Hyaline cartilage is a highly complex connective tissue that resists compression in articular joints and protects bones from friction.1 Healthy functional cartilage is characterized by a balance between anabolic and catabolic factors. Disturbance of this balance may result in excessive inflammation that ultimately leads to the breakdown of cartilage. This process has been implicated in the pathogenesis of osteoarthritis.2
Osteoarthritis is a common condition in dogs. Presumably > 20% of middle-aged dogs in the United States have osteoarthritis.3 Similar to the condition in humans, affected dogs have signs of joint pain and restricted mobility; thus, they often have a diminished quality of life.3 Methods have been used to mimic osteoarthritis in dogs for in vitro evaluation of this inflammatory disease.4–7
Several factors derived from chondrocytes and synoviocytes play a major role in the initiation and progression of osteoarthritis. Among them, IL-1β is considered one of the most important.8 Once IL-1β is bound to the IL-1 receptor, various catabolic pathways are induced, which include the expression of proteolytic enzymes (eg, MMPs and aggrecanases). Major components of the extracellular matrix are broken down6,9–11 and mediators (eg, NO and PGE) are produced, which leads to inflammation in the joint.12–14 Furthermore, anabolic activity of the cells is suppressed, which leads to delayed healing of the resulting cartilage defects.15,16 Interleukin-1β also has the potential to induce a variety of chemokines that attract other cells to the joint. These cells generate additional inflammatory and proteolytic mediators,17,18 which may result in total cartilage destruction.
Transforming growth factor-β is a supplement commonly added to chondrocyte cell cultures and has been used as a trigger for chondrogenic differentiation of mesenchymal stem cells.19,20 However, the actions of TGF-β on chondrocytes remain controversial because it has been found that TGF-β provides both stimulatory and inhibitory effects on cartilage metabolism. On the one hand, TGF-β promotes the production of matrix components in chondrocytes21 and plays a key role in chondrogenesis22 and cartilage repair.23 Furthermore, TGF-β attenuates IL-1β–stimulated NO production24 and has proven beneficial for matrix protection because it modulates secretion of TIMPs25 and decreases the synthesis of MMPs.26,27 On the other hand, TGF-β has a number of effects that promote cartilage breakdown, which include the synthesis of matrix-degenerating enzymes,28,29 the development of osteophytes,30 and the initiation of fibrosis.22 In vivo experiments have revealed that prolonged administration of high doses of TGF-β results in osteoarthritis-like cartilage defects.31 However, moderate doses of TGF-β may be a potential treatment for osteoarthritis.32
The effects of TGF-β on canine chondrocytes have not been elucidated. Therefore, the purpose of the study reported here was to use cultured canine chondrocytes to investigate the effects of TGF-β on chondrocytes stimulated with IL-1β. We hypothesized that TGF-β would exert positive effects on matrix metabolism and, moreover, inhibit the destructive effects of IL-1β.
Materials and Methods
Sample
Full-thickness cartilage slices were aseptically obtained from the stifle joints of 4 dogs (mixed-breed dogs; median age, 12 years) within 24 hours after the dogs were euthanized for reasons unrelated to the present study. Carcasses were stored in a cold room (7°C) from time of euthanasia until harvest of cartilage slices. Dogs were eligible for inclusion in the study if they had no orthopedic abnormalities in the stifle joints and no current systemic diseases that could have interfered with the growth and viability of chondrocytes.
Chondrocyte isolation and in vitro culture
Cells were cultured and harvested as described elsewhere,33 with slight modifications. Briefly, slices of macroscopically normal articular cartilage were digested in an enzyme mixture at 37°C for 18 hours with constant agitation. The enzyme mixture consisted of collagenasea (1 U/mL), another collagenaseb (330 U/mL), and hyaluronidasec (30 U/mL) diluted in Dulbecco modified Eagle medium (high glucose) that was supplemented with 10% fetal calf serum and 1% penicillin-streptomycin. After enzymatic digestion was completed, cells were separated by filtration through a 100-μm nylon mesh, centrifuged at 400 × g for 20 minutes, and washed twice with PBS solution. Viability and cell numbers were determined by use of trypan blue dye exclusion in a Neubauer chamber, and cells were plated in culture flasks at a density of 2 × 104 cells/cm2. Freshly isolated cells were maintained in Dulbecco modified Eagle medium (high glucose) with 10% fetal calf serum and 1% penicillin-streptomycin, enriched with 10 ng of human recombinant insulin/mL and 50 μg of phospho-ascorbic acid–trisodium salt/mL (basic medium), and incubated at 37°C, 5% CO2, and 95% humidity (passage 0). Culture medium was replaced with basic medium every 2 to 3 days. After confluency was reached, cells were detached with 0.05% trypsin-EDTA, centrifuged at 400 × g for 20 minutes, and washed once with PBS solution. Cells from each donor were resuspended in antimicrobial-free basic medium with 5% dimethyl sulfoxide at a density of 1 × 106 cells/cryovial and frozen at −80°C.
Cells harvested from each of the 4 canine cadaver donors were cultured separately (passage 0). They were pooled prior to the respective experiments (passage 1).
