• View in gallery
    Figure 1—

    Histograms of c-Fos (A and B) and integrin β-2 (C and D) expression by cytotoxic T cells (A and C) and DP T cells (B and D) obtained from colostrum (solid line) and peripheral blood (dashed line) samples collected from a representative sow. The number in the upper right corner of each histogram is the difference in median fluorescent intensity (MFI) between colostral and peripheral blood T cells.

  • 1. Pluske JR. Gut development: interactions between nutrition, gut health and immunity in young pigs. In: Taylor-Pickard JA, Spring P, eds. Gut efficiency; the key ingredient in pig and poultry production. Wageningen, The Netherlands: Wageningen Academic Publishers, 2008;3956.

    • Search Google Scholar
    • Export Citation
  • 2. Pomorska-Mól M, Markowska-Daniel I. Age-dependent changes in relative and absolute size of lymphocyte subsets in the blood of pigs from birth to slaughter. Bull Vet Inst Pulawy 2011; 55: 305310.

    • Search Google Scholar
    • Export Citation
  • 3. Wagstrom EA, Yoon K-J, Zimmerman JJ. Immune components in porcine mammary secretions. Viral Immunol 2000; 13: 383397.

  • 4. Hlavova K, Stepanova H, Faldyna M. The phenotype and activation status of T and NK cells in porcine colostrum suggest these are central/effector memory cells. Vet J 2014; 202: 477482.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 5. Nascimbeni M, Shin E-C, Chiriboga L, et al. Peripheral CD4+CD8+ T cells are differentiated effector memory cells with antiviral functions. Blood 2004; 104: 478486.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 6. Zuckermann FA, Husmann RJ. Functional and phenotypic analysis of porcine peripheral blood CD4/CD8 double-positive T cells. Immunology 1996; 87: 500512.

    • Search Google Scholar
    • Export Citation
  • 7. Tuboly S, Bernáth S, Glávits R, et al. Intestinal absorption of colostral lymphoid cells in newborn piglets. Vet Immunol Immunopathol 1988; 20: 7585.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 8. Williams PP. Immunomodulating effects of intestinal absorbed maternal colostral leukocytes by neonatal pigs. Can J Vet Res 1993; 57: 18.

    • Search Google Scholar
    • Export Citation
  • 9. Bandrick M, Ariza-Nieto C, Baidoo SK, et al. Colostral antibody-mediated and cell-mediated immunity contributes to innate and antigen-specific immunity in piglets. Dev Comp Immunol 2014; 43: 114120.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 10. Bandrick M, Pleters M, Pijoan C, et al. Passive transfer of maternal Mycoplasma hyopneumoniae-specific cellular immunity to piglets. Clin Vaccine Immunol 2008; 15: 540543.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 11. Oh Y, Seo HW, Han K, et al. Protective effect of the maternally derived porcine circovirus type 2 (PCV2)-specific cellular immune response in piglets by dam vaccination against PCV2 challenge. J Gen Virol 2012; 93: 15561562.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 12. Huang DW, Sherman BT, Lempicki RA. Systematic and integrative analysis of large gene lists using DAVID bioinformatics resources. Nat Protoc 2008; 4: 4457.

    • Search Google Scholar
    • Export Citation
  • 13. Huang DW, Sherman BT, Lempicki RA. Bioinformatics enrichment tools: paths toward the comprehensive functional analysis of large gene lists. Nucleic Acids Res 2009; 37: 113.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 14. Yajima T, Inoue R, Matsumoto M, et al. Non-neuronal release of ACh plays a key role in secretory response to luminal propionate in rat colon. J Physiol 2011; 589: 953962.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 15. Yanai H. 4 Steps Excel statistics (Japanese). Tokorozawa, Saitama, Japan: The Publisher OMS Ltd, 2004.

  • 16. Broere F, Apasov SG, Sitkovsky MV, et al. T cell subsets and T cell-mediated immunity. In: Nijkamp FP, Parnham MJ, eds. Principles of immunopharmacology. 3rd ed. Basel, Switzerland: Springer Basel AG, 2011;1527.

    • Search Google Scholar
    • Export Citation
  • 17. Reiner G, Heinricy L, Brenig B, et al. Cloning, structural organization, and chromosomal assignment of the porcine c-fos proto-oncogene, FOS. Cytogenet Genome Res 2000; 89: 5961.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 18. Kim D-I, Kim K-H, Kang J-H, et al. Trans-10, cis-12-conjugated linoleic acid modulates NF-κB activation and TNF-α production in porcine peripheral blood mononuclear cells via a PPARγ-dependent pathway. Br J Nutr 2011; 105: 13291336.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 19. Sica A, Dorman L, Viggiano V, et al. Interaction of NF-kB and NFAT with the interferon-γ promoter. J Biol Chem 1997; 272: 3041230420.

  • 20. Fan Y-H, Chow K-C, Huang S-Y, et al. A missense polymorphism in porcine interferon-γ cDNA affects antiviral activity of the protein variant. Mol Immunol 2007; 44: 32973304.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 21. Czarneski J, Berguer P, Bekinschtein P, et al. Neonatal infection with a milk-borne virus is independent of β7 integrin- and L-selectin-expressing lymphocytes. Eur J Immunol 2002; 32: 945956.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 22. Moreno S, Álvarez B, Martínez P, et al. Analysis of chemokine receptor CCR7 expression on porcine blood T lymphocytes using a CCL19-Fc fusion protein. Dev Comp Immunol 2013; 39: 207213.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 23. Peroni DG, Chirumbolo S, Veneri D, et al. Colostrum-derived B and T cells as an extra-lymphoid compartment of effector cell populations in humans. J Matern Fetal Neonatal Med 2013; 26: 137142.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 24. Sabbaj S, Ghosh MK, Edwards BH, et al. Breast milk- derived antigen-specific CD8+ T cells: an extralymphoid effector memory cell population in humans. J Immunol 2005; 174: 29512956.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 25. Lederman MM, Penn-Nicholson A, Cho M, et al. Biology of CCR5 and its role in HIV infection and treatment. JAMA 2006; 296: 815826.

