Abstract
OBJECTIVE To determine the efficacy of Bdellovibrio bacteriovorus 109J for the treatment of calves with experimentally induced infectious bovine keratoconjunctivitis (IBK).
ANIMALS 12 healthy dairy calves.
PROCEDURES For each calf, a grid keratotomy was performed on both eyes immediately before inoculation with Moraxella bovis hemolytic strain Epp63–300 (n = 11 calves) or nonhemolytic strain 12040577 (1 calf). For each calf inoculated with M bovis Epp63–300, the eyes were randomly assigned to receive an artificial tear solution with (treatment group) or without (control group) lyophilized B bacteriovorus 109J. Six doses of the assigned treatment (0.2 mL/eye, topically, q 48 h) were administered to each eye. On nontreatment days, eyes were assessed and corneal swab specimens and tear samples were collected for bacterial culture. Calves were euthanized 12 days after M bovis inoculation. The eyes were harvested for gross and histologic evaluation and bacterial culture.
RESULTS The calf inoculated with M bovis 12040577 did not develop corneal ulcers. Of the 22 eyes inoculated with M bovis Epp63–300, 18 developed corneal ulcers consistent with IBK within 48 hours after inoculation; 4 of those eyes developed secondary corneal ulcers that were not consistent with IBK. Corneal ulcer size and severity and the time required for ulcer healing did not differ between the treatment and control groups.
CONCLUSIONS AND CLINICAL RELEVANCE Results suggested that B bacteriovorus 109J was not effective for the treatment of IBK; however, the experimental model used produced lesions that did not completely mimic naturally occurring IBK.
Pinkeye, or IBK, is a common, contagious disease of cattle that is caused by Moraxella bovis. It is associated with corneal ulcers and abnormally decreased weaning weights1,2 and results in substantial economic losses.3,3 Infectious bovine keratoconjunctivitis is considered an important production-limiting disease on beef cow-calf operations and affects up to 30% of herds and approximately 20% to 30% of calves in those herds.3 Although M bovis is considered the primary causal organism for IBK, the occurrence and clinical severity of naturally occurring disease are strongly influenced by various other factors including mechanical transport of M bovis by face flies4; ocular irritants such as UV light, dust, and wind; and mechanical trauma to the eyes caused by tall grass, brush, plant seeds, or awns.3,5–7 Individual cattle factors such as age, breed, and immune system and vaccination status and the presence of other infectious pathogens also have integral roles in the occurrence and severity of IBK.3
The multifactorial aspects associated with naturally occurring IBK have posed challenges to the development of a reliable experimental model. Published literature describing experimental models that result in high and reproducible IBK infection rates is limited. The current consensus is that clinical signs of IBK are most readily produced by instilling pathogenic M bovis (0.5 to 1 mL of a solution containing piliated β-hemolytic Tifton 18–10 or Epp63–300 strain5,11,12 with a mean concentration of 1 × 1010 CFUs of M bovis/mL) in eyes with a corneal injury.8,9,13 Historically, the use of UV radiation to induce corneal irritation before inoculation of M bovis has been particularly important in experimental models for IBK. In the 1960s, Hughes et al5,12 reported that clinical signs of IBK could be readily produced by combining ophthalmic instillation of M bovis with UV radiation. That model has been used with varying success by many investigators since; the overall incidence rate of corneal ulcers induced by that model ranges from 50% to 79%.8,9,13 Currently, the sun lampsb used to induce corneal irritation are scarce, which makes it difficult for researchers to conduct studies with that experimental model. Furthermore, the inconsistency of corneal ulcer development associated with that model makes it suboptimal for use in treatment trials.
Recently, researchers have resorted to other methods for inducing corneal injury such as corneal scarification before instillation or intraconjunctival inoculation of M bovis. Corneal scarification followed by exposure to M bovis seems to parallel the conditions required for natural infections, which are characterized by the development of a superficial centralized corneal ulcer (epithelial defect) in the early phase of the disease. In 1 study,11 IBK was experimentally induced in 9 of 10 calves (9/10 eyes [only 1 eye/calf was inoculated]) by the use of sterilized small-gauge, rubber-clad electrical cables as a metallic brush for corneal scarification followed by inoculation with M bovis. Those 9 calves developed corneal ulcers that were consistent with IBK.11 In another study,14 intraconjunctival inoculation of M bovis resulted in IBK in 80% of inoculated calves.
Usually, naturally occurring IBK is presumptively diagnosed on the basis of the presence of characteristic clinical signs. A presumptive diagnosis of IBK can be confirmed by bacterial culture of corneo-conjunctival swab specimens.15 Similar to other bacterial infections, antimicrobial susceptibility data can be used to guide treatment decisions during IBK out-breaks.16 Currently, the most cost-effective treatment for IBK is parenteral administration of antimicrobials, especially when the prevalence and incidence of the disease are high. Antimicrobials that have been used to effectively treat experimentally induced or naturally occurring IBK include oxytetracycline,10,15,17,18 florfenicol,9,19 ceftiofur crystalline-free acid,20 and tulathromycin.13 Prompt treatment of affected cattle with an appropriate antimicrobial often prevents the disease from progressing. However, treatment failures are common and currently available commercial21 and autogenous22 vaccines do not provide optimal protection primarily because of M bovis antigenic strain variation.
At a time when antimicrobial resistance among bacterial pathogens is of increasing concern, the search for new antimicrobials and novel treatments for bacterial infections is a research priority. One novel treatment for IBK caused by M bovis is a biological, nonchemotherapeutic ophthalmic formulation that contains the predatory bacterium Bdellovibrio bacteriovorus 109J. In 1973, Stolp23 first described the genus Bdellovibrio as bacteriolytic organisms capable of attacking a living bacterium by attaching to its surface, penetrating the cell wall, multiplying inside the host cell, and causing lysis of the infested cell, all within approximately 3.5 to 4 hours. More recent reviews24,25 describe the growth cycle of B bacteriovorus as biphasic, which includes a free-swimming attack phase and an intraperiplasmic growth phase. Bdellovibrio bacteriovorus is a small (0.35 × 1.2 μm), obligate aerobic, motile (polar flagellum), gram-negative bacterium with obligate host dependency on a wide range of gram-negative prey bacteria, primarily Pseudomonas spp and enterobacteria.23,25 Bdellovibrio bacteriovorus sources, its prey range, the minimum prey density required to sustain its life cycle, optimal conditions for its growth and maintenance in vitro,24 and a clinically relevant summary of its use as a biological control or therapeutic agent26 have been previously reviewed.