Experimental design
Canine IL-1βd was obtained as a solid lyophilized powder, reconstituted in sterile distilled water to a concentration of 50 μg/mL, and placed in aliquots and frozen at −20°C until usage. Frozen cells pooled from all 4 canine cadaver donors were thawed, diluted with basic medium, and centrifuged at 1,200 × g for 6 minutes. The cell pellet was resuspended in basic medium (with 5% fetal calf serum), and cells were counted and seeded onto 6-well plates at a density of 1.8 × 105 cells/well (passage 1). During incubation, plates were maintained at 37°C with 5% CO2 and 95% humidity. To investigate the effects of TGF-β, cells were incubated in basic medium alone or basic medium containing 1 or 10 ng of canine TGF-1βe/mL. Cultures were incubated for 48 hours, and cells then were incubated with (stimulated) or without 10 ng of IL-1β/mL for another 24 hours in basic medium supplemented as described previously. The incubation time of 24 hours was chosen on the basis of a previous study5 in which investigators found that the first peak of inflammatory marker release in osteoarthritis models occurs after cells have been incubated for 24 hours. After cultures were incubated for 72 hours, cells and culture supernatants were collected and stored at −80°C for subsequent assessment of PGE and NO concentrations and gene expression. All samples were prepared in triplicate. At the end of the experiment, the total yield of chondrocytes was 4 × 105 cells/well.
Histologic examination of extracellular matrix
Cells were examined daily by use of phase-contrast microscopy during in vitro culture. Extracellular matrix production was visible by use of Alcian blue stain. Cells of passage 0 and passage 1 were grown in monolayer, as described previously. After confluency was reached, cells were fixed with 10% formaldehyde for 15 minutes, incubated in 3% acetic acid for 3 minutes, and then incubated with 1% Alcian blue salt solutionc for 3 hours. Phase-contrast microscopy of stained cells was performed, and photographs were obtained of representative specimens.
Gene expression analysis
Total RNA was extracted from the cells with a commercially available kitf used in accordance with the manufacturer's instructions. Contaminating residual genomic DNA was removed with an endonuclease.g Purity and concentration of RNA were determined by absorbance measurement at 260 and 280 nm.h For each sample, 500 ng of RNA was reverse transcribed into cDNA by use of a commercial kiti and thermal cycler.j Relative gene expression of MMP-3,34 TIMP-2,35 iNOS,36 and COX-25 and the reference genes TBP37 and GAPDH38 (Appendix) was analyzed by use of a commercially available PCR assay kitk and real-time detection system.l Final volume of reaction samples was 20 μL, which consisted of 10 μL of master mix,k 400nM of forward primer, 400nM of reverse primer, and 1 μL of cDNA diluted 1:10 in PCR-grade water. Previously validated primers for target and reference genes were used. The amplification efficiency for each gene was determined from the slope of a standard curve generated by performing qPCR assays with a logarithmic dilution of the template DNA. All reactions were performed in triplicate by use of the following cycling conditions: initial denaturation at 95°C for 3 minutes, which was followed by 40 cycles of denaturation at 95°C for 3 seconds, annealing at the appropriate temperature for 20 seconds, and extension at 72°C for 1 second. Control samples (no reverse transcriptase and no template) were included in each assay. To verify specificity of the PCR assay products, a melting curve analysis was performed by heating the samples from 55° to 99°C in 1°C increments with continuous measurement of fluorescence. Relative expression was obtained by normalizing target gene expression to that of the reference genes TBP and GAPDH. The change in gene expression for each sample was calculated by use of computer software.m
Assay of NO concentrations
Nitric oxide is a short-lived free radical that is rapidly metabolized to nitrite. Therefore, the nitrite concentration was quantified by use of a calorimetric assay and used as an indicator of NO production. Briefly, 50 μL of Griess reagent (1:1 mixture of 0.1% sulfanilamide in 5% phosphoric acid and 0.1% N-naphthyl-ethylenediamine dihydrochloride) was added to 50 μm of cell culture supernatant and allowed to incubate for 10 minutes. Absorbance then was measured at 540 nm on a plate reader.n A standard curve was generated from solutions containing 0 to 6 μg of sodium nitrite/mL.o
Assay of PGE concentrations
Stored supernatants were thawed and assayed for PGE concentration by use of a commercially available enzyme immunoassay kitp that was used in accordance with the manufacturer's instructions. Optical density was measured at 450 nm on a plate reader.q Assay specificity was approximately 100% for PGE2. Cross-reactivity was 100% for PGE3 and 27% for PGE1.
Statistical analysis
Data for the real-time qPCR assay were analyzed as logarithmic (base 2) ratios of expression. The study was conducted as 3 separate experiments in duplicate for PGE and NO concentrations and in triplicate for gene expression analysis by use of pooled cells from the 4 canine cadaver donors. To compare the effects of TGF-β and IL-1β, all data were analyzed with a 2-factor ANOVA by use of a statistical program.r When there was a significant main effect of TGF-β or IL-1β or an interaction between TGF-β and IL-1β, a Bonferroni post hoc test was performed to detect differences between means. Significance for the ANOVA and post hoc test was set at α = 0.01.