  • 26. Haverson K, Bailey M, Stokes CR. T-cell populations in the pig intestinal lamina propria: memory cells with unusual phenotypic characteristics. Immunology 1999; 96: 6673.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 27. Hamann D, Baars PA, Rep MHG, et al. Phenotypic and functional separation of memory and effector human CD8+ T cells. J Exp Med 1997; 186: 14071418.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 28. Pribila JT, Quale AC, Mueller KL, et al. Integrins and T cell-mediated immunity. Annu Rev Immunol 2004; 22: 157180.

  • 29. Ebdrup L, Krog J, Granfeldt A, et al. Dynamic expression of the signal regulatory protein α and CD18 on porcine PBMC during acute endotoxaemia. Scand J Immunol 2008; 68: 430437.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 30. Aitken SL, Karcher EL, Rezamand P, et al. Evaluation of antioxidant and proinflammatory gene expression in bovine mammary tissue during the periparturient period. J Dairy Sci 2009; 92: 589598.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 31. Waller KP. Mammary gland immunology around parturition. In: Mol JA, Clegg RA, eds. Biology of the mammary gland. New York: Springer US, 2002; 231245.

    • Search Google Scholar
    • Export Citation

Advertisement

Comparison of gene expression profiles of T cells in porcine colostrum and peripheral blood

Shohei OgawaLaboratory of Animal Science, Graduate School of Life and Environmental Sciences, Kyoto Prefectural University, Shimogamo-Hangi, Kyoto 606-8522, Japan.

Search for other papers by Shohei Ogawa in
Current site
Google Scholar
PubMed
Close
 MSc
,
Mie OkutaniLaboratory of Animal Science, Graduate School of Life and Environmental Sciences, Kyoto Prefectural University, Shimogamo-Hangi, Kyoto 606-8522, Japan.

Search for other papers by Mie Okutani in
Current site
Google Scholar
PubMed
Close
 MSc
,
Takamitsu TsukaharaLaboratory of Animal Science, Graduate School of Life and Environmental Sciences, Kyoto Prefectural University, Shimogamo-Hangi, Kyoto 606-8522, Japan.
Kyoto Institute of Nutrition and Pathology, Ujitawara, Tsuzuki, Kyoto 610–0231, Japan.

Search for other papers by Takamitsu Tsukahara in
Current site
Google Scholar
PubMed
Close
 PhD
,
Nobuo NakanishiKyodoken Institute, Shimoitabashi, Fushimi, Kyoto 612-8073, Japan.

Search for other papers by Nobuo Nakanishi in
Current site
Google Scholar
PubMed
Close
 VMD
,
Yoshihiro KatoTechnical Center, Toyohashi Feed Mills, Kawada, Shinshiro, Aichi 441-1346, Japan.

Search for other papers by Yoshihiro Kato in
Current site
Google Scholar
PubMed
Close
 VMD
,
Kikuto FukutaTechnical Center, Toyohashi Feed Mills, Kawada, Shinshiro, Aichi 441-1346, Japan.

Search for other papers by Kikuto Fukuta in
Current site
Google Scholar
PubMed
Close
 VMD
,
Gustavo A. Romero-PérezKyoto Institute of Nutrition and Pathology, Ujitawara, Tsuzuki, Kyoto 610–0231, Japan.

Search for other papers by Gustavo A. Romero-Pérez in
Current site
Google Scholar
PubMed
Close
 PhD
,
Kazunari UshidaLaboratory of Animal Science, Graduate School of Life and Environmental Sciences, Kyoto Prefectural University, Shimogamo-Hangi, Kyoto 606-8522, Japan.

Search for other papers by Kazunari Ushida in
Current site
Google Scholar
PubMed
Close
 PhD
, and
Ryo InoueLaboratory of Animal Science, Graduate School of Life and Environmental Sciences, Kyoto Prefectural University, Shimogamo-Hangi, Kyoto 606-8522, Japan.

Search for other papers by Ryo Inoue in
Current site
Google Scholar
PubMed
Close
 PhD

Abstract

OBJECTIVE To compare gene expression patterns of T cells in porcine colostrum and peripheral blood.

ANIMALS 10 multiparous sows.

PROCEDURES Cytotoxic and CD4-CD8 double-positive T cells were separated from porcine colostrum and peripheral blood. Total RNA was extracted. The cDNA prepared from RNA was amplified, labeled, fragmented, and competitively hybridized to DNA microarray slides. The DNA microarray data were validated by use of a real-time reverse-transcription PCR assay, and expression of the genes FOS, NFKBI, IFNG, CXCR6, CCR5, ITGB2, CCR7, and SELL was assessed. Finally, DNA microarray data were validated at the protein level by use of flow cytometry via expression of c-Fos and integrin β-2.

RESULTS Evaluation of gene expression profiles indicated that in contrast to results for peripheral blood, numerous cell-signaling pathways might be activated in colostrum. Profile analysis also revealed that FOS and NFKBI (genes of transcription factors) were involved in most cell-signaling pathways and that expression of these genes was significantly higher in colostral T cells than in peripheral blood T cells. Furthermore, CCR7 and SELL (genes of T-cell differentiation markers) in colostral T cells had expression patterns extremely similar to those found in effector or effector memory T cells.

CONCLUSIONS AND CLINICAL RELEVANCE All or most of the T cells in colostrum had an effector-like phenotype and thus were more activated than those in peripheral blood. This gene expression profile would enable T cells to migrate to mammary glands, be secreted in colostrum, and likely contribute to passive immunity provided by sows to newborn pigs.

Abstract

OBJECTIVE To compare gene expression patterns of T cells in porcine colostrum and peripheral blood.

ANIMALS 10 multiparous sows.

PROCEDURES Cytotoxic and CD4-CD8 double-positive T cells were separated from porcine colostrum and peripheral blood. Total RNA was extracted. The cDNA prepared from RNA was amplified, labeled, fragmented, and competitively hybridized to DNA microarray slides. The DNA microarray data were validated by use of a real-time reverse-transcription PCR assay, and expression of the genes FOS, NFKBI, IFNG, CXCR6, CCR5, ITGB2, CCR7, and SELL was assessed. Finally, DNA microarray data were validated at the protein level by use of flow cytometry via expression of c-Fos and integrin β-2.

RESULTS Evaluation of gene expression profiles indicated that in contrast to results for peripheral blood, numerous cell-signaling pathways might be activated in colostrum. Profile analysis also revealed that FOS and NFKBI (genes of transcription factors) were involved in most cell-signaling pathways and that expression of these genes was significantly higher in colostral T cells than in peripheral blood T cells. Furthermore, CCR7 and SELL (genes of T-cell differentiation markers) in colostral T cells had expression patterns extremely similar to those found in effector or effector memory T cells.