Results of studies26,c conducted by our laboratory group indicate that M bovis can serve as prey for B bacteriovorus, and serial passage of B bacteriovorus on M bovis enhances the killing efficiency of B bacteriovorus for M bovis.26 Bdellovibrio bacteriovorus effectively controls M bovis infection of bovine corneas in an ex vivo model of IBK26 and remains viable in bovine tears for 24 hours in vitro.c Results of unpublished experiments conducted by our laboratory group indicate that B bacteriovorus is not pathogenic to bovine eyes in vivo and can persist on the corneal surface for prolonged periods following ocular instillation in cattle. Therefore, we proposed to examine whether topical instillation of B bacteriovorus in the eyes of cattle might be an effective nonchemotherapeutic alternative for the treatment of IBK. Its use in food-producing animals would eliminate the risk of antimicrobial residues in the meat and milk of treated cattle, avoid local and systemic adverse effects associated with parenteral antimicrobial administration, and potentially decrease the opportunity for the development of antimicrobial-resistant bacteria. The primary purpose of the study reported here was to evaluate the efficacy of a B bacteriovorus ophthalmic formulation for the treatment of calves with experimentally induced IBK. The null hypothesis was that the outcome for M bovis–infected eyes that were treated with B bacteriovorus would not differ from that for M bovis–infected eyes that were not treated with B bacteriovorus.
Materials and Methods
Animals
Twelve healthy sexually intact male Holstein and Jersey calves with a mean age of 7 ± 1 weeks (range, 2 weeks to 3 months) were used for the study. The calves had served as control calves in a vaccine trial conducted by another group of investigators at Oklahoma State University. All protocols used in the vaccine trial were reviewed and approved by the Oklahoma State University Institutional Animal Care and Use Committee as were the protocols for this study, which included the internal acquisition of calves from the vaccine trial. The investigators involved with the vaccine trial verified that the calves had never been administered any antimicrobials (ie, the calves were presumed to be free of antimicrobial residues) and had not been vaccinated against IBK. Each calf was determined to be free of corneal, conjunctival, and eyelid abnormalities following a complete ophthalmic examination performed by a board-certified veterinary ophthalmologist (MG), which included evaluation of the adnexa, cornea, anterior chamber, iris, lens, and anterior vitreous with a transilluminator and slit-lamp biomicroscoped and staining of the corneas with fluorescein staine for assessment of potential epithelial defects.
Calves were housed in individual stalls with no nose-to-nose contact in 1 temperature-controlled, artificially lighted, and fully enclosed room in a biosafety level–2 building at the Oklahoma State University Large Animal Resources Isolation Facility in Still-water, Okla, for the duration of the study. Animal caretakers followed strict procedures during feeding and stall cleaning to prevent cross-contamination among calves.
Study design
The study was a terminal challenge study in which the corneas of both eyes of each calf were scarified followed by inoculation with M bovis (challenge inoculation). For each calf, 1 eye was treated with an artificial tear solution containing B bacteriovorus (treatment) and the other eye was treated with an artificial tear solution (control) every other day for 6 treatments. Consequently, each calf acted as its own control.
The day that the grid keratotomies and challenge inoculation were performed was designated as day 0. Calves were moved to the biosafety level–2 room designated for the study on day −4 and allowed to acclimate to that environment for 2 days. On day −2, each calf underwent a complete ophthalmic examination to determine its eligibility for study inclusion. On day −1, a coin-flip method was used to randomly allocate the eyes of each calf to either the treatment or control group. The assigned treatment was administered on days 1, 3, 5, 7, 9, and 11. The eyes were examined and samples were collected on days 2, 4, 6, 8, 10, and 12. On day 12, all calves were euthanized with a penetrating captive boltf in accordance with the AVMA Guidelines for the Euthanasia of Animals,27 and the eyes were harvested for histologic examination and bacterial culture. All calves were physically restrained by an experienced animal handler during all study procedures.
Grid keratotomy
On day 0, the cornea of both eyes of each calf was anesthetized by topical administration of a 2% lidocaine hydrochloride solution (0.5 to 1 mL/eye). After 4 to 6 minutes, a grid keratotomy was performed by a board-certified veterinary ophthalmologist (MG). Briefly, a 64 corneal bladeg was used to create a series of approximately 4 to 5 parallel, 5- to 7-mm-long, partial-thickness (< 25% of the depth of the corneal stroma; the depth of the incision extended from the corneal surface to below the epithelium basement membrane into the superficial stroma) score marks in the central aspect of the corneal stroma. Visually, score marks of the appropriate depth were achieved when the groove lines were visible beyond the epithelium when minimal pressure was applied to the corneal blade. A second set of score marks were created at approximately 90° to the first set resulting in a grid pattern. A new corneal blade was used for each calf.
Challenge inoculation
Following completion of the grid keratotomy, both eyes of each calf were inoculated with either M bovis Epp63–300 (n = 11 calves) or M bovis 12040577 (1 calf). The M bovis Epp63–300 strain used was a pathogenic β-hemolytic strain of the organism that was obtained from another researcher,h and the M bovis 12040577 was a nonhemolytic strain that was isolated from an IBK outbreak in cattle in Oklahoma.i The protocol described by Gould et al11 was used to prepare the M bovis Epp63–300 inoculum. Briefly, lyophilized M bovis Epp63–300 cultures in vacuum-sealed ampules were scored and cut and then reconstituted with 200 μL of distilled water. That suspension was diluted in 2 mL of nutrient brothj and divided into 200 μL aliquots, and each aliquot was inoculated onto each of 11 BAPs with a flamed loop resulting in 1 plate of bacterial colony growth/calf to be inoculated. The BAPs were labeled and incubated at 37°C in a 5% CO2 atmosphere for 24 hours and then immediately transferred to a refrigerator and stored at 4°C.