Results
Chondrocyte in vitro culture
Examination after application of trypan blue dye stain revealed that viability of the isolated chondrocytes was > 90%. Cells adhered to the bottom of the flasks within 24 to 72 hours after seeding. There was no appreciable variation of viability between cultured cells isolated from the various donors. Cells in monolayer appeared small and had a polygonal shape, although clusters of round cells remained. Cells in clusters were encapsulated in metachromatic material that consisted of glycosaminoglycans, as indicated by a positive response to Alcian blue stain (Figure 1).
Photomicrographs of canine chondrocytes isolated and cultured in monolayer for 10 days (passage 0; A) and isolated, cultured in monolayer for 10 days, frozen at −80°C, and then cultured for another 5 days (passage 1; B). Notice that chondrocytes of both passages form clusters of round cells and are encapsulated in extracellular matrix. Alcian blue stain; bar = 250 μm.
Citation: American Journal of Veterinary Research 78, 11; 10.2460/ajvr.78.11.1264
Gene expression of MMP-3 and TIMP-2
To determine the effect of TGF-β and IL-1β on cartilage matrix degradation, gene expression of MMP-3 and its antagonist TIMP-2 was examined (Figure 2). For cells stimulated with IL-1β alone, there was a 51fold increase in MMP-3 gene expression, whereas there was a 2-fold decrease in TIMP-2 gene expression, compared with results for cells incubated in the control medium. For cells treated with TGF-β alone, there was a substantial decrease in expression for both genes. Gene expression of MMP-3 was significantly lower in chondrocytes exposed to TGF-β and stimulated with IL-1β, compared with results for cells stimulated with IL-1β alone. Gene expression analysis revealed a 4-fold downregulation for 1 ng of TGF-β/mL and a 12-fold downregulation for 10 ng of TGF-β/mL. In contrast, gene expression of TIMP-2 was only significantly increased after addition of 1 ng of TGF-β/mL in combination with IL-1β. Expression of TIMP-2 in cells treated with 1 ng of TGF-β/mL in combination with IL-1β was slightly upregulated, compared with the response for cells treated with IL-1β alone. However, 10 ng of TGF-β/mL in combination with IL-1β had no significant effect on TIMP-2 gene expression.
Box-and-whisker plots of the effects of TGF-β on mRNA concentrations for MMP-3 (A) and TIMP-2 (B). Canine chondrocytes obtained from 4 canine cadavers were incubated (in triplicate) in medium supplemented with 1 ng of TGF-β/mL (TGF1) and 10 ng of TGF-β/mL (TGF10) for 48 hours followed by incubation with or without IL-1β (10 ng/mL) for 24 hours. Data were normalized on the basis of mRNA concentrations for the housekeeping genes GAPDH and TBP and reported as log2-fold changes relative to results for the untreated control cells (Con). Each box represents the 25th to 75th percentiles, the horizontal line in each box represents the mean, and the whiskers represent the minimum and maximum values. Notice that the scale on the y-axis differs between panels. *Value differs significantly (P < 0.01) from the value for the untreated control cells. †Value differs significantly (P < 0.01) from the value for the IL-1β–treated control cells.
Citation: American Journal of Veterinary Research 78, 11; 10.2460/ajvr.78.11.1264
Gene expression of iNOS and NO concentration
Gene expression of iNOS (Figure 3) and the concomitant NO concentration (Figure 4), which is an important inflammatory mediator in osteoarthritis, were determined. Cells stimulated with IL-1β alone had significantly higher gene expression of iNOS and a significantly higher NO concentration than did chondrocytes incubated in control medium. Gene expression of iNOS and generation of NO were not affected by TGF-β alone. In IL −1β–stimulated cells treated with the 2 concentrations of TGF-β, IL-induced iNOS gene expression and NO concentration were decreased in a dose-dependent manner. There was a 3-fold downregulation of iNOS gene expression for 1 ng of TGF-β/mL and a 6-fold downregulation for 10 ng of TGF-β/mL, compared with results for cells treated with IL-1β alone.
Box-and-whisker plot of the effects of TGF-β on gene expression of iNOS in canine chondrocytes incubated with 1 and 10 ng of TGF-β/mL for 48 hours followed by incubation with or without IL-1β (10 ng/mL) for 24 hours. See Figure 2 for key.
Citation: American Journal of Veterinary Research 78, 11; 10.2460/ajvr.78.11.1264
Mean ± SD concentrations of NO in canine chondrocytes incubated with 1 and 10 ng of TGF-β/mL for 48 hours followed by incubation with or without IL-1β (10 ng/mL) for 24 hours. Concentrations of NO were determined as the nitrite concentrations by use of the Griess assay. See Figure 2 for key.
Citation: American Journal of Veterinary Research 78, 11; 10.2460/ajvr.78.11.1264
Gene expression of COX-2 and PGE concentration
Effects on PGE, which is another important inflammatory mediator, were determined by gene expression analysis of the PGE-generating enzyme COX-2 (Figure 5) and by measuring the PGE concentration (Figure 6). When cells were stimulated with IL-1β alone, there was a significant increase in COX-2 gene expression, which was accompanied by a high PGE concentration. For chondrocytes incubated with TGF-β alone, no significant changes in PGE concentration were found in the cell culture supernatant. In contrast, COX-2 gene expression was approximately twice as high for cells incubated with 10 ng of TGF-β/mL. When cells were stimulated with IL-1β, 10 ng of TGF-β/mL significantly reduced gene expression of COX-2, compared with results for cells stimulated with IL-1β alone. This change in gene expression was associated with significantly lower PGE concentrations in cells treated with TGF-β in combination with IL-1β.
