsy from different anatomic sites (visceral vs subcutaneous) or from dogs of different age groups (young [1 to 4 years] vs aged [8 to 14 years]).34–36 However, proliferation capacity of such cells was significantly decreased after the sixth to seventh passage in culture.12,36 In the present study, we extended our previous research21 to chronically paraplegic dogs of diverse breeds with the intent of describing the expression of markers reflecting different stages of neural cell differentiation in cultured ADSC-NSCs from these patients. All the ADSCs isolated from these clinical patients had typical MSC morphology. More than 1 × 106 cells—a minimum number considered adequate for treatment of spinal cord injury in dogs—were readily generated by the third passage and maintained their differentiation capacity as reported by other groups.18,19
Results of a study by Bunnell et al37 revealed that there were overlapping sets of commonly expressed gene profiles in NPCs derived from bone marrow MSCs and ADSCs and in NPCs derived from brain tissue in nonhuman primates. Functional categories of those profiles were broad and included cell cycle regulation, transcription factor activity, receptor activity, developmental processes, and cell-to-cell signaling, on the basis of analysis of 184 common genes. In the present study, we identified gene expression of a transcription marker (PAX6), NPC markers (nestin and SOX2), a neural cell differentiation marker (TUJ1), and synaptic markers (STX1A and synaptoporin) by ADSCs as well as ADSC-NSCs and SVZ-NPCs in dogs. Moreover, CD90 was expressed in all 3 cell types. However, MAP2 and GFAP were expressed only in ADSC-NSCs and SVZ-NPCs. This can be explained if nestin expression is regarded as a first step in progression to the neural linage, with MAP2 and GFAP being expressed with additional differentiation.38 It has been suggested that small populations (2% to 20%) of MSCs from people and mice express nestin.39,40 Moreover, nestin-positive MSCs from mice proliferated to form sphere-like cell aggregates and differentiated into functional neurons in appropriate culture conditions.38,41,42 The results of our study indicated that 5.91 ± 7.47% of ADSCs expressed nestin protein (as assessed by flow cytometry), and this increased to 73.73 ± 18.19% after induction to form ADSC-NSCs. Relative gene expression of nestin in ADSC-NSCs was 7.5 ± 0.08 times that in ADSCs, and increased expression of nestin after neural induction was consistent with the results of previous human studies.43–45 However, unlike a study45 of human cells that found that CD90 gene expression was decreased in MSC-derived NPCs, compared with that in MSCs, our results from 3 dogs indicated that the relative gene expression of CD90 was substantially higher in ADSC-NSCs than that in ADSCs and that a consistently high percentage of cells of both types expressed CD90 antigen. In the same way, relative CD90 gene expression was subjectively higher in SVZ-NPCs than in ADSCs. It is possible that the limited number of dogs with samples evaluated for qPCR generated biased results, but it is also possible that the cell culture conditions in our study transiently upregulated progenitor characteristics in the ADSCs and ADSC-NSCs concurrent with neural markers.46 Alternatively, CD90 could potentially represent a progenitor marker in certain types of neural lineage cells.47 Further study in larger numbers of dogs is needed to confirm or refute these findings.
The main study weaknesses relate to limited dog numbers, compounded by technical issues that prevented all assays from being performed on cultures from all dogs. This prevented meaningful statistical analysis from being performed in many instances. The data should be interpreted in the light of this limitation and should not be extrapolated across all canine patients, particularly those with other underlying disease processes.