To prepare M bovis 12040577 for inoculation, bacterial colonies present on BAPs that had been incubated for 24 hours following inoculation from field samplesi were harvested into Luria-Bertani brothk and incubated on a shaker (180 rpm) at 35°C for approximately 24 hours. Then the bacterial suspension was divided into 470-µL aliquots, and each aliquot was supplemented with 750 μL of a 20% solution of skim milkl and 280 μL of an 80% solution of glycerol.m The 1.5-mL aliquots were stored in cryogenic vials at −135°C until used. To prepare the inoculum, an aliquot of bacterial suspension was thawed and inoculated onto a BAP as described for M bovis Epp63–300. The plate was labeled and incubated at 37°C in a 5% CO2 atmosphere for 24 hours and then immediately transferred to a refrigerator and stored at 4°C. All M bovis inoculum plates were kept cold on ice until used for the challenge inoculation or for a maximum of 6 hours.
The ophthalmologist (MG) who performed the grid keratotomies also inoculated all of the eyes with M bovis. Each calf was assigned its own M bovis inoculum plate, and new disposable gloves, sleeves, and plastic aprons were used during inoculation of each calf to prevent cross-contamination among calves. For each eye on each calf, a sterile swab was rolled across the M bovis growth on the prepared BAP. Then the contaminated swab was gently rolled across the keratotomy site on the cornea and the medial canthus of the eye. The eyelid was held closed for 4 to 5 seconds immediately after inoculation. The process was repeated for the contralateral eye. The ophthalmologist remained unaware of (ie, was blinded to) which calves were inoculated with which M bovis strain throughout the duration of the study.
Treatment protocol
Bdellovibrio bacteriovorus strain 109J obtained from another researchern was cultivated on nonhemolytic M bovis for 10 passages as described.26 To prepare the lyophilized B bacteriovorus stock solution used for the treatment solution, 174 mL of a culture broth that contained fully active and motile B bacteriovorus (as determined by dark-phase microscop° at high [100X] power) was centrifuged at 1,500 × g for 8 minutes to remove cell debris. The B bacteriovorus–rich supernatant was decanted and saved. The remaining cell pellet was centrifuged at 10,000 × g for 20 minutes and resuspended without filtering in 12 mL of sterile lyophilizing medium.p Two hundred microliters of that cell suspension was reserved for quantification of B bacteriovorus and M bovis by RT-PCR assay and serial dilution with counting of CFUs on BAPs, respectively. The remaining cell suspension was divided into 500-µL aliquots and placed into 25 lyophilization vials.q The vials were then shell frozen in liquid nitrogen and placed on a lyophilizerr with automated settings for 24 hours. When the vials were removed from the lyophilizer, they were capped,s wrapped in aluminum foil to protect the contents from light, and transferred to a refrigerator where they were stored at 4°C until used.
To prepare the treatment solution, 500 μL of a preservative-free, 0.1% dextran and 0.3% hypromellose (hydroxypropyl methylcellulose)–based artificial tear productt was added to 1 vial (500 μL) of lyophilized B bacteriovorus stock solution. The control solution was prepared by the addition of 500 μL of the artificial tear product to 1 vial (500 μL) of lyophilized B bacteriovorus–free lyophilizing medium.p Individual doses (0.2 mL) of both the treatment and control solutions were drawn into sterile tuberculin syringes and kept cold on ice until administered to the calves or for a maximum of 6 hours.
Treatment was not administered to either eye of the calf that was inoculated with M bovis 12040577. For each eye of the remaining 11 calves, 0.2 mL of the assigned treatment (treatment or control solution) was topically instilled in the ventral conjunctival fornix by use of a tuberculin syringe equipped with a 25-gauge needle that was broken at the hub on days 1 (24 hours after M bovis inoculation), 3, 5, 7, 9, and 11 (ie, each eye received 6 doses of the assigned treatment). The eyelid was held closed for 4 to 5 seconds after instillation of the treatment. The investigator (MJB) responsible for administering the treatments remained blinded to the treatment group assignment of each eye for the duration of the observation period.
Calf monitoring and sample collection
To reduce the iatrogenic spread of M bovis and B bacteriovorus among calves, all personnel examining and caring for the calves wore safety glasses and personal protective equipment that included disposable boots, long-sleeved plastic coveralls, plastic aprons, obstetric sleeves, and latex examination gloves. All of the personal protective equipment was changed between calves.
The eyes of each calf were visually examined by 1 investigator (MJB) on days 2, 4, 6, 8, 10, and 12 (immediately before euthanasia). During those examinations, the head was tilted downward by the animal handler to facilitate observation of the ventral half of the cornea. Both corneas were examined for evidence of ulceration by use of a standard fluorescein staining technique. Briefly, 0.3 to 0.5 mL of fluorescein stain, which was created by immersing 1 fluorescein stripe in 1 mL of preservative-free eye wash solution, was topically instilled into an eye. Shortly thereafter, a preservative-free eye wash solutionu was used to wash off any excess stain. Each eye was assigned an OLS on a 10-point scale as described (Appendix 1). A corneal ulcer was defined as the presence of grossly evident fluorescein stain retention in the cornea when the eye was examined with a blue incandescent light.v Eyes with an OLS ≥ 5 were photographed with a digital camera.w A ruler was included in each photograph to allow for further calibration. The surface area of each corneal lesion was measured (outlined) twice by the same investigator (MJB) with a software program,x which calculated and recorded the corresponding mean surface area measurement.
Ocular secretion specimens and tear samples were collected from each eye prior to M bovis inoculation on day 0 and days 2, 4, 6, 8, 10, and 12. Prior to specimen collection, the periocular region was cleansed with gauze soaked with a diluted 2% iodine solution (1:10 dilution of iodine in sterile saline [0.9% NaCl] solution). An ocular secretion specimen was obtained by swabbing the medial conjunctival sac with a sterile cotton swaby (1 swab/eye). Immediately thereafter, a tear sample was collected by placing a sterile cellulose spongez in the lower medial conjunctival sac and holding it there until it was fully saturated (approx 10 to 15 seconds).