CONCLUSIONS AND CLINICAL RELEVANCE All or most of the T cells in colostrum had an effector-like phenotype and thus were more activated than those in peripheral blood. This gene expression profile would enable T cells to migrate to mammary glands, be secreted in colostrum, and likely contribute to passive immunity provided by sows to newborn pigs.

Neonatal pigs are immunocompromised immediately after they are born because the transfer of maternal immune factors to porcine fetuses is prevented by the epitheliochorial structure of the porcine placenta.1 Therefore, prompt postnatal ingestion of colostrum is crucial for newborn pigs to acquire passive immunity from sows.

Porcine colostrum contains soluble components (eg, immunoglobulins and cytokines) as well as mononuclear cells such as B cells (CD21+), monocytes or macrophages (CD14+), neutrophils, epithelial cells, DP T cells (CD3+CD4+CD8+), cytotoxic T cells (CD3+CD4CD8+), and helper T cells (CD3+CD4+CD8).2,3 In particular, DP T cells are considered to be a typical T-cell subset in several species, including pigs. Moreover, in contrast to helper T cells, which are rarely found in colostrum, DP T cells along with cytoxic T cells are major T-cell subsets in porcine colostrum.4 The DP T cells are also abundant (10% to 60% of lymphocytes) in peripheral blood of healthy pigs, which is in contrast to their abundance in human blood, in which they are scarcely found (< 5% of lymphocytes).5,6

Colostral mononuclear cells from the dam can reach the bloodstream and various lymphoid tissues of her newborn pigs.7,8 In contrast, PBMCs from the dam and CMCs from unrelated sows are not absorbed when injected directly into the stomach of baby pigs.7 These findings suggest that in contrast to PBMCs, CMCs may have distinct characteristics and certain host-specificity for transfer. Investigators of a study9 reported that CMCs had significantly higher natural-killer activity than did PBMCs collected from the same sows. In addition, flow cytometry analysis conducted in another study4 revealed differences in expression between some cell surface markers (eg, CCR7 and CD25) in colostral and blood natural-killer cells and T cells. With respect to colostral T cells, investigators have reported10,11 the transfer of antigen-specific T cells from sows to newborn pigs via the ingestion of colostrum; thus, the presence of antigen-specific memory T cells in colostrum is plausible.

The objective of the study reported here was to determine differences in gene expression profiles between porcine CMCs and PBMCs. Transcriptome analysis of DP T cells and cytotoxic T cells from colostrum and peripheral blood of parturient sows was performed by the use of DNA microarray techniques. In addition, some genes differentially expressed between colostral and peripheral blood T cells were validated by use of a qRT-PCR assay and flow cytometry.

Materials and Methods

Animals and collection of samples

Ten sows (Large White–Landrace crossbreeds) were used for the study. All sows were reared on commercial farms in Japan. Two sows were transported to a research farm approximately 10 days prior to parturition; colostrum and peripheral blood samples were collected from these sows at the research farm and used for DNA microarray analysis. All other sows farrowed at their farm of origin, and samples were collected at those locations. Colostrum and peripheral blood samples were collected from 6 other sows and used for qRT-PCR assay. Colostrum and peripheral blood samples were collected from the final 2 sows and used for flow cytometry. Colostrum samples (25 mL/sample) were manually collected into sterile polypropylene tubes, and peripheral blood samples (10 mL/sample) were collected from the caudal vein into vacuum tubes containing heparin.a All samples were stored at 4°C and processed within 24 hours after collection. All animals were handled in accordance with guidelines for animal studies issued by Kyoto Prefectural University.

Isolation of lymphocytes

Colostrum samples were diluted (1:1 [vol/vol]) with PBS solution (140mM NaCl, 3mM KCl, 10mM Na2HPO4, and 2mM KH2PO4; pH, 7.4) and centrifuged at 900 × g for 10 minutes at 4°C. Cell suspensions were washed twice with PBS solution and, when needed, filteredb to remove debris. Peripheral blood samples were also diluted (1:1 [vol/vol]) with PBS solution. The CMCs and PBMCs were then collected from diluted samples by use of density gradient centrifugationc (1.084 g/mL of medium). Red blood cells were lysed by incubation with ammonium chloride–potassium lysing solution (150mM NH4Cl, 10mM KHCO3, and 0.1mM EDTA). Nylon wool fiber columns were used to enrich T cells. Briefly, nylon wool fiber columns were prepared by packing nylon wool fiberd into 10-mL syringes.e Each column was then equilibrated with culture mediumf supplemented with 10% (vol/vol) fetal bovine serum.g Then, colostral and blood lymphocytes suspended in warm (37°C) mediumf were loaded into the columns and incubated at 37°C for at least 30 minutes. Finally, nonadherent lymphocytes were eluted by adding more mediumf into the columns.

Sorting of cytotoxic T cells and DP T cells

Monoclonal antibodies against porcine CD3 ε (clone PPT3; R-phycoerythrin– and cyanine-5–conjugated),h CD4a (clone 74–12–4; phycoerythrin-conjugated),i and CD8 α (clone 76–2–11; FITC-conjugated)h were used to sort cytotoxic T cells and DP T cells. Colostral and blood lymphocytes were stained by incubation with optimal amounts of each monoclonal antibody at 4°C in the dark. Separately, 5,000 to 10,000 cytotoxic T cells and DP T cells in colostrum and blood samples were sorted by use of a benchtop cell sorter.j All sorted cells were then suspended in RNA extraction reagentk immediately after sorting and stored at −80°C until further use.