Box-and-whisker plot of the effects of TGF-β on gene expression of COX-2 in canine chondrocytes incubated with 1 and 10 ng of TGF-β/mL for 48 hours followed by incubation with or without IL-1β (10 ng/mL) for 24 hours. See Figure 2 for key.
Citation: American Journal of Veterinary Research 78, 11; 10.2460/ajvr.78.11.1264
Mean ± SD concentration of PGE in canine chondrocytes incubated with 1 and 10 ng of TGF-β/mL for 48 hours followed by incubation with or without IL-1β (10 ng/mL) for 24 hours. Concentrations of PGE were determined by use of an enzyme immunoassay kit. See Figure 2 for key.
Citation: American Journal of Veterinary Research 78, 11; 10.2460/ajvr.78.11.1264
Discussion
For the study reported here, we chose to use a 2-D technique, similar to the one used in another study.5 Effects in monolayer cultures can only be attributable to cell metabolism and are not affected by surrounding 3-D structures. Additionally, all cells in a monolayer culture have the same access to cell culture media components and stimulants. A major disadvantage is that chondrocytes grown in monolayer tend to lose their phenotype and become fibroblastoid.39 However, because the cells used in the present study formed clusters encapsulated in extracellular matrix, we believed that the cell culture consisted primarily of differentiated chondrocytes.
It is known that IL-1β is a major trigger in osteoarthritis and stimulates catabolic changes, suppresses anabolic pathways, and decreases matrix synthesis.8 In chondrocyte culture, it is also known that IL-1β initiates an inflammatory cascade comparable to that of naturally occurring osteoarthritis.4–7 In the present study, the addition of IL-1β led to higher expression of all genes and concentrations of inflammatory mediators selected for analysis, compared with results for nonstimulated control cells. Analysis of data for the real-time qPCR assay revealed a ≥ 35-fold upregulation for expression of the catabolic enzymes iNOS, COX-2, and MMP-3, whereas the matrix-protective enzyme TIMP-2 was slightly downregulated. The cells were more responsive to stimulation to induce osteoarthritic changes than has been reported for other studies on canine chondrocytes in 2-D or 3-D culture, even when higher IL-1β concentrations6,7 or a combination of several cytokines4,5 were used. Therefore, we concluded that the addition of 10 ng of IL-1β/mL for 24 hours was sufficient for canine chondrocyte cultures in monolayer to evoke a subset of events similar to those of naturally occurring osteoarthritis. The canine cell culture described here served as a simple in vitro technique to mimic osteoarthritis in dogs. This technique may be used to investigate the mechanisms underlying osteoarthritis in dogs and to explore new treatment options for this degenerative joint disease.
To our knowledge, the study reported here was the first in which in vitro evaluation of the impact of TGF-β to mimic osteoarthritis in dogs has been described. The effects of TGF-β on chondrocytes are rather complex. Although members of the TGF family are important for chondrocyte differentiation22 and the maintenance of healthy cartilage,40 some authors have detected a negative impact,28,29 which suggests that TGF-β may also contribute to the pathogenesis of osteoarthritis. In the present study, we found no evidence for detrimental effects of TGF-β.
To investigate combined actions of TGF-β and IL-1β on chondrocyte-specific gene expression and mediator release, both cytokines were added alone but also in combination to the cells after pretreatment with TGF-β. Different concentrations have been used to detect potential synergistic41,42 or antagonistic effects.24,27 In fact, TGF-β in the present study could have attenuated signs of cartilage degradation induced by IL-1β. Only a few in vivo43,44 and in vitro5,7 studies have been conducted to examine the role of MMP-3 in osteoarthritis of dogs. The MMPs degrade type II collagen,45 which is a major component of the extracellular matrix. In particular, MMP-3 is a useful marker of joint disease in dogs.44 In healthy joints, the destructive actions of MMPs are balanced by their inhibitor TIMPs, which act by blocking MMPs in a ratio of 1 to 1.46,47 Therefore, protective actions on the extracellular matrix are mediated by a higher expression of TIMPs or a lower expression of MMPs. In the study reported here, TGF-β alone reduced MMP-3 gene expression but decreased the expression of its inhibitor TIMP-2. However, the ratio of MMP-3 to TIMP-2 was lower in cells treated with TGF-β, which indicated that TGF-β alone significantly inhibited matrix degradation in healthy cartilage. When TGF-β was applied in combination with IL-1β, 1 ng of TGF-β/mL caused an effective dose-dependent downregulation of MMP-3 gene expression that was accompanied by a slight increase in TIMP-2 gene expression. Because the ratio of MMP-3 to TIMP-2 decreased in cells treated with TGF-β applied in combination with IL-1β, compared with result for IL-1β–stimulated control cells, we concluded that TGF-β applied in low concentrations had a protective effect on cartilage matrix. Whether expression of other members of the TIMP family would be increased or other members of the MMP family would be decreased, which therefore may have contributed to the favorable response, would need to be investigated in additional studies.