Sample processing
Immediately after collection, each ocular secretion swab specimen was inoculated onto 1 quadrant of a BAP; the remaining quadrants were streaked in the laboratory by use of a flamed inoculation loop. The BAPs were incubated at 37°C in a 5% CO2 atmosphere for 24 hours. Plates that yielded bacterial colonies with β hemolysis characteristic of M bovis were assigned a quantitative score as described (Appendix 2).
Bacterial colonies from those plates underwent RT-PCR assay to confirm that they were M bovis. Briefly, the mbxB gene28 of M bovis was retrieved from Genbank (accession No. AF205359.3). A publicly available web programaa was used as described29 to design specific primers that would target the mbxB gene (mbx), which were produced by another company.bb The primers were used to amplify a 103-bp product by means of a RT-PCR protocol. A RT-PCR detection systemcc was used as described30 to perform the RT-PCR reaction. Each reaction consisted of 10 μL of a PCR master mix,dd 2 μL of DNase and RNase–free water, 10 pmol of each forward and reverse mbx primer (Appendix 3), and 1 μL of the DNA sample (template). The cycling conditions used were 98°C for 2 minutes followed by 34 cycles of 98°C for 10 seconds and 55°C for 10 seconds. During each analysis, a negative control that did not contain a template sample was processed, and the amplification product was confirmed by analysis of the dissociation curve.
Fully saturated cellulose sponges were centrifuged at 3,220 × g for 12 minutes to extract tear samples. On each tear collection day (days 0, 2, 4, 6, 8, 10, and 12) and for the duration of the study, all tear samples collected from eyes treated with the treatment solution were pooled as were the tear samples collected from eyes treated with the control solution. For each treatment group on each collection day, a 25-cm2 culture flaskee that contained 5 ml of peptone yeast extract (1% enzymatic digest of animal proteinff and 0.3% yeast extract supplemented with 2mM calcium chloride and 3mM magnesium chloride26) was inoculated with 100 μL of nonhemolytic M bovis strain 12040577 (prey) and 100 μL of the pooled tear sample (multiplicity of infection = 1; ratio, 1 CFU of M bovis-to-1 plaque forming unit26 of B bacteriovorus). Each flask was incubated at 30°C for 72 hours. During that 72-hour period, dark-phase microscopy was used daily to evaluate each coculture flask for the presence of B bacteriovorus predatory activity. From each flask after the 72-hour incubation period, 50 μL of culture fluid was streaked on a BAP. The BAP was incubated at 37°C in a 5% CO2 atmosphere for 24 hours, after which the plate was examined for purity of bacterial growth.
At each time the coculture flask was evaluated, 100 μL of culture fluid containing pooled tear samples was removed from the flask, frozen, and stored at −20°C until analyzed by a RT-PCR assay to determine the B bacteriovorus genomic equivalence per milliliter (GE/mL). Briefly, the B bacteriovorus 16S (Bb16) rDNA gene sequence was retrieved from Genbank (accession No. CP007656.1). A publicly available web programaa was used to design specific primers on the basis of the whole genome sequence of B bacteriovorus,31 which were produced by another company.bb The primers were used to amplify a 108-bp product by means of an RT-PCR protocol. An RT-PCR detection systemcc was used to perform the RT-PCR reaction. Each reaction consisted of 10 μL of a PCR master mix,dd 2 μL of DNase and RNase–free water, 10 pmol of each forward and reverse Bb16 primer (Appendix 3), and 1 μL of the DNA sample (template, 1:10 dilution of the tear sample). The cycling conditions used were 98°C for 2 minutes followed by 38 cycles of 98°C for 10 seconds and 55°C for 10 seconds. During each analysis, a negative control that did not contain a template sample was processed, and the amplification product was confirmed by analysis of the dissociation curve. The limit of detection for the assay was 2 × 104 GE/mL. The selected RT-PCR cycle threshold cutoff was 36.
Postmortem diagnostic testing
Following application of the penetrating captive bolt, each calf was confirmed dead on the basis of the absence of a corneal reflex, auscultable heartbeat, and palpable pulse (monitored at the brachial artery on the proximomedial aspect of the elbow joint). Once death was confirmed, a biohazard bag was placed over the head of each calf and secured around the neck to prevent ocular trauma and cross-contamination during transportation to the Oklahoma Animal Disease Diagnostic Laboratory. At the laboratory, the eyes of each calf were examined for gross lesions then harvested and processed for histologic evaluation. One pathologist (MAB), who was blinded to the treatment allocation and all antemortem observations for each eye, performed all examinations. For corneas with grossly apparent lesions, multiple parasagittal sections of the abnormal tissue were obtained at approximately 5-mm intervals and examined. A standardized OHS (Appendix 4) was developed to characterize the severity and distribution of the ocular lesions present in each eye. Corneal changes evaluated included ulceration and epithelial hyperplasia, as well as stromal changes such as subepithelial clefting, inflammation, and neovascularization. Bacterial culture of the cornea was also performed on all eyes. For cultures that yielded growth of gram-negative diplococci, isolates were confirmed as M bovis by automated sequencing of 16S rDNA performed by the Oklahoma State University Microarray Core Facility in Stillwater, Okla.
Statistical analysis
The IBK infection rate for the study population was calculated as the number of experimentally infected eyes that were assigned an OLS ≥ 6 at least once divided by the number of eyes that were experimentally infected with M bovis multiplied by 100%. An eye was classified as infected when each of at least 2 consecutive bacterial cultures yielded ≥ 1 CFU of M bovis. A corneal ulcer was defined as healed when no fluorescein stain uptake (OLS ≤ 4) was observed during at least 2 consecutive ocular examinations.