Evaluation with a DNA microarray

Total RNA was extracted from each sample by incubation with a mixture containing the RNA extraction reagentk and chloroform; RNA was recovered by centrifugation at 20,400 × g for 15 minutes at 4°C and purified by use of an RNA cleanup kit.l The concentration and quality of RNA were evaluated by use of a spectrophotometerm and chip-based capillary gel electrophoresis,n respectively. Then, cDNA was prepared from 10 ng of total RNA (RNA integrity number > 8.5) by use of a system for cDNA amplification for gene expression analysis.o After amplification was completed, cDNA samples from colostrum were labeled with a green fluorescent dyep and those from blood were labeled with a red fluorescent dyeq by use of a genomic labeling system.r Fluorescent dye–labeled cDNA was quantitatively measured and qualitatively assessed by use of a spectrophotometer.m All procedures were performed in accordance with the manufacturer's instructions. Each sample (825 ng) of fluorescent dye–labeled cDNA was fragmented by incubation with 0.55 Kunitz units of a DNase reagents for 10 minutes at 37°C. After fragmentation was completed, samples were competitively hybridized to an array slidet by incubation for 17 hours at 65°C. Images were scanned with a microarray scanner.u

Analysis of DNA microarray data

Data were analyzed with commercially available software.v,w Signal intensity values were initially normalized by use of the quartile normalization method and then logarithmically (log2) transformed. The log2 ratios of normalized signal intensity values (matching subsets of colostral T cells and blood T cells) were calculated to compare gene expression of T cells between colostrum and peripheral blood.

Genes were characterized as having high expression in colostral T cells when normalized signal intensity values were ≥ 100 in colostral T cells and the log2 ratio was ≥ 0.5 for samples obtained from both sows. Similarly, genes were characterized as having low expression in colostral T cells when normalized signal intensity values were ≥ 100 in blood T cells and the log2 ratio was ≤ −0.5. Analyses of KEGG pathways were conducted for genes with high and low expression in colostral and blood cytotoxic T cells and DP T cells by use of a previously reported database.12,13 Gene symbols of selected genes were used for the KEGG pathway analysis, and Sus scrofa was selected as the species.

Validation of DNA microarray data by use of a qRT-PCR assay

The DNA microarray data were validated by use of a qRT-PCR assay. Cytotoxic T cells and DP T cells in colostrum and blood from each sow were sorted as described previously. Synthesis of cDNA was performed with a kitx used in accordance with the manufacturer's instructions. To minimize potential bias, cDNA samples from both sows were newly prepared for this experiment. Primer design was conducted as described elsewhere,14 with minor modifications. Specific primers and probe sets for each gene were designed with available softwarey on the basis of GenBank accession numbers, and all primers then were synthesizedz (Appendix).

Expression of ACTB as the housekeeping gene and 8 differentially expressed genes (FOS, NFKB1, IFNG, CXCR6, CCR5, ITGB2, CCR7, and SELL) were assessed. Analyses by use of the qRT-PCR assay were conducted with a real-time PCR systemaa as described elsewhere.14 Each 10-μL qRT-PCR mixture contained 5 μL of probe mixture,bb 0.2μM of forward and reverse primers, 0.2μM of hydrolysis probes,cc and 1 μL of cDNA sample. Amplification conditions were initial denaturation at 95°C for 5 minutes and 55 cycles of denaturation at 95°C for 10 seconds with combined annealing-extension at 60°C for 30 seconds. Values for the fold change were calculated with the software of the real-time PCR system.aa Fold-change values were calculated as follows:

article image

where ΔCt was the Δ threshold cycle.

Validation of DNA microarray data by use of flow cytometry

The DNA microarray data were also validated at the protein level by use of flow cytometry. Expression of proto-oncogene c-Fos and integrin β-2 was assessed. Monoclonal antibodies against porcine-reactive human c-Fos (clone T.142.5; rabbit IgG; unconjugated),dd porcine integrin β-2 (clone PNK-1; mouse IgG1; unconjugated),h porcine CD3 ε (clone PPT3; mouse IgG1; FITC-conjugated),h CD4a (clone 74–12–4; phycoerythrin-conjugated),i and CD8 α (clone 76–2–11; phycoerythrin- and cyanine-5–conjugated)h were used to confirm expression of c-Fos and integrin β-2 in cytotoxic T cells and DP T cells from colostrum and blood. Secondary antibodies against rabbit IgG (red fluorescent dyeee–conjugated; minimal cross reactivity against mouse immunoglobulins) and mouse IgG1 (allophycocyanin-conjugated)g were used for detection of c-Fos and integrin β-2, respectively. Colostral and blood lymphocytes were incubated with anti-porcine CD3 ε (FITC-conjugated), CD4a (phycoerythrin-conjugated), and CD8 α (phycoerythrin- and cyanine-5–conjugated) to confirm expression of c-Fos in cytotoxic T cells and DP T cells. After incubation was completed, all lymphocytes were fixed and permeated with a transcription factor–staining buffer setff used in accordance with the manufacturer's instructions. Lymphocytes then were incubated with anti–c-Fos, which was followed by incubation with red fluorescent dye–conjugated secondary antibody against rabbit IgG. Colostral and blood lymphocytes were incubated with anti-porcine integrin β-2, which was followed by incubation with allophycocyanin-conjugated secondary antibody against mouse IgG1. After incubation was completed, lymphocytes then were incubated with anti-porcine CD3 ε (FITC-conjugated), CD4a (phycoerythrin-conjugated), and CD8 α (phycoerythrin- and cyanine-5–conjugated). All antibodies were used at optimal amounts.

Flow cytometry was performed by use of a flow cytometergg and a cytometer sampler kit.hh Each lymphocyte subset was gated, and histograms of c-Fos and integrin β-2 were produced by use of flow cytometry data analysis software.ii

Statistical analysis

Differences in gene expression between colostral and blood T cells were analyzed by use of the Wilcoxon signed rank test because some data sets were not normally distributed. The obtained ΔCt value was used for statistical analysis. All data were analyzed by use of an application15,jj for commercially available software.w All data were reported as mean ± SE. Differences between means were considered significant at P < 0.05.

Results

Differentially expressed genes

Compared with expression of genes in cytotoxic T cells and DP T cells in blood, 644 and 538 genes had high expression in colostral cytotoxic T cells and DP T cells, respectively, as determined by use of the previously described cutoff criteria. For example, expression of HSP70.2 and FOS was remarkably higher in cytotoxic T cells and DP T cells in colostrum, compared with the expression of these genes in T cells in blood. In contrast, 925 and 970 genes (eg, SELL and ITGB2) had low expression in colostral cytotoxic T cells and DP T cells, respectively, compared with expression of the same genes in cytotoxic T cells and DP T cells in blood.