Nitric oxide exerts a number of detrimental effects on cartilage, including enhancement of matrix destruction, induction of inflammatory mediators, and apoptosis of chondrocytes.48,49 Incubation with TGF-β followed by stimulation with IL-1β suppressed NO concentrations and iNOS gene expression in a dose-dependent manner. These results indicated that the strong decrease in NO concentration was, at least in part, associated with the reduction in gene expression of the NO-generating enzyme iNOS. Overall, results of the present study confirmed that TGF-β rapidly attenuated IL-1β–induced NO production in canine chondrocytes. In accordance with results of other studies, TGF-β alone did not alter iNOS mRNA or NO concentrations, whereas IL-1β alone effectively induced iNOS gene expression and higher concentrations of NO. This pattern of responsiveness is known to be linked to highly differentiated cells14 and therefore also suggested that the cells used in the present study had many features of differentiated chondrocytes.
Depending on the concentration, PGE can exert anabolic or catabolic actions in cartilage. At higher concentrations, it is considered a major component of the pathological mechanisms that cause pain and joint inflammation,50 whereas at lower concentrations, it has been found to have protective effects on the extracellular matrix.51 Because there was no PGE assay commercially available that accurately discriminated between PGE2 and PGE3, total PGE concentration was measured in the supernatants. However, it has been found that in vivo concentrations of PGE3 are much lower in dogs than are PGE2 concentrations (ratio, approx 1 to 500).52 Therefore, we assumed that the significant changes in total PGE concentration were mainly attributable to PGE2 and not to PGE3. Analysis of the results for the present study indicated that TGF-β reduced the IL-dependent increase in PGE concentration in a dose-dependent manner, whereas only 10 ng of TGF-β/mL significantly decreased COX-2 gene expression. In cells exposed to TGF-β alone, PGE concentration was not affected, whereas COX-2 mRNA was slightly more abundant. Changes in COX-2 expression often were not consistent with PGE concentration in the cell culture medium. Therefore, we assumed that COX-2 gene expression may not have been the predominant pathway for altering PGE concentrations in canine chondrocytes. Taken together, these results suggested that TGF-β can decrease IL-induced PGE production, probably by allowing a shift from the deleterious effect of high concentrations of PGE to the rather chondroprotective effects at lower concentrations of PGE.
It is known that low concentrations of TGF-β decrease the matrix-degrading activity of IL-1β26,27 and stimulate matrix synthesis.21 In contrast, higher concentrations of TGF-β have catabolic effects on extracellular matrix, including upregulation of matrix-degrading enzymes.28,29 The diverse actions of TGF-β could be attributed to a dose-dependent modulation of signaling pathways.53 Although the canine chondrocytes of the present study were exposed to a maximum of 10 ng of TGF-β/mL over 72 hours, mostly beneficial effects on matrix metabolism were detected, even when used in combination with the catabolic mediator IL-1β. It was most probable that IL-1β signaling was rapidly altered by TGF-β in a dose-dependent manner. Studies26,54 on rabbit chondrocytes have revealed that TGF-β suppresses the production of IL-1β by down-regulating expression of the IL-1 receptor. The present study provided evidence that this may be the case for canine chondrocytes as well.
Changes in TGF-β signaling during maturation have been assessed in murine, bovine, and human cartilage samples.55,56 Results of those studies55,56 revealed an age-related decrease in TGF-β responsiveness and the loss of chondroprotective properties in mature cartilage. Although chondrocytes in the present study were obtained from older dogs, they were highly responsive to TGF-β. Therefore, we concluded that age-related changes were masked and TGF-β remained effective as a protective agent in cultured canine chondrocytes.
Analysis of the results for the present study suggested that TGF-β might be an important factor for limiting cartilage damage in dogs with osteoarthritis. Therefore, TGF-β should be considered as a therapeutic target for osteoarthritis in dogs.
Acknowledgments
Presented in part as an abstract at the meeting of the Specialist Group for Physiology and Biochemistry of the German Veterinary Medical Society, Berlin, March 2016.
The authors thank Bastian Kaiser for assistance with the gene expression analysis.
ABBREVIATIONS
| COX | Cyclooxygenase |
| GAPDH | Glyceraldehyde-3-phosphate dehydrogenase |
| IL | Interleukin |
| iNOS | Inducible nitric oxide synthase |
| MMP | Matrix metalloproteinase |
| NO | Nitric oxide |
| PG | Prostaglandin |
| qPCR | Quantitative PCR |
| TBP | TATA-binding protein |
| TGF | Transforming growth factor |
| TIMP | Tissue inhibitor of metalloproteinase |
Footnotes
Collagenase P, Roche Diagnostic Deutschland GmbH, Mannheim, Germany.
Collagenase CLS, Biochrom AG, Berlin, Germany.
Sigma-Aldrich Chemie GmbH, Steinheim, Germany.
Life Technologies, Carlsbad, Calif.
Sino Biological Inc, Beijing, China.
InviTrap spin cell RNA mini kit, Stratec Molecular GmbH, Berlin, Germany.
DNAse I, RNAse-free, Thermo Scientific Inc, Waltham, Mass.
Nanodrop 1000, Thermo Scientific Inc, Waltham, Mass.
Maxima First Strand cDNA synthesis kit for RT-qPCR, Thermo Scientific Inc, Waltham, Mass.