Descriptive statistics were generated. Fisher exact tests were used to compare the respective proportions of eyes with corneal ulcers and M bovis–infected eyes between the treatment and control groups. A Mann-Whitney U test was used to compare the maximum OLS between M bovis–infected and uninfected eyes. Kaplan-Meier survival analysis was used to compare the time required for corneal ulcer healing and the time required for the OLS to decrease to ≤ 4 between the treatment and control groups. The Wilcoxon signed rank test was used to compare maximum OLS and the number of days required for corneal ulcer healing between the treatment and control groups. A generalized linear model was used to assess the respective effects of treatment on OLS and corneal ulcer size. The Spearman rank correlation coefficient (ρ) was calculated to assess the correlation between the OLS assigned to each eye on day 12 immediately before euthanasia (terminal OLS) and OHS. All analyses were performed with commercially available software,gg and values of P < 0.05 were considered significant.
Results
Eyes
The calf experimentally inoculated with M bovis 12040577 did not develop a corneal ulcer in either eye. Of the 22 eyes (11 calves) experimentally inoculated with M bovis Epp63–300, 18 (82%) developed a corneal ulcer consistent with IBK within 48 hours after inoculation. Ten of those 18 ulcerated eyes were assigned to the treatment group, and the remaining 8 eyes were assigned to the control group. Also, 4 (2 eyes assigned to the treatment group and 2 eyes assigned to the control group) of those 18 ulcerated eyes developed a second corneal ulceration adjacent to the initial lesion at a median of 10 days (range, 8 to 12 days) after M bovis inoculation (Figure 1). All 4 eyes that failed to develop a corneal ulcer within 48 hours after M bovis inoculation remained ulcer free for the duration of the study. The median OLS for infected eyes (eyes that yielded ≥ 1 CFU of M bovis on ≥ 2 consecutive bacterial cultures) was significantly (P = 0.023) greater than that for eyes that remained uninfected.
Photograph of the left eye of an approximately 7-week-old male Holstein calf 8 days after the performance of a grid keratotomy immediately followed by inoculation with Moraxella bovis hemolytic strain Epp63–300. Notice the fluorescein stain uptake by a secondary corneal ulcer (*) that developed > 48 hours after M bovis inoculation located adjacent to 2 healed ulcers (†) that developed within 48 hours after M bovis inoculation. A ruler is included in the lower right-hand corner of the photograph for measurement purposes; the scale for the top portion of the ruler is in centimeters.
Citation: American Journal of Veterinary Research 77, 9; 10.2460/ajvr.77.9.1017
Ten of the 11 eyes in the treatment group and 8 of 11 eyes in the control group developed a corneal ulcer within 48 hours after M bovis inoculation. Thus, the IBK infection rate for the treatment group (10/11 [91%]) did not differ significantly from that for the control group (8/11 [73%]). Similarly, the proportion of infected eyes for the treatment group (6/11 [55%]) did not differ significantly (P = 0.637) from that for the control group (4/11 [36%]). The number of days required for corneal ulcers to heal and the number of days required for the OLS to decrease to ≤ 4 also did not differ significantly between the treatment and control groups. The corneal ulcer surface area measurement was not associated with treatment group (Figure 2). Although the median maximum OLS during the observation period for the treatment group (6; range, 4 to 7) was numerically greater than that for the control group (5; range, 4 to 7), it did not differ significantly (P = 0.071) between the 2 groups. Similarly, the estimated marginal mean OLS for the control group paralleled that for the treatment group on days 2 through 7, and although the estimated marginal mean OLS for the treatment group declined quicker than that for the control group, that difference was not significant (P = 0.30; Figure 3).
Scatterplots of the corneal ulcer surface area over time for eyes of dairy calves that were experimentally inoculated with M bovis Epp63–300 immediately after corneal scarification was achieved with a grid keratotomy (day 0) and topically treated with an artificial tear solution (0.2 mL/eye) with (treatment group; diamonds) or without (control group; squares) lyophilized Bdellovorus bacteriovorus 109J (concentration, 10.1 log genomic equivalences (GE)/mL) every 48 hours for 6 treatments (on days 1, 3, 5, 7, 9, and 11). For each of 11 male Holstein or Jersey calves (mean ± SD age, 7 ± 1 weeks), 1 eye was randomly assigned to the treatment group and the other eye was assigned to the control group; thus, each calf served as its own control. Corneal ulcers were measured on nontreatment days (days 2, 4, 6, 8, 10, and 12). Calves were euthanized on day 12, and the eyes were harvested for gross and histologic evaluation and bacterial culture.
Citation: American Journal of Veterinary Research 77, 9; 10.2460/ajvr.77.9.1017
Estimated marginal mean OLS over time for the eyes of the calves of Figure 2 that were assigned to the treatment (dashed line; n = 11) and control (solid line; 11) groups. See Figure 2 for remainder of key.
Citation: American Journal of Veterinary Research 77, 9; 10.2460/ajvr.77.9.1017
The tear volume obtained from each cellulose sponge (1 sponge/eye) after centrifugation ranged from 10 to 150 μL (mean, 70 μL). Bdellovibrio bacteriovorus was detected intermittently by RT-PCR assay in 3 of the 6 pooled tear samples for the treatment group in amounts that ranged from 5.3 to 7.1 log GE/mL, whereas the organism was not detected in any of the pooled tear samples for the control group. Use of dark-phase microscopy to visually examine coculture flasks failed to detect active B bacteriovorus organisms. However, when the flasks containing pooled tears collected from the treatment group on days 8 and 10 were observed with dark-phase microscopy at high power (100X), evidence of predatory activity (ie, presence of bdelloplasts)23,24 was observed after 72 hours of incubation, which confirmed the presence of active B bacteriovorus organisms. All liquid cocultures that contained tear samples had varying degrees of bacterial contamination after 72 hours of incubation when cultured for purity on BAP. Identification of those bacterial contaminates was not performed.