Therapeutic cell transplantation approaches have greatly improved with increased availability of a variety of cells from different sources. However, it is critical to ensure the safety of these cells to consider them for clinical application. Karyotypic changes are one of the critical risks of cellular therapy.20,31 It has been shown that long-term in vitro culture can induce chromosomal aberrations in pluripotent stem cells derived from multiple species.30,48,49 Furthermore, several studies50–53 have shown that spontaneous neoplastic transformation can occur during prolonged culture of initially normal cells from a variety of mammalian species, in association with the emergence of nonrandom genomic alterations. In this study, we used multipotent ADSCs that theoretically are stable karyotypically, and in addition, we strictly limited the number of in vitro passages before neural induction. However, to our knowledge, potential induction of chromosomal aberration during transdifferentiation of MSCs has not yet been reported. Hence, to assess this possibility, we used ACGH analysis to evaluate the genomic stability of ADSC-NSCs after induction in cells from 6 canine patients. The results indicated that the source ADSCs had global genomic balance, compared with blood-derived DNA from healthy dogs, and there was no evidence for genomic instability relative to the corresponding ADSCs from which they were derived. These findings supported the growing body of evidence for the safety of this protocol to obtain autologous NPCs. These preliminary results supported that the ADSCs isolated from paraplegic dogs can potentially be a safe and clinically relevant autologous cell source; however, the number of dogs included in this study, particularly in the DNA copy number analysis, was small, and further research is needed before the results can be extrapolated to the larger population of paraplegic canine patients.
Acknowledgments
Supported by the Morris Animal Foundation (D10CA-040). The authors declare there were no conflicts of interest. Presented in abstract form at the 31st Annual Forum of the American College of Veterinary Internal Medicine, Seattle, June 2013.
ABBREVIATIONS
| ADSC | Adipose tissue-derived stromal cell |
| ADSC-NSC | Neurosphere-like cell clusters generated from adipose tissue-derived stromal cells |
| CGH | Comparative genomic hybridization |
| GFAP | Glial fibrillary acidic protein |
| kb | Kilobase |
| MAP2 | Microtubule-associated protein 2 |
| MSC | Mesenchymal stem cell |
| NPC | Neural progenitor cell |
| PAX6 | Paired box 6 |
| PBST | PBS solution containing 0.01% polysorbate 20 |
| qRT-PCR | Quantitative real-time PCR |
| RT-PCR | Reverse transcription PCR |
| SOX2 | Sex-determining region Y-box 2 |
| STX1 | Syntaxin 1 |
| SVZ | Subventricular zone |
| SVZ-NPC | Subventricular zone neural progenitor cell |
| TUJ1 | Tubulin β 3 class III |
Footnotes
PBS, Gibco BRL, Grand Island, NY.
Collagen type I, Sigma-Aldrich, St Louis, Mo.
Dulbecco Modified Eagle Medium, Gibco BRL, Grand Island, NY.
Fetal bovine serum, Corning, Corning, NY.
Penicillin-streptomycin, Gibco BRL, Grand Island, NY.
Neurobasal medium, Gibco BRL, Grand Island, NY.
B27, Invitrogen, Carlsbad, Calif.
N2, Invitrogen, Carlsbad, Calif.
Basic fibroblast growth factor, Invitrogen, Carlsbad, Calif.
Epidermal growth factor, Invitrogen, Carlsbad, Calif.
Round cell culture plate, Corning, Corning, NY.
Trypsin EDTA, Gibco BRL, Grand Island, NY.
Accutase, Innovative Cell Technologies, San Diego, Calif.
EZ-10 Total RNA Mini-preps Kit, Bio Basic Inc, Amherst, NY.
TURBO DNase, New England Biolabs Inc, Ipswich, Mass.
AffinityScript MultiTemp cDNA Synthesis Kit, Agilent Technologies, Santa Clara, Calif.
Phire Hot Start II DNA polymerase, Thermo Fisher Scientific Inc, Grand Island, NY.
Brilliant II SYBR Green QPCR Master Kit, Agilent Technologies, Santa Clara, Calif.
BioRad Real-Time PCR Detection System, Bio-Rad Laboratories Inc, Hercules, Calif.
Monoclonal mouse anti-dog CD90, CA1.4G8, Leukocyte Antigen Biology Laboratory, Davis, Calif.