T1 thermocycler 96, Biometra GmbH, Göttingen, Germany.
KAPA Sybr Fast qPCR kit master mix universal, Kapa Biosystem Ltd, Cape Town, Republic of South Africa.
RotorGene 6000, Qiagen GmbH, Hilden, Germany.
Relative expression software tool, version 2.013, Qiagen GmbH, Hilden, Germany.
SpectraMax 340 PC, Molecular Device, Munich, Germany.
Carl Roth GmbH + Co KG, Karlsruhe, Germany.
Prostaglandin E2 enzyme immunoassay kit, Arbor Assay, Ann Arbor, Mich.
Victor2 1420 multilabel counter, PerkinElmer, Waltham, Mass.
GraphPad Prism 4 software, GraphPad Software Inc, La Jolla, Calif.
References
1. Pfander, D. Physiologie und Pathophysiologie des Gelenkknorpels Akt Rheumatol 2005; 30: 344–353.
2. Houard X, Goldring MB, Berenbaum F. Homeostatic mechanisms in articular cartilage and role of inflammation in osteoarthritis. Curr Rheumatol Rep 2013; 15: 375–385.
3. Johnston SA. Osteoarthritis. Joint anatomy, physiology, and pathobiology. Vet Clin North Am Small Anim Pract 1997; 27: 699–723.
4. Dycus DL, Au AY, Grzanna MW, et al. Modulation of inflammation and oxidative stress in canine chondrocytes. Am J Vet Res 2013; 74: 983–989.
5. Rai MF, Rachakonda PS, Manning K, et al. Quantification of cytokines and inflammatory mediators in a three-dimensional model of inflammatory arthritis. Cytokine 2008; 42: 8–17.
6. Kuroki K, Stoker AM, Cook JL. Effects of proinflammatory cytokines on canine articular chondrocytes in a three-dimensional culture. Am J Vet Res 2005; 66: 1187–1196.
7. Cook JL, Anderson CC, Kreeger JM, et al. Effects of human recombinant interleukin-1 beta on canine articular chondrocytes in three-dimensional culture. Am J Vet Res 2000; 61: 766–770.
8. Wojdasiewicz P, Poniatowski ŁA, Szukiewicz D. The role of inflammatory and anti-inflammatory cytokines in the pathogenesis of osteoarthritis. Mediators Inflamm 2014; 2014: 561459.
9. Cortial D, Gouttenoire J, Rousseau CF, et al. Activation by IL-1 of bovine articular chondrocytes in culture within a 3-D collagen-based scaffold. An in vitro model to address the effect of compounds with therapeutic potential in osteoarthritis. Osteoarthritis Cartilage 2006; 14: 631–640.
10. Fan Z, Bau B, Yang H, et al. Freshly isolated osteoarthritic chondrocytes are catabolically more active than normal chondrocytes, but less responsive to catabolic stimulation with interleukin-1beta. Arthritis Rheum 2005; 52: 136–143.
11. Kobayashi M, Squires GR, Mousa A, et al. Role of interleukin-1 and tumor necrosis factor alpha in matrix degradation of human osteoarthritic cartilage. Arthritis Rheum 2005; 52: 128–135.
12. Attur MG, Patel IR, Patel RN, et al. Autocrine production of IL-1 beta by human osteoarthritis-affected cartilage and differential regulation of endogenous nitric oxide, IL-6, prostaglandin E2, and IL-8. Proc Assoc Am Physicians 1998; 110: 65–72.
13. Pelletier JP, Mineau F, Ranger P, et al. The increased synthesis of inducible nitric oxide inhibits IL-1ra synthesis by human articular chondrocytes: possible role in osteoarthritic cartilage degradation. Osteoarthritis Cartilage 1996; 4: 77–84.
14. Blanco FJ, Geng Y, Lotz M. Differentiation-dependent effects of IL-1 and TGF-beta on human articular chondrocyte proliferation are related to inducible nitric oxide synthase expression. J Immunol 1995; 154: 4018–4026.
15. Pfander D, Heinz N, Rothe P, et al. Tenascin and aggrecan expression by articular chondrocytes is influenced by interleukin 1beta: a possible explanation for the changes in matrix synthesis during osteoarthritis. Ann Rheum Dis 2004; 63: 240–244.
16. Goldring MB, Birkhead J, Sandell LJ, et al. Interleukin 1 suppresses expression of cartilage-specific types II and IX collagens and increases types I and III collagens in human chondrocytes. J Clin Invest 1988; 82: 2026–2037.
17. Aigner T, Fundel K, Saas J, et al. Large-scale gene expression profiling reveals major pathogenetic pathways of cartilage degeneration in osteoarthritis. Arthritis Rheum 2006; 54: 3533–3544.
18. Yuan GH, Masuko-Hongo K, Sakata M, et al. The role of C–C chemokines and their receptors in osteoarthritis. Arthritis Rheum 2001; 44: 1056–1070.
19. Cicione C, Muiños-Lopéz E, Hermida-Gómez T, et al. Alternative protocols to induce chondrogenic differentiation: transforming growth factor-beta superfamily. Cell Tissue Bank 2015; 16: 195–207.