On day 12, the terminal OLS ranged from 1 to 7 (median, 4) for the treatment group and from 1 to 6 (median, 4) for the control group. Gram-negative diplococci were isolated during bacterial culture of postmortem corneal specimens for 6 of 11 eyes assigned to the treatment group and 5 of 11 eyes assigned to the control group. Of the 6 gram-negative diplococci–positive cultures for the treatment group, M bovis was identified in 4, Acinetobacter lwoffii strain 040413 was identified 1, and an Acinetobacter spp was identified in 1 on the basis of results of 16s rDNA sequencing and comparison of those results with the GENBANK library. Of the 5 gram-negative diplococci–positive cultures for the control group, M bovis was identified in 4 and Acinetobacter lwoffii strain 040413 was identified in 1. Moraxella bovis was identified in both the treatment and control eyes for each of 3 calves; for all other calves with 1 culture-positive eye, the culture results were negative for the contralateral eye. Histologic examination revealed that the corneal lesions that were present were typically characterized by focal corneal epithelial hyperplasia and dysplasia accompanied by hypercellularity of the superficial layers of the subjacent stroma subsequent to an inflammatory response, which consisted of lymphocytes, plasma cells, macrophages, rare neutrophils, fibroplasia, and neovascularization (Figure 4). The median OHS was 3.75 (range, 2.1 to 14.2) for the treatment group and 2.6 (range, 0 to 7.55) for the control group. There was a significant (P < 0.001) positive correlation (p = 0.755) between the terminal OLS and OHS. Treatment group was not associated with either terminal OLS or OHS.
Photomicrographs of a section of the left cornea from the calf of Figure 1. The calf was euthanized 12 days after M bovis inoculation, and the eyes were harvested for histologic examination. This eye belonged to the treatment group described in Figure 2 and was assigned an OLS of 8 (fluorescein stain uptake in a coalescing deep corneal ulcer < 5 mm accompanied by conjunctival hyperemia and stromal loss [ie, grossly visible divot in the corneal surface]) at the time of euthanasia and an OHS of 13.3 on the basis of histologic examination. A—Representative section of the cornea obtained from the margin of a healing corneal ulcer. Notice the epithelial proliferation and reepithelialization of the corneal surface (right) and the extensive neovascularization within the corneal stroma (arrows). H&E stain; bar = 500 μm. B—Higher magnification of the area delimited by the box in A. Notice the subepithelial cleft (*) adjacent to the primary corneal ulcer, which contains fibrin and inflammatory cells that include lymphocytes, plasma cells, macrophages, and a few neutrophils. A small number of inflammatory cell are also present within the corneal stroma adjacent to the ulcer. H&E stain; bar = 100 μm. See Figures 1 and 2 for remainder of key.
Citation: American Journal of Veterinary Research 77, 9; 10.2460/ajvr.77.9.1017
Treatment solutions
The amount of B bacteriovorus in the treatment solution was 10.3 log GE/mL prior to lyophilization and 10.1 log GE/mL following reconstitution with the artificial tear solution, whereas the amount of nonhemolytic M bovis 12040577 (ie, prey) in the reconstituted, lyophilized treatment solution was 107 GE/mL. Bdellovibrio bacteriovorus was not detected in the control solution.
Discussion
Results of the present study indicated that use of a grid keratotomy to produce corneal scarification prior to experimental inoculation with M bovis resulted in lesions compatible with naturally occurring IBK within 48 hours after inoculation in the majority of eyes (18/22 [82%]). Findings also indicated that, under the experimental conditions used, topical application of an ophthalmic solution containing B bacteriovorus was not effective for the treatment of corneal ulcers.
To our knowledge, prior to the present study, the ability of an experimental model that involved the use of grid keratotomy to scarify the cornea before M bovis inoculation to reliably produce corneal ulcers consistent with naturally occurring IBK in calves had not been evaluated. Prior to initiation of the study, we assumed that model would be as effective as the model described by Gould et al,11 in which a metallic brush was used for corneal scarification, and result in corneal ulcers characteristic of naturally occurring IBK in at least 90% of eyes challenged. Our assumption was close; corneal ulcers characteristic of naturally occurring IBK developed in 82% (18/22) of eyes within 48 hours after grid keratotomy and inoculation with M bovis. However, some eyes (n = 4) in the present study developed secondary corneal ulcers adjacent to the primary ulcer > 2 days after M bovis inoculation, which is not typical in naturally occurring IBK and was not described for the experimental model developed by Gould et al.11 We suspect that those secondary corneal ulcers were caused by subepithelial seeding of bacteria during performance of the grid keratotomy and corneal inoculation, which led to the development of subepithelial microabscesses. That phenomenon was suspected during clinical observation of the affected eyes and was confirmed by the histologic results for those eyes. We believe that corneal scarification by use of a more superficial grid keratotomy technique than that used or by use of a metallic brush might have prevented the secondary corneal ulcers.
In the present study, we chose to perform grid keratotomies on both eyes of each calf to minimize the number of calves used in the study. This paired-eye design32 allowed each calf to serve as its own control and minimized the number of calves subjected to the discomfort caused by the grid keratotomy procedure. Although we recognize that corneal ulceration is a painful condition, the study calves were not administered any additional analgesics aside from the topical anesthetic that was used for the grid keratotomy procedure. That decision was made on the basis that systemic analgesics (eg, NSAIDs such as flunixin meglumine) do not alleviate pain associated with exposed corneal nerve endings and topical anesthetics can be toxic to the corneal epithelium when administered repeatedly. Also, on the basis of the clinical experience of one of the investigators (MG), a board-certified veterinary ophthalmologist, topical administration of NSAIDs to corneal ulcers causes signs of discomfort and does not appear to provide any lasting analgesic effects in calves.
Both eyes of one of the study calves were inoculated with a nonhemolytic strain of M bovis 12040577 to verify that that isolate was not associated with the development of corneal ulcers. This was important because the lyophilized B bacteriovorus inoculum used in the treatment solution contained low numbers of that bacterium, and the investigators needed to ensure that the treatment solution did not exacerbate corneal ulceration.