Monoclonal mouse anti-human nestin, Millipore, Billerica, Mass.
Monoclonal mouse anti-mammalian neuronal class III betatubulin, Covance Inc, Princeton, NJ.
Monoclonal mouse anti-mammalian GFAP, Covance Inc, Princeton, NJ.
Alexa Fluor 488-conjugated goat anti-mouse IgG, Invitrogen, Carlsbad, Calif.
CellQuest software, Becton-Dickinson, San Jose, Calif.
Lab-tek Chamber Slides, Thermo Fisher Scientific Inc, Rochester, NY.
Polyclonal rabbit anti-human nestin, AbD Serotec, Hercules, Calif.
Polyclonal rabbit anti-human GFAP, Dako, Carpinteria, Calif.
Cy-3-conjugated goat anti-rabbit IgG, Invitrogen, Carlsbad, Calif.
Vectashield mounting medium with 4′,6-diamidino-2-phenylindole, Vector Laboratories, Burlingame, Calif.
AZ100 fluorescence microscope, Nikon, Japan.
Qiagen DNeasy Blood and Tissue Kit, QIAGEN Science, Germantown, Md.
SureTag Genomic DNA Enzymatic Labeling Kit, Agilent Technologies, Santa Clara, Calif.
Canine Oligonucleotide CGH microarray, Agilent Technologies, Santa Clara, Calif.
UCSC Genome Bioinformatics Sequence and Annotation Downloads [database online]. Dog genome: Sep. 2011 (Broad CanFam3.1/canFam3). Santa Cruz, Calif: University of California-Santa Cruz Genome Informatics Group, September 2011. Available at: hgdownload.cse.ucsc.edu/downloads.html#source_downloads. Accessed Dec 4, 2015.
Agilent G2565CA microarray scanner, Agilent Technologies, Santa Clara, Calif.
Feature Extraction, version 10.10, and Genomic Workbench, version 6.5, Agilent Technologies, Santa Clara, Calif.
Nexus Copy Number, version 7.5, Biodiscovery Inc, El Segundo, Calif.
References
1. Thuret S, Moon LD, Gage FH. Therapeutic interventions after spinal cord injury. Nat Rev Neurosci 2006; 7:628–643.
2. Kumar S, Chanda D, Ponnazhagan S. Therapeutic potential of genetically modified mesenchymal stem cells. Gene Ther 2008; 15:711–715.
3. Kim SU, de Vellis J. Stem cell-based cell therapy in neurological diseases: a review. J Neurosci Res 2009; 87:2183–2200.
4. Marquis-Gravel G, Stevens LM, Mansour S, et al. Stem cell therapy for the treatment of nonischemic cardiomyopathy: a systematic review of the literature and meta-analysis of randomized controlled trials. Can J Cardiol 2014; 30:1378–1384.
5. Cosson S, Otte EA, Hezaveh H, et al. Concise review: tailoring bioengineered scaffolds for stem cell applications in tissue engineering and regenerative medicine. Stem Cells Transl Med 2015; 4:156–164.
6. Aust L, Devlin B, Foster SJ, et al. Yield of human adipose-derived adult stem cells from liposuction aspirates. Cytotherapy 2004; 6:7–14.
7. Schäffler A, Büchler C. Concise review: adipose tissue-derived stromal cells-basic and clinical implications for novel cell-based therapies. Stem Cells 2007; 25:818–827.
8. Pittenger MF, Mackay AM, Beck SC, et al. Multilineage potential of adult human mesenchymal stem cells. Science 1999; 284:143–147.
9. Zuk PA, Zhu M, Ashjian P, et al. Human adipose tissue is a source of multipotent stem cells. Mol Biol Cell 2002; 13:4279–4295.
10. Gimble J, Guilak F. Adipose-derived adult stem cells: isolation, characterization, and differentiation potential. Cytotherapy 2003; 5:362–369.