20. Csaki C, Matis U, Mobasheri A, et al. Chondrogenesis, osteogenesis and adipogenesis of canine mesenchymal stem cells: a biochemical, morphological and ultrastructural study. Histochem Cell Biol 2007; 128: 507–520.
21. Demoor-Fossard M, Boittin M, Redini F, et al. Differential effects of interleukin-1 and transforming growth factor beta on the synthesis of small proteoglycans by rabbit articular chondrocytes cultured in alginate beads as compared to monolayers. Mol Cell Biochem 1999; 199: 69–80.
22. Hunziker EB, Driesang IM, Morris EA. Chondrogenesis in cartilage repair is induced by members of the transforming growth factor-beta superfamily. Clin Orthop Relat Res 2001; 391: S171–S181.
23. Ikegawa N, Sasho T, Yamaguchi S, et al. Identification of genes required for the spontaneous repair of partial-thickness cartilage defects in immature rats. Connect Tissue Res 2016; 57: 190–199.
24. Vuolteenaho K, Moilanen T, Jalonen U, et al. TGF beta inhibits IL-1-induced iNOS expression and NO production in immortalized chondrocytes. Inflamm Res 2005; 54: 420–427.
25. Su S, Dehnade F, Zafarullah M. Regulation of tissue inhibitor of metalloproteinases-3 gene expression by transforming growth factor-beta and dexamethasone in bovine and human articular chondrocytes. DNA Cell Biol 1996; 15: 1039–1048.
26. Harvey AK, Hrubey PS, Chandrasekhar S. Transforming growth factor-beta inhibition of interleukin-1 activity involves down-regulation of interleukin-1 receptors on chondrocytes. Exp Cell Res 1991; 195: 376–385.
27. Pujol JP, Galera P, Redini F, et al. Role of cytokines in osteoarthritis: comparative effects of interleukin 1 and transforming growth factor-beta on cultured rabbit articular chondrocytes. J Rheumatol Suppl 1991; 27: 76–79.
28. Moulharat N, Lesur C, Thomas M, et al. Effects of transforming growth factor-beta on aggrecanase production and proteoglycan degradation by human chondrocytes in vitro. Osteoarthritis Cartilage 2004; 12: 296–305.
29. Moldovan F, Pelletier JP, Hambor J, et al. Collagenase-3 (matrix metalloprotease 13) is preferentially localized in the deep layer of human arthritic cartilage in situ: in vitro mimicking effect by transforming growth factor beta. Arthritis Rheum 1997; 40: 1653–1661.
30. Scharstuhl A, Glansbeek HL, van Beuningen HM, et al. Inhibition of endogenous TGF-beta during experimental osteoarthritis prevents osteophyte formation and impairs cartilage repair. J Immunol 2002; 169: 507–514.
31. van Beuningen HM, Glansbeek HL, van der Kraan PM, et al. Osteoarthritis-like changes in the murine knee joint resulting from intra-articular transforming growth factor-beta injections. Osteoarthritis Cartilage 2000; 8: 25–33.
32. Lee M-C, Ha C-W, Elmallah RK, et al. A placebo-controlled randomised trial to assess the effect of TGF-beta 1-expressing chondrocytes in patients with arthritis of the knee. Bone Joint J 2015; 97-B:924–932.
33. Kaps C, Fuchs S, Endres M, et al. Molekulare Charakterisierung von gezüchteten humanen dreidimensionalen Chondrozytentransplantaten. Orthopade 2004; 33: 76–85.
34. Kuroki K, Cook JL, Stoker AM, et al. Characterizing osteochondrosis in the dog: potential roles for matrix metalloproteinases and mechanical load in pathogenesis and disease progression. Osteoarthritis Cartilage 2005; 13: 225–234.
35. Aupperle H, Thielebein J, Kiefer B, et al. Expression of genes encoding matrix metalloproteinases (MMPs) and their tissue inhibitors (TIMPs) in normal and diseased canine mitral valves. J Comp Pathol 2009; 140: 271–277.
36. Morchón R, López-Belmonte J, Bazzocchi C, et al. Dogs with patent Dirofilaria immitis infection have higher expression of circulating IL-4, IL-10 and iNOS mRNA than those with occult infection. Vet Immunol Immunopathol 2007; 115: 184–188.
37. Peters IR, Peeters D, Helps CR, et al. Development and application of multiple internal reference (housekeeper) gene assays for accurate normalisation of canine gene expression studies. Vet Immunol Immunopathol 2007; 117: 55–66.
38. NG KW, Lima EG, Liming B, et al. Passaged adult chondrocytes can form engineered cartilage with functional mechanical properties: a canine model. Tissue Eng Part A 2010; 16: 1041–1051.
39. Rai MF, Rachakonda PS, Manning K, et al. Molecular and phenotypic modulations of primary and immortalized canine chondrocytes in different culture systems. Res Vet Sci 2009; 87: 399–407.
40. Shen J, Li J, Wang B, et al. Deletion of the transforming growth factor beta receptor type II gene in articular chondrocytes leads to a progressive osteoarthritis-like phenotype in mice. Arthritis Rheum 2013; 65: 3107–3119.
41. Mejiers MH, Aisa CM, Billingham ME, et al. The effect of interleukin-1 beta and transforming growth factor beta on cathepsin B acitivity in human articular. Agents Actions 1994; 41: C198–C200.