The 48-hour dosing interval used in the present study for the assigned treatments was chosen on the basis of the expected duration of the maximum treatment effect for the B bacteriovorus treatment solution. Unpublished data obtained by our laboratory group suggest that fluorescein stain has a bacteriostatic or bactericidal effect on B bacteriovorus. Therefore, the decision to perform clinical observations and OLS assignment (which required fluorescein staining) on nontreatment days was made to minimize any negative effects the fluorescein stain might have on the treatment efficacy of the B bacteriovorus (treatment) solution.
Although the maximum OLS for the eyes in the treatment group was numerically lower than that for the eyes in the control group and the mean OLS for the treatment group appeared to decline faster than did the mean OLS for the control group, neither of those variables differed significantly between the 2 treatment groups. Failure to detect a significant treatment difference between the 2 treatment groups might have been caused, in part, by the formation of microabscesses in some eyes and the subsequent development of secondary corneal ulcers that were not amenable to treatment with a biological agent such as B bacteriovorus, which is active only on surfaces (eg, solid media, including biofilms,33 or tissue such as corneal epithelium) and is not active in deep tissues. Additionally, the small number of calves enrolled in the study limited our power to detect differences between groups for treatment effects that had small magnitudes and prohibited us from evaluating treatment difference on the basis of calf age.
Bdellovibrio bacteriovorus was detected infrequently by an RT-PCR assay in tear samples collected from eyes assigned to the treatment group, and none of the liquid cocultures inoculated with pooled tear samples from the treatment group became fully active. Those findings might be associated with several factors that acted alone or in combination, including the presence of a low concentration of B bacteriovorus in the tears subsequent to the organism being flushed out through the nasolacrimal duct or diluted from epiphora after topical instillation of the treatment solution (dose, 0.2 mL/eye; B bacteriovorus concentration, 10.1 log GE/mL), an ophthalmic concentration of M bovis Epp63–300 < 1 × 104 CFUs/mL (the minimum level of M bovis necessary to support B bacteriovorus predation),26 or concurrent bacterial contamination of tear samples during collection. In fact, all tear samples were contaminated with bacteria other than M bovis and B bacteriovorus even though the periocular region of each eye was cleansed with gauze soaked with a 2% iodine solution immediately before tear sample collection.
Of the 11 postmortem corneal specimens that yielded gram-negative diplococci on bacterial culture, M bovis was isolated from 8 (M bovis was isolated from both eyes of each of 3 calves), and Acinetobacter spp were isolated from 3. The genus Acinetobacter consists of gram-negative, strictly aerobic, nonfermentative coccobacilli rods, which are often assembled in pairs. Acinetobacter spp are ubiquitous in nature and are frequently found in the microbial flora of clinically normal bovine eyes34–36; however, Acinetobacter spp have been associated with infections in many veterinary species.37 The relevance of the isolation of Actinetobacter spp from the postmortem corneal specimens in the present study is difficult to interpret. For 2 of the 3 eyes from which Acinetobacter spp was isolated, culture of the corresponding (day 12) eye swab specimens obtained immediately before euthanasia failed to yield growth of hemolytic M bovis. Also, neither of those eyes had gross evidence of a corneal ulcer (OLS ≤ 3). Therefore, we believe that the Acinetobacter spp isolated from those 2 eyes represented environmental contaminates rather than pathogens. That environmental contamination occurred despite our efforts to prevent it by covering the head of each calf with a biohazard bag following confirmation of death for transport to the necropsy facility.
The terminal OLS was significantly and positively correlated with OHS in the present study. Aside from the inherent differences between those 2 scoring systems, discrepancies between those 2 scores were presumed to be associated with variation in the tissue specimens that underwent histologic evaluation. Within each eye, the OHS represented the microscopic assessment of only a few tissue sections of the cornea, whereas the OLS represented a global macroscopic assessment of the entire corneal surface.
Limitations of the present study included the experimental model not completely mimicking naturally occurring IBK, a small study population (n = 12 calves), and a short observation period (12 days) following experimental inoculation with M bovis. The small study population and short observation period were the products of, at least in part, space limitations in the biosecurity level 2 building where the study had to be conducted in conjunction with financial constraints. Additionally, all bacterial cultures of eye swab specimens were performed in our research laboratory, whereas all bacterial cultures of postmortem corneal specimens were performed by the Oklahoma Animal Disease Diagnostic Laboratory, and minor differences in culture procedures or conditions between the 2 laboratories might have contributed to the discrepancies observed for some eyes.
In the present study, we were unable to document the persistence of active B bacteriovorus in the tears of calves with experimentally induced IBK or identify a significant treatment effect for B bacteriovorus in such calves, despite repeated topical administration of an ophthalmic solution containing that organism. Those findings appeared to contradict the results of other unpublished experiments conducted by our laboratory group, in which B bacteriovorus persisted on the corneal surface for a mean of 6 days following ocular instillation in cattle. Although the experimental model (use of grid keratotomy to cause corneal scarification prior to inoculation with M bovis) used in the present study resulted in corneal lesions that were similar to IBK, it did not completely mimic naturally occurring disease, and further research is necessary to identify an experimental model that better mimics naturally occurring IBK in calves. Once such a model has been identified, experiments that involve a larger study population than that used in the present study are necessary to determine the efficacy of a topical ophthalmic formulation containing B bacteriovorus for the treatment of calves with IBK.
Acknowledgments
Supported by the Oklahoma State University Technology and Business Development Program, Stillwater, Okla.
Presented in abstract form at the Conference of Research Workers in Animal Diseases Annual Meeting, Chicago, December 2013.
ABBREVIATIONS
| BAP | Blood agar plate |
| IBK | Infectious bovine keratoconjunctivitis |
| OHS | Ocular histopathological score |
| OLS | Ocular lesion score |
| rDNA | Ribosomal DNA |
| RT-PCR | Real-time PCR |
Footnotes
Rodriguez JE. Infectious bovine keratoconjunctivitis in Angus cattle. MS thesis, Iowa State University, Ames, Iowa, 2006.
Sylvania sun lamp, GTE Products Corp, Manchester, NH.