11. Franco Lambert AP, Fraga Zandonai A, Bonatto D, et al. Differentiation of human adipose-derived adult stem cells into neuronal tissue: does it work? Differentiation 2009; 77:221–228.
12. Lim JH, Boozer L, Mariani CL, et al. Generation and characterization of neurospheres from canine adipose tissue-derived stromal cells. Cell Reprogram 2010; 12:417–425.
13. Lees JS, Sena ES, Egan KJ, et al. Stem cell-based therapy for experimental stroke: a systematic review and meta-analysis. Int J Stroke 2012; 7:582–588.
14. Banerjee S, Bentley P, Hamady M, et al. Intra-arterial immunoselected CD34+ stem cells for acute ischemic stroke. Stem Cells Transl Med 2014; 3:1322–1330.
15. Reeves A, Keirstead HS. Stem cell based strategies for spinal cord injury repair. Adv Exp Med Biol 2012; 760:16–24.
16. Dasari VR, Veeravalli KK, Dinh DH. Mesenchymal stem cells in the treatment of spinal cord injuries: a review. World J Stem Cells 2014; 6:120–133.
17. Marx C, Silveira MD, Beyer Nardi N. Adipose-derived stem cells in veterinary medicine: characterization and therapeutic applications. Stem Cells Dev 2015; 24:803–813.
18. Park SS, Lee YJ, Lee SH, et al. Functional recovery after spinal cord injury in dogs treated with a combination of Matrigel and neural-induced adipose-derived mesenchymal stem cells. Cytotherapy 2012; 14:584–597.
19. Ryu HH, Kang BJ, Park SS, et al. Comparison of mesenchymal stem cells derived from fat, bone marrow, Wharton's jelly, and umbilical cord blood for treating spinal cord injuries in dogs. J Vet Med Sci 2012; 74:1617–1630.
20. Thomas R, Demeter Z, Kennedy KA, et al. Integrated immunohistochemical and DNA copy number profiling analysis provides insight into the molecular pathogenesis of canine follicular lymphoma [published online ahead of print May 2, 2016]. Vet Comp Oncol doi: 10.1111/vco.12227.
21. Lim JH, Koh S, Olby NJ, et al. Isolation and characterization of neural progenitor cells from adult canine brains. Am J Vet Res 2012; 73:1963–1968.
22. Halme DG, Kessler DA. FDA regulation of stem-cell-based therapies. N Engl J Med 2006; 355:1730–1735.
23. Fink DW Jr. FDA regulation of stem cell-based products. Science 2009 26;324:1662–1663.
24. Hu BY, Weick JP, Yu J, et al. Neural differentiation of human induced pluripotent stem cells follows developmental principles but with variable potency. Proc Natl Acad Sci U S A 2010; 107:4335–4340.
25. Wilcox JT, Lai JK, Semple E, et al. Synaptically-competent neurons derived from canine embryonic stem cells by lineage selection with EGF and noggin. PLoS ONE 2011; 6:e19768.
26. Schmittgen TD, Livak KJ. Analyzing real-time PCR data by the comparative C(T) method. Nat Protoc 2008; 3:1101–1108.
27. Thomas R, Seiser EL, Motsinger-Reif A, et al. Refining tumor-associated aneuploidy through ‘genomic recoding’ of recurrent DNA copy number aberrations in 150 canine non-Hodgkin lymphomas. Leuk Lymphoma 2011; 52:1321–1335.
28. Chen WK, Swartz JD, Rush LJ, et al. Mapping DNA structural variation in dogs. Genome Res 2009; 19:500–509.
29. Nicholas TJ, Cheng Z, Ventura M, et al. The genomic architecture of segmental duplications and associated copy number variants in dogs. Genome Res 2009; 19:491–499.
30. Koh S, Thomas R, Tsai S, et al. Growth requirements and chromosomal instability of induced pluripotent stem cells generated from adult canine fibroblasts. Stem Cells Dev 2013; 22:951–963.