Analysis of KEGG pathways

There were 648 (in colostral cytotoxic T cells) and 638 (in colostral DP T cells) genes with high expression involved in 9 and 10 enriched pathways, respectively (Table 1). For example, pathways such as MAPK signaling, antigen processing and presentation, toll-like receptor signaling, NOD-like receptor signaling, RIG-I–Iike receptor signaling, T-cell receptor signaling, and B-cell receptor signaling, were commonly enriched in both colostral cytotoxic T cells and DP T cells. Chemokine signaling was a uniquely enriched immunologic pathway from genes with high expression in colostral DP T cells. In contrast, 8 pathways were involved with each of the 925 (in colostral cytotoxic T cells) and 970 (in colostral DP T cells) genes with low expression. These pathways included oxidative phosphorylation, ribosome, cell adhesion molecules, antigen processing and presentation, and natural-killer cell–mediated cytotoxicity, which were commonly observed for both colostral cytotoxic T cells and DP T cells.

Table 1—

Analysis of differentially expressed genes in KEGG pathways between colostral and peripheral blood T cells obtained from 2 sows.

CellKEGG pathwayNo. of genes*P value
 High expression
 Cytotoxic T cellsssc04621: NOD-like receptor signaling pathway80.003
 ssc04660: T-cell receptor signaling pathway110.004
 ssc04010: MAPK signaling pathway1140.005
 ssc04662: B-cell receptor signaling pathway80.008
 ssc04620: Toll-like receptor signaling pathway100.018
 ssc04622: RIG-I-like receptor signaling pathway70.039
 ssc04612: Antigen processing and presentation80.043
 ssc04115: p53 signaling pathway60.046
 ssc00100: Steroid biosynthesis30.04
 DP T cellsssc04621: NOD-like receptor signaling pathway§60.019
 ssc04660: T-cell receptor signaling pathway§90.010
 ssc04010: MAPK signaling pathway§130.002
 ssc04662: B-cell receptor signaling pathway§60.037
 ssc04620: Toll-like receptor signaling pathway§90.014
 ssc04622: RIG-I-like receptor signaling pathway§60.049
 ssc04612: Antigen processing and presentation§70.043
 ssc04920: Adipocytokine signaling pathway9< 0.001
 ssc04062: Chemokine signaling pathway90.041
 ssc04722: Neurotrophin signaling pathway70.043
Low expression
 Cytotoxic T cellsssc00190: Oxidative phosphorylation18< 0.001
 ssc04514: Cell adhesion molecules17< 0.001
 ssc03010: Ribosome13< 0.001
 ssc04612: Antigen processing and presentation14< 0.001
 ssc04650: Natural-killer cell-mediated cytotoxicity110.030
 ssc04260: Cardiac muscle contraction80.029
 ssc04672: Intestinal immune network for IgA production80.029
 ssc00280: Valine, leucine, and isoleucine degradation60.038
 DP T cellsssc00190: Oxidative phosphorylation§19< 0.001
 ssc04514: Cell adhesion molecules§17< 0.001
 ssc03010: Ribosome§22< 0.001
 ssc04612: Antigen processing and presentation§120.017
 ssc04650: Natural-killer cell-mediated cytotoxicity§120.032
 ssc04910: Insulin signaling pathway130.005
 ssc04720: Long-term potentiation70.029
 ssc00561: Glycerolipid metabolism60.045

Pathways classified as belonging to human diseases were excluded from the list.

There were 644 and 538 genes with high expression in colostral cytotoxic T cells and DP T cells, respectively, and 925 and 970 genes with low expression in colostral cytotoxic T cells and DP T cells, respectively.

Values were considered significant at P < 0.05.

Compared with expression for corresponding T cells in peripheral blood.

Pathway was also enriched in corresponding cytotoxic T cells.

Validation of DNA microarray data by use of qRT-PCR assay

To validate the DNA microarray data, expression of FOS, NFKB1, IFNG, CXCR6, CCR5, ITGB2, CCR7, and SELL were analyzed by use of a qRT-PCR assay (Table 2). Genes FOS, NFKB1, and IFNG were involved in the pathway T-cell receptor signaling, CXCR6 and CCR5 were involved in the pathway chemokine signaling, and ITGB2 was involved in the pathway cell adhesion molecules. Expression of genes for 2 T-cell differentiation markers, CCR7 and SELL,16 was also analyzed because results for analysis of KEGG pathways suggested the possibility that T-cell populations in colostrum were more enriched in the effector-like phenotype than were those in blood.

Table 2—

Results for qRT-PCR assay of DNA microarray data of selected genes.

GeneCytotoxic T cellsP value*DP T cellsP value*
Involved in T-cell receptor signaling pathway
 FOS5.83 ± 1.91< 0.059.02 ± 6.23< 0.05
 NFKBI2.42 ± 0.62< 0.056.69 ± 1.71< 0.05
 IFNG12.53 ± 8.34< 0.0523.75 ± 11.92< 0.05
Involved in chemokine signaling pathway
 CXCR66.14 ± 4.50NS5.98 ± 3.24NS
 CCR52.51 ± 1.28NS3.50 ± 1.28< 0.05
Involved in cell adhesion molecules
 ITGB20.21 ± 0.110.010.32 ± 0.170.01
T-cell differentiation markers
 CCR70.31 ± 0.080.010.88 ± 0.13NS
 SELL0.37 ± 0.120.010.45 ± 0.25NS

Data reported are mean ± SE fold change between colostral T cells and blood T cells; fold change was calculated as 2(– [ΔCt value obtained from colostral T cells – ΔCt value obtained from blood T cells]), where ΔCt was the Δ threshold cycle.

Values were considered significant at P < 0.05.

NS = Not significant.

Expression of genes involved in the pathway T-cell receptor signaling (FOS, NFKB1, and IFNG) was significantly higher in colostral cytotoxic T cells and DP T cells than in blood cytoxic T cells and DP T cells. Regardless of the T-cell subset evaluated, all genes had expression > 5-fold as high in colostral T cells as in blood T cells, except for NFKB1, the expression of which was 2.4-fold as high in colostral cytotoxic T cells as in blood cytotoxic T cells. Expression of CCR5 was significantly greater (3.5-fold as high) in colostral DP T cells than in blood DP T cells but did not differ significantly between colostral and blood cytotoxic T cells. Expression of CXCR6 was higher, but not significantly (P = 0.08) so, in colostral cytotoxic T cells than in colostral DP T cells and did not differ significantly between colostral and blood T cells. Expression of ITGB2 in colostral cytotoxic T cells and DP T cells was significantly (P = 0.01) less (approx one-fifth and one-third, respectively) that observed in the corresponding blood T cells. Expression of CCR7 and SELL was significantly lower in colostral cytotoxic T cells than in blood cytotoxic T cells. However, there were no significant differences in expression of CCR7 and SELL between colostral and blood DP T cells. Finally, expression of CCR7 and SELL in colostral cytotoxic T cells was less than that in blood cytotoxic T cells.