42. Fawthrop FW, Frazer A, Russell RG, et al. Effects of transforming growth factor beta on the production of prostaglandin E and caseinase activity of unstimulated and interleukin 1-stimulated human articular chondrocytes in culture. Br J Rheumatol 1997; 36: 729–734.
43. Fujita Y, Hara Y, Nezu Y, et al. Direct and indirect markers of cartilage metabolism in synovial fluid obtained from dogs with hip dysplasia and correlation with clinical and radiographic variables. Am J Vet Res 2005; 66: 2028–2033.
44. Hegemann N, Kohn B, Brunnberg L, et al. Biomarkers of joint tissue metabolism in canine osteoarthritic and arthritic joint disorders. Osteoarthritis Cartilage 2002; 10: 714–721.
45. Murphy G, Lee M. What are the roles of metalloproteinases in cartilage and bone damage? Ann Rheum Dis 2005; 64(suppl 4): iv44–iv47.
46. Bee A, Barnes A, Jones MD, et al. Canine TIMP-2: purification, characterization and molecular detection. Vet J 2000; 160: 126–134.
47. Gomis-Rüth FX, Maskos K, Betz M, et al. Mechanism of inhibition of the human matrix metalloproteinase stromelysin-1 by TIMP-1. Nature 1997; 389: 77–81.
48. Ridnour LA, Windhausen AN, Isenberg JS, et al. Nitric oxide regulates matrix metalloproteinase-9 activity by guanylyl-cyclase-dependent and -independent pathways. Proc Natl Acad Sci U S A 2007; 104: 16898–16903.
49. Whiteman M, Armstrong JS, Cheung NS, et al. Peroxynitrite mediates calcium-dependent mitochondrial dysfunction and cell death via activation of calpains. FASEB J 2004; 18: 1395–1397.
50. Attur M, Al-Mussawir HE, Patel J, et al. Prostaglandin E2 exerts catabolic effects in osteoarthritis cartilage: evidence for signaling via the EP4 receptor. J Immunol 2008; 181: 5082–5088.
51. Tchetina EV, Di Battista JA, Zukor DJ, et al. Prostaglandin PGE(2) at very low concentrations suppresses collagen cleavage in cultured human osteoarthritic articular cartilage: this involves a decrease in expression of proinflammatory genes, collagenases and COL10A1, a gene linked to chondrocyte hypertrophy. Arthritis Res Ther 2007; 9: R75.
52. Kearns RJ, Hayek MG, Turek JJ, et al. Effect of age, breed and dietary omega-6 (n-6): omega-3 (n-3) fatty acid ratio on immune function, eicosanoid production, and lipid peroxidation in young and aged dogs. Vet Immunol Immunopathol 1999; 69: 165–183.
53. Baugé C, Legendre F, Leclercq S, et al. Interleukin-1beta impairment of transforming growth factor beta1 signaling by down-regulation of transforming growth factor beta receptor type II and up-regulation of Smad7 in human articular chondrocytes. Arthritis Rheum 2007; 56: 3020–3032.
54. Rédini F, Mauviel A, Pronost S, et al. Transforming growth factor beta exerts opposite effects from interleukin-1 beta on cultured rabbit articular chondrocytes through reduction of interleukin-1 receptor expression. Arthritis Rheum 1993; 36: 44–50.
55. van der Kraan PM. Age-related alterations in TGF beta signaling as a causal factor of cartilage degeneration in osteoarthritis. Biomed Mater Eng 2014; 24(suppl): 75–80.
56. Blaney Davidson EN, Scharstuhl A, Vitters EL, et al. Reduced transforming growth factor-beta signaling in cartilage of old mice: role in impaired repair capacity. Arthritis Res Ther 2005; 7: R1338–R1347.
Appendix
Oligonucleotide primers used for real-time qPCR assays performed to analyze changes in gene expression in canine chondrocytes treated with IL-1β, TGF-β, or a combination of both.
| Gene | Accession No. | Primer sequence (5′-3′) | Amplicon size (bp) | TA (°C) | Reference |
|---|---|---|---|---|---|
| MMP-3 | NM_001002967 | F ATGGCATCCAGTCCCTGTAT R AAAGAACAGGAACTCTCCCC | 161 | 53 | 34 |
| TIMP-2 | NM_001003082.1 | F CAACGCGGACGTAGTGATTA R TTCCCGCAATGAGATACTCC | 227 | 53 | 35 |
| COX-2 | NM_001003354 | F GCCTTACCCAGTTTGTGGAA R AGCCTAAAGCGTTTGCGATA | 163 | 52 | 31 |
| iNOS | XM_005624846.1 | F CTTCAACCCCAAGGTTGTCTGCAT R ATGTCATGAGCAAAGGCGCAGAAC | 231 | 60 | 36 |
| TBP | XM_849432.2 | F CTATTTCTTGGTGTGCATGAGG R CCTCGGCATTCAGTCTTTTC | 96 | 55 | 37 |
| GAPDH | NM_001003142.1 | F GTGACTTCAACAGTGACACC R CCTTGGAGGCCATGTAGACC | 153 | 52 | 38 |
Target genes were normalized to expression of the reference genes TBP and GAPDH.
F = Forward. R = Reverse. TA = Annealing temperature.