31. Hyun I, Lindvall O, Ahrlund-Richter L, et al. New ISSCR guidelines underscore major principles for responsible trans-lational stem cell research. Cell Stem Cell 2008; 3:607–609.
32. Sethe S, Scutt A, Stolzing A. Aging of mesenchymal stem cells. Ageing Res Rev 2006; 5:91–116.
33. Kim M, Kim C, Choi YS, et al. Age-related alterations in mesenchymal stem cells related to shift in differentiation from osteogenic to adipogenic potential: implication to age-associated bone diseases and defects. Mech Ageing Dev 2012; 133:215–225.
34. Neupane M, Chang CC, Kiupel M, et al. Isolation and characterization of canine adipose-derived mesenchymal stem cells. Tissue Eng Part A 2008; 14:1007–1015.
35. Kisiel AH, McDuffee LA, Masaoud E, et al. Isolation, characterization, and in vitro proliferation of canine mesenchymal stem cells derived from bone marrow, adipose tissue, muscle, and periosteum. Am J Vet Res 2012; 73:1305–1317.
36. Guercio A, Di Bella S, Casella S, et al. Canine mesenchymal stem cells (MSCs): characterization in relation to donor age and adipose tissue-harvesting site. Cell Biol Int 2013; 37:789–798.
37. Bunnell BA, Ylostalo J, Kang SK. Common transcriptional gene profile in neurospheres derived from pATSCs, pBMSCs, and pNSCs. Biochem Biophys Res Commun 2006; 343:762–771.
38. Wislet-Gendebien S, Leprince P, Moonen G, et al. Regulation of neural markers nestin and GFAP expression by cultivated bone marrow stromal cells. J Cell Sci 2003; 116:3295–3302.
39. Deng W, Obrocka M, Fischer I, et al. In vitro differentiation of human marrow stromal cells into early progenitors of neural cells by conditions that increase intracellular cyclic AMP. Biochem Biophys Res Commun 2001; 282:148–152.
40. Morikawa S, Mabuchi Y, Niibe K, et al. Development of mesenchymal stem cells partially originate from the neural crest. Biochem Biophys Res Commun 2009; 379:1114–1119.
41. Wislet-Gendebien S, Hans G, Leprince P, et al. Plasticity of cultured mesenchymal stem cells: switch from nestin-positive to excitable neuron-like phenotype. Stem Cells 2005; 23:392–402.
42. Sauerzweig S, Munsch T, Lessmann V, et al. A population of serum deprivation-induced bone marrow stem cells (SD-BMSC) expresses marker typical for embryonic and neural stem cells. Exp Cell Res 2009; 315:50–66.
43. Hermann A, Gastl R, Liebau S, et al. Efficient generation of neural stem cell-like cells from adult human bone marrow stromal cells. J Cell Sci 2004; 117:4411–4422.
44. Hermann A, Liebau S, Gastl R, et al. Comparative analysis of neuroectodermal differentiation capacity of human bone marrow stromal cells using various conversion protocols. J Neurosci Res 2006; 83:1502–1514.
45. Harris VK, Faroqui R, Vyshkina T, et al. Characterization of autologous mesenchymal stem cell-derived neural progenitors as a feasible source of stem cells for central nervous system applications in multiple sclerosis. Stem Cells Transl Med 2012; 1:536–547.
46. Rooney GE, Howard L, O'Brien T, et al. Elevation of cAMP in mesenchymal stem cells transiently upregulates neural markers rather than inducing neural differentiation. Stem Cells Dev 2009; 18:387–398.
47. He J, Liu Y, Zhu T, et al. CD90 is identified as a candidate marker for cancer stem cells in primary high-grade gliomas using tissue microarrays. Mol Cell Proteomics 2012; 11:M111.010744.