Validation of DNA microarray data by use of flow cytometry

Expression of c-Fos and integrin β-2 was validated at the protein level by use of flow cytometry. Expression of c-Fos was higher in colostral cytotoxic T cells and DP T cells than in blood cytotoxic T cells and DP T cells (Figure 1). Median fluorescent intensity was 1.26 and 1.50 times as great in colostral cytotoxic T cells and 1.53 and 2.41 times as great in colostral DP T cells for each of the 2 sows, compared with the median fluorescent intensity for the corresponding blood T cells. In contrast, expression of integrin β-2 was lower in colostral T cells than in blood T cells. Differences were 0.67 and 0.72 times as great in cytotoxic T cells and 0.46 and 0.77 times as great in DP T cells for each of the 2 sows.

Figure 1—
Figure 1—

Histograms of c-Fos (A and B) and integrin β-2 (C and D) expression by cytotoxic T cells (A and C) and DP T cells (B and D) obtained from colostrum (solid line) and peripheral blood (dashed line) samples collected from a representative sow. The number in the upper right corner of each histogram is the difference in median fluorescent intensity (MFI) between colostral and peripheral blood T cells.

Citation: American Journal of Veterinary Research 77, 9; 10.2460/ajvr.77.9.961

Discussion

Investigators have reported differences in phenotypic characteristics between porcine CMCs and PBMCs.4,9 Differences between gene expression profiles of colostral and blood T cells were evaluated in the study reported here.

Analysis of KEGG pathways indicated that some cell-signaling pathways were more activated in colostral T cells than in blood T cells. Expression of FOS17 and NFKB1,18 which code transcription factors involved in many cell-signaling pathways, was higher in colostral T cells than in blood T cells, regardless of the T-cell subset (Table 2).

Expression of FOS and NFKB1 was confirmed by use of a qRT-PCR assay to be higher in colostral T cells than in blood T cells. Expression of FOS at the protein level was also confirmed to be higher in colostral T cells (Figure 1). Proto-oncogene c-Fos and NF-kB control the expression of numerous genes involved in immune responses and cellular proliferations.17,18 Therefore, some genes involved in these processes may be more actively transcribed in colostral T cells than in blood T cells. In agreement with this, expression of IFNG, which has a NF-kB binding site in the promoter region19 and contributes to antiviral activity,20 was also higher in colostral T cells than in blood T cells. Although triggering factors that stimulate the expression of FOS and NFKB1, and subsequently IFNG, in colostral T cells were unknown during the present study, analysis of the data we obtained led us to hypothesize that T-cell populations in colostrum would be more enriched in the effector-like phenotype than were T-cell populations in blood. To test this hypothesis, expression of CCR7 and SELL,14 2 T-cell differentiation markers, was analyzed; results indicated that expression was significantly lower in colostral cytotoxic T cells than in blood cytotoxic T cells. Genes SELL and CCR7 play important roles in migration of T cells to secondary lymphoid tissues21,22 and are used as T-cell differentiation markers. Moreover, low expression of these genes typically represents the effector or effector memory phenotype, whereas high expression is more representative of naïve or central memory phenotypes.16 Therefore, the study reported here revealed lower expression of CCR7 and SELL in colostral cytotoxic T cells, which strongly supported the hypothesis that cytotoxic T cells in colostrum are more enriched in the effector-like phenotype than are cytotoxic T cells in blood. Moreover, these results are consistent with those of another study4 in which investigators determined the activated status of porcine colostral T cells on the basis of the expression pattern of cell surface markers and with results of studies23,24 for humans.

Expression of CCR7 and SELL also was lower, but not significantly so, in colostral DP T cells than in blood DP T cells. In addition, expression of CCR5 was significantly higher in colostral DP T cells than in blood DP T cells, but no differences in expression were found between colostral cytotoxic T cells and blood cytotoxic T cells. It is believed that CCR5 is expressed in activated effector and intestinal homing T cells.25 Therefore, results of the present study suggested that colostral DP T cells were richer in effector-like or activated phenotype than were blood DP T cells. In contrast, CCR5 is expressed in effector cells and memory T cells in humans. Moreover, certain porcine DP T cells exhibit the memory T-cell phenotype.6,26 Thus, the expression pattern of DP T cells observed in the study reported here also implied that colostral DP T cells were richer in effector memory T cells than were blood DP T cells.

In general, effector T cells have elevated expression of integrins.27,28 However, in the present study, both gene and protein expression for integrin β-2 in cytotoxic T cells and DP T cells from colostrum were markedly lower than were those in cytotoxic T cells and DP T cells from blood. The reason for this discrepancy may be explained, in part, by specific T-cell migration from the mammary gland to colostrum. Integrin β-2 constitutes leukocyte-functioning antigen-1 with integrin α-L, and it binds to ICAM-1 to mediate leukocyte transmigration into target tissues.29 Although expression of ICAM-1 has not been evaluated in porcine mammary glands, expression of ICAM-1 in bovine mammary glands has been confirmed.30 In addition, it was reported that dexamethasone injected into cattle resulted in secretion of more leukocytes in milk and also reduced in vitro expression of integrin β-2 and ICAM-1 in leukocytes and endothelial cells, respectively.31

Analysis of results for the present study, particularly an increase in expression of FOS and NFKB1 in colostral T cells, suggested that all or most T cells in colostrum had an effector-like phenotype and thus were more activated than T cells in blood. This gene expression profile would enable migration of T cells to mammary glands and subsequent secretion in colostrum. Eventually, circulating colostral T cells are likely to contribute to the rapid elimination of potential pathogens and development of the immune system in newborn pigs.

Acknowledgments

Supported by JSPS Kakenhi (grant Nos. 23688034 and 26292145).

The authors declare that there were no conflicts of interest.

Presented as an oral presentation at the 20th Hindgut Club Japan Symposium, Tokyo, December 2014.

The authors thank T. Imaoka and S. Chomei for technical assistance.