Boileau MJ. Assessment of Bdellovibrio bacteriovorus 109J viability in bovine tears (abstr). J Vet Intern Med 2011;25:759–760.
Kowa SL-15 slit lamp biomicroscope, Vision Systems Inc, Tarpon Springs, Fla.
FUL-GLO fluorescein sodium ophthalmic strips (1.0 mg), Akorn Inc, Lake Forest, Ill.
Cash Special .25 caliber HD extended-bolt stunner, Bunzl Processor Division, Koch Supplies, North Kansas City, Mo.
BVI mini-blade 64 carbon steel surgical blade, Beaver-Visitec International Inc, Waltham, Mass.
Rosenbusch R, Department of Veterinary Microbiology and Preventative Medicine, College of Veterinary Medicine, Iowa State University, Ames, Iowa.
Oklahoma Animal Disease Diagnostic Laboratory, Oklahoma State University, Stillwater, Okla.
Nutrient broth, Sigma-Aldrich Corp, St Louis, Mo.
Luria-Bertani broth (tissue culture grade), Amresco, Solon, Ohio.
Skim milk powder, EMD Chemicals Inc, Gibbstown, NJ.
80% Glycerol, MP Biomedicals LLC, Solon, Ohio.
Iandolo J, Health Sciences Center, University of Oklahoma, Oklahoma City, Okla.
Olympus BX41 laboratory microscope, Hitschfel Instruments, St Louis, Mo.
Microbial freeze drying buffer (sterile filtered), OPS Diagnostics, Lebanon, NJ.
Freeze drying serum vials (10 mL, clear), OPS Diagnostics, Lebanon, NJ.
FreeZone 4.5-L console freeze dry system with PTFE-coated collector, Labconco, Kansas City, Mo.
13-mm split rubber stoppers, OPS Diagnostics, Lebanon, NJ.
Bion tears (0.45-mL single-use vials, preservative free), Alcon Laboratories Inc, Fort Worth, Tex.
OcuFresh eye wash, Optic Laboratory Inc, El Monte, Calif.
INOVA X5MT-BT, AA-powered LED flashlight (light wavelength, 400 nm), Nite Ize Inc, Boulder, Colo.
PowerShot SD800 IS Digital Elph (7.1 megapixels), Canon Inc, Tokyo, Japan.
Rasband WS, ImageJ (1997–2014), National Institutes of Health, Bethesda, Md. Available at: imagej.nih.gov/ij/. Accessed Mar 9, 2016.
Culture swab, Becton, Dickinson and Co, Franklin Lakes, NJ.
Cellulose eye sponges, Eagle Labs, Rancho Cucamonga, Calif.
Rozen S, Skaletsky HJ. Primer3 (1998). Available at www.genome.wi.mit.edu/genome_software/other/primer3.html. Accessed Mar 9, 2016.
Integrated DNA Technologies, Coralville, Iowa.
CFX96 Touch Real-time PCR Detection System, Bio-Rad Laboratories Inc, Hercules, Calif.
SSoFast, EvaGreen Supermix, Bio-Rad Laboratories Inc, Hercules, Calif.
Cell star tissue culture flask (50 mL; 25 cm2), Greiner Bio-One, Monroe, NC.
Bacto peptone, Becton, Dickinson and Co, Franklin Lakes, NJ.
SPSS, version 21.0. IBM Corp, Armonk, NY.
References
1. Funk L, O'Connor AM, Maroney M, et al. A randomized and blinded field trial to assess the efficacy of an autogenous vaccine to prevent naturally occurring infectious bovine keratoconjunctivitis (IBK) in beef calves. Vaccine 2009; 27: 4585–4590.
2. Thrift FA, Overfield JR. Impact of pinkeye (infectious bovine keratoconjunctivitis) on weaning and post weaning performance of Hereford calves. J Anim Sci 1974; 38: 1179–1184.
3. Brown MH, Brightman AH, Fenwick BW, et al. Infectious bovine keratoconjunctivitis: a review. J Vet Intern Med 1998; 12: 259–266.
4. Hall RD. Relationship of the face fly (Diptera: Muscidae) to pinkeye in cattle: a review and synthesis of the relevant literature. J Med Entomol 1984; 21: 361–365.
5. Hughes DE, Pugh GW Jr, McDonald TJ. Ultraviolet radiation and Moraxella bovis in the etiology of bovine infectious keratoconjunctivitis. Am J Vet Res 1965; 26: 1331–1338.
6. Lepper AWD, Barton IJ. Infectious bovine keratoconjunctivitis: seasonal variation in cultural, biochemical and immunoreactive properties of Moraxella bovis isolated from the eyes of cattle. Aust Vet J 1987; 64: 33–39.
7. Webber JJ, Shelby LA. Risk factors related to the prevalence of infectious bovine keratoconjunctivitis. J Am Vet Med Assoc 1981; 179: 823–826.
8. Daigneault J, George LW. Topically applied benzathine cloxacillin for treatment of experimentally induced infectious bovine keratoconjunctivitis. Am J Vet Res 1990; 51: 376–380.
9. Dueger EL, Angelos JA, Cosgrove S, et al. Efficacy of florfenicol in the treatment of experimentally induced infectious bovine keratoconjunctivitis. Am J Vet Res 1999; 60: 960–964.
10. Smith JA, George LW. Treatment of acute ocular Moraxella bovis infections in calves with a parenterally administered long-acting oxytetracycline formulation. Am J Vet Res 1985; 46: 804–807.
11. Gould S, Dewell R, Tofflemire K, et al. Randomized blinded challenge study to assess association between Moraxella bovoculi and infectious bovine keratoconjunctivitis in dairy calves. Vet Microbiol 2013; 164: 108–115.
12. Hughes DE, Pugh GW Jr, McDonald TJ. Experimental bovine infectious keratoconjunctivitis caused by sunlamp irradiation and Moraxella bovis infection: determination of optimal irradiation. Am J Vet Res 1968; 29: 821–827.
13. Lane VM, George LW, Cleaver DM. Efficacy of tulathromycin for treatment of cattle with acute ocular Moraxella bovis infections. J