48. Laurent LC, Ulitsky I, Slavin I, et al. Dynamic changes in the copy number of pluripotency and cell proliferation genes in human ESCs and iPSCs during reprogramming and time in culture. Cell Stem Cell 2011; 8:106–118.
49. Ben-David U, Benvenisty N. High prevalence of evolutionarily conserved and species-specific genomic aberrations in mouse pluripotent stem cells. Stem Cells 2012; 30:612–622.
50. Omeir R, Thomas R, Teferedegne B, et al. A novel canine kidney cell line model for the evaluation of neoplastic development: karyotype evolution associated with spontaneous immortalization and tumorigenicity. Chromosome Res 2015; 23:663–680.
51. Osada N, Kohara A, Yamaji T, et al. The genome landscape of the African green monkey kidney-derived vero cell line. DNA Res 2014; 21:673–683.
52. Padilla-Nash HM, McNeil NE, Yi M, et al. Aneuploidy, oncogene amplification and epithelial to mesenchymal transition define spontaneous transformation of murine epithelial cells. Carcinogenesis 2013; 34:1929–1939.
53. Magdolen U, Schmitt M, Hildebrandt B, et al. Spontaneous in vitro transformation of primary human osteoblast-like cells. Cancer Genomics Proteomics 2010; 7:61–66.
Appendix
Canine-specific primer sequences used for RT-PCR and qRT-PCR assays in evaluation of neural lineage marker expression in ADSCs, ADSC-NSCs, and SVZ-NPCs from dogs.
| Gene | Primers (5′-3′) | Expected amplicon size (bp) | Reference |
|---|---|---|---|
| PAX6 | F: GCGGCCAAAATCGATCTACCTG | 135 | 25 |
| R: GCTGATGGGGATGTGACTGGGT | |||
| Nestin | F: CAGCAGCTAGCACACCTCAA | 220 | 26 |
| R: GCAAGGAGAGGGAAGTAGGG | |||
| SOX2 | F: GTCCCAGCACTACCAGAGCG | 150 | 21 |
| R: CTTACTCTCCTCCCATTTCCCTCG | |||
| TUJ1 | F: AGCCAAGTTCTGGGAAGTCA | 238 | 26 |
| R: CCCACTCTGACCAAAGATGAA | |||
| MAP2 | F: AGAGGAGGTGTCTGCAAGGA | 161 | 26 |
| R: GTGATGGAGGTGGAGAAGGA | |||
| Neurofilament heavy polypeptide | F: CTCAAAGGCACCAAGGACTC | 244 | 26 |
| R: CAAAGCCAATCCGACATTCT | |||
| GFAP | F: AGATCCACGATGAGGAGGTG | 104 | 26 |
| R: TCTTAGGGCTGCTGTGAGGT | |||
| Myelin basic protein | F: AGAAGAGCAACAAGGCTGGA | 124 | 26 |
| R: TTGTTCTGCTCCACATCTGC | |||
| Postsynaptic density protein 95 | F: GACGGGAGTGGTCAAGGTTA | 120 | 26 |
| R: GGCGAGCATAGTGAACTTCC | |||
| STX1A | F: AGTACAACGCCACACAGTCG | 122 | 26 |
| R: GTTCCCACTCTCCAGCATGT | |||
| STX1B | F: CAACAAGGTTCGGTCCAAGT | 158 | 26 |
| R: ACTGGGTCGCGTTATATTCG | |||
| Synaptoporin | F: GTTGGTGGGTTCATCAGCTT | 165 | 26 |
| R: CCAAAGACCACGGAAGTGTT | |||
| CD90 | F: TTGCTGACAGTCTTGCAGGT | 372 | 12 |
| R: TATGCCCTCACACTTGACCA | |||
| Glyceraldehyde 3-phosphate dehydrogenase | F: GCCCTCAATGACCACTTTGT | 101 | 26 |
| R: TCCTTGGAGGCCATGTAGAC |
F = Forward. R = Reverse.