ABBREVIATIONS

CCR

Chemokine (C-C motif) receptor

c-Fos

Proto-oncogene of the FBJ murine osteosarcoma viral oncogene homologue

CMC

Colostral mononuclear cell

DP

CD4-CD8 double-positive

FITC

Fluorescein isothiocyanate

ICAM-1

Intercellular adhesion molecule 1

KEGG

Kyoto Encyclopedia of Genes and Genomes

MAPK

Mitogen-activated protein kinase

NF-kB

Nuclear factor of κ light polypeptide gene enhancer in B cells

NOD

Nucleotide-binding oligomerization domain

PBMC

Peripheral blood mononuclear cell

qRT-PCR

Quantitative real-time reverse-transcription PCR

RIG

Retinoic acid inducible gene

Footnotes

a.

Venoject II, Terumo Corp, Tokyo, Japan.

b.

Tetoron cloth (mesh size, 65 µm), Tokyo Screen Co Ltd, Tokyo, Japan.

c.

Percoll, GE Healthcare, Tokyo, Japan.

d.

Polysciences, Warrington, Pa.

e.

Terumo Corp, Tokyo, Japan.

f.

Roswell Park Memorial Institute (RPMI) medium, Nacalai Tesque, Kyoto, Japan.

g.

Sigma-Aldrich Japan, Tokyo, Japan.

h.

Abcam, Tokyo, Japan.

i.

Becton Dickinson, Tokyo, Japan.

j.

JSAN cell sorter, Bay Bioscience, Kobe, Japan.

k.

TRIzol reagent, Life Technologies Japan Ltd, Tokyo, Japan.

l.

RNeasy MinElute cleanup kit, Qiagen KK, Tokyo, Japan.

m.

NanoDrop Technologies, Wilmington, Del.

n.

Agilent 2100 Bioanalyzer, Agilent Technologies, Tokyo, Japan.

o.

Ovation PicoSL WTA system V2, NuGEN Technologies, San Carlos, Calif.

p.

Alexa Fluor 3, Life Technologies Japan Ltd, Tokyo, Japan.

q.

Alexa Fluor 5, Life Technologies Japan Ltd, Tokyo, Japan.

r.

BioPrime total genomic labeling system, Life Technologies Japan Ltd, Tokyo, Japan.

s.

RNase-free DNase set, Qiagen KK, Tokyo, Japan.

t.

Porcine (V2) gene expression microarray, 4 × 44, Agilent Technologies Japan Ltd, Tokyo, Japan.

u.

GenePix 4100A, Molecular Devices LLC, Sunnyvale, Calif.

v.

CLC main workbench software, version 6.0, Qiagen KK, Tokyo, Japan.

w.

Excel, Microsoft Corp, Redmond, Wash.

x.

ReverTra Ace qPCR RT kit, Toyobo Life Science Department, Osaka, Japan.

y.

Universal Probe Library Assay Design Center, Roche Applied Science, Indianapolis, Ind.

z.

Greiner Japan, Tokyo, Japan.

aa.

LightCycler 480 real-time system, Roche Applied Science, Indianapolis, Ind.

bb.

LightCycler 480 probes master, Roche Applied Science, Indianapolis, Ind.

cc.

Universal ProbeLibrary sets, Roche Applied Science, Indianapolis, Ind.

dd.

Thermo Fisher Scientific KK, Kanagawa, Japan.

ee.

DyLight 649, Biolegend, San Diego, Calif.

ff.

Foxp3/transcription factor staining buffer set, Bioscience Inc, San Diego, Calif.

gg.

AccuriC6 flow cytometer, Becton Dickinson, Tokyo, Japan.

hh.

BD CSampler kit and software, Becton Dickinson, Tokyo, Japan.

ii.

FCS Express 4 Plus, De Novo Software, Glendale, Calif.

jj.

Statcel2, The Publisher OMS Ltd, Tokorozawa, Saitama, Japan.

References

  • 1. Pluske JR. Gut development: interactions between nutrition, gut health and immunity in young pigs. In: Taylor-Pickard JA, Spring P, eds. Gut efficiency; the key ingredient in pig and poultry production. Wageningen, The Netherlands: Wageningen Academic Publishers, 2008;3956.

    • Search Google Scholar
    • Export Citation
  • 2. Pomorska-Mól M, Markowska-Daniel I. Age-dependent changes in relative and absolute size of lymphocyte subsets in the blood of pigs from birth to slaughter. Bull Vet Inst Pulawy 2011; 55: 305310.

    • Search Google Scholar
    • Export Citation
  • 3. Wagstrom EA, Yoon K-J, Zimmerman JJ. Immune components in porcine mammary secretions. Viral Immunol 2000; 13: 383397.

  • 4. Hlavova K, Stepanova H, Faldyna M. The phenotype and activation status of T and NK cells in porcine colostrum suggest these are central/effector memory cells. Vet J 2014; 202: 477482.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 5. Nascimbeni M, Shin E-C, Chiriboga L, et al. Peripheral CD4+CD8+ T cells are differentiated effector memory cells with antiviral functions. Blood 2004; 104: 478486.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 6. Zuckermann FA, Husmann RJ. Functional and phenotypic analysis of porcine peripheral blood CD4/CD8 double-positive T cells. Immunology 1996; 87: 500512.

    • Search Google Scholar
    • Export Citation
  • 7. Tuboly S, Bernáth S, Glávits R, et al. Intestinal absorption of colostral lymphoid cells in newborn piglets. Vet Immunol Immunopathol 1988; 20: 7585.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 8. Williams PP. Immunomodulating effects of intestinal absorbed maternal colostral leukocytes by neonatal pigs. Can J Vet Res 1993; 57: 18.

    • Search Google Scholar
    • Export Citation
  • 9. Bandrick M, Ariza-Nieto C, Baidoo SK, et al. Colostral antibody-mediated and cell-mediated immunity contributes to innate and antigen-specific immunity in piglets. Dev Comp Immunol 2014; 43: 114120.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 10. Bandrick M, Pleters M, Pijoan C, et al. Passive transfer of maternal Mycoplasma hyopneumoniae-specific cellular immunity to piglets. Clin Vaccine Immunol 2008; 15: 540543.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 11. Oh Y, Seo HW, Han K, et al. Protective effect of the maternally derived porcine circovirus type 2 (PCV2)-specific cellular immune response in piglets by dam vaccination against PCV2 challenge. J Gen Virol 2012; 93: 15561562.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 12. Huang DW, Sherman BT, Lempicki RA. Systematic and integrative analysis of large gene lists using DAVID bioinformatics resources. Nat Protoc 2008; 4: 4457.

    • Search Google Scholar
    • Export Citation
  • 13. Huang DW, Sherman BT, Lempicki RA. Bioinformatics enrichment tools: paths toward the comprehensive functional analysis of large gene lists. Nucleic Acids Res 2009; 37: 113.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 14. Yajima T, Inoue R, Matsumoto M, et al. Non-neuronal release of ACh plays a key role in secretory response to luminal propionate in rat colon. J Physiol 2011; 589: 953962.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 15. Yanai H. 4 Steps Excel statistics (Japanese). Tokorozawa, Saitama, Japan: The Publisher OMS Ltd, 2004.

  • 16. Broere F, Apasov SG, Sitkovsky MV, et al. T cell subsets and T cell-mediated immunity. In: Nijkamp FP, Parnham MJ, eds. Principles of immunopharmacology. 3rd ed. Basel, Switzerland: Springer Basel AG, 2011;1527.

    • Search Google Scholar
    • Export Citation
  • 17. Reiner G, Heinricy L, Brenig B, et al. Cloning, structural organization, and chromosomal assignment of the porcine c-fos proto-oncogene, FOS. Cytogenet Genome Res 2000; 89: 5961.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 18. Kim D-I, Kim K-H, Kang J-H, et al. Trans-10, cis-12-conjugated linoleic acid modulates NF-κB activation and TNF-α production in porcine peripheral blood mononuclear cells via a PPARγ-dependent pathway. Br J Nutr 2011; 105: 13291336.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 19. Sica A, Dorman L, Viggiano V, et al. Interaction of NF-kB and NFAT with the interferon-γ promoter. J Biol Chem 1997; 272: 3041230420.

  • 20. Fan Y-H, Chow K-C, Huang S-Y, et al. A missense polymorphism in porcine interferon-γ cDNA affects antiviral activity of the protein variant. Mol Immunol 2007; 44: 32973304.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 21. Czarneski J, Berguer P, Bekinschtein P, et al. Neonatal infection with a milk-borne virus is independent of β7 integrin- and L-selectin-expressing lymphocytes. Eur J Immunol 2002; 32: 945956.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 22. Moreno S, Álvarez B, Martínez P, et al. Analysis of chemokine receptor CCR7 expression on porcine blood T lymphocytes using a CCL19-Fc fusion protein. Dev Comp Immunol 2013; 39: 207213.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 23. Peroni DG, Chirumbolo S, Veneri D, et al. Colostrum-derived B and T cells as an extra-lymphoid compartment of effector cell populations in humans. J Matern Fetal Neonatal Med 2013; 26: 137142.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 24. Sabbaj S, Ghosh MK, Edwards BH, et al. Breast milk- derived antigen-specific CD8+ T cells: an extralymphoid effector memory cell population in humans. J Immunol 2005; 174: 29512956.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 25. Lederman MM, Penn-Nicholson A, Cho M, et al. Biology of CCR5 and its role in HIV infection and treatment. JAMA 2006; 296: 815826.

  • 26. Haverson K, Bailey M, Stokes CR. T-cell populations in the pig intestinal lamina propria: memory cells with unusual phenotypic characteristics. Immunology 1999; 96: 6673.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 27. Hamann D, Baars PA, Rep MHG, et al. Phenotypic and functional separation of memory and effector human CD8+ T cells. J Exp Med 1997; 186: 14071418.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 28. Pribila JT, Quale AC, Mueller KL, et al. Integrins and T cell-mediated immunity. Annu Rev Immunol 2004; 22: 157180.

  • 29. Ebdrup L, Krog J, Granfeldt A, et al. Dynamic expression of the signal regulatory protein α and CD18 on porcine PBMC during acute endotoxaemia. Scand J Immunol 2008; 68: 430437.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 30. Aitken SL, Karcher EL, Rezamand P, et al. Evaluation of antioxidant and proinflammatory gene expression in bovine mammary tissue during the periparturient period. J Dairy Sci 2009; 92: 589598.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 31. Waller KP. Mammary gland immunology around parturition. In: Mol JA, Clegg RA, eds. Biology of the mammary gland. New York: Springer US, 2002; 231245.

    • Search Google Scholar
    • Export Citation

Appendix

Sequences of primers and probes used for a qRT-PCR assay.

Gene nameGeneGenBank accession No.Primer sequence (5′-3′)Universal probe No.*
β actinACTBXM_003124280.3F: CTAGGAGCGGGTTGAGGTG71
   R: CTGGTCTCAAGTCAGTGTACAGGT 
c-FosFOSNM_001123113.1 (AK232994.1)F: GGCTGGAGTCGTGAAGACC R: GGACAACTGTTCCACCTTGC79
NF-κB-1NFKBINM_001048232.1F:CAGACACCCTTGCACTTGG R: CCCTCAGCAAGTCCTCCAC75
Interferon γIFNGNM_213948.1F: TTCAGCTTTGCGTGACTTTG129
   R: TGCATTAAAATAGTCCTTTAGGATCG 
Chemokine (C-X-C motif) receptor 6CXCR6NM_001001623.1F: GTTCTGGCCACCCAGATG R: GCAGACAATCATGGCAAGC4
CCR5CCR5NM_001001618.1F: TCTGGGCTCCCTACAACATC R: CTGCAGTTATTCAGGCCAAAG2
Integrin β-2 (complement component 3 receptor 3 and 4 subunit)ITGB2NM_213908.1 (AK398627.1)F: TCACAGACATCATCCCCAAGT R: AGGACGTTGCTGGAATCCT24
CCR7CCR7NM_001001532.2F: TGTACTCCATCATCTGCTTCGT3
   R: CCTCTTGAAATAGATGTAGGTCAGC 
Selectin LSELLNM_001112678.1 (AK236776.1)F: GTATTCACCCTTTGGGCAAG118
   R: TCCCTCAGAGCAGTTGAAGG 

Listed probe numbers indicate the product numbers in commercially available probe library sets.y

F = Forward. R = Reverse.

Contributor Notes

Address correspondence to Dr. Inoue (r-inoue@kpu.ac.jp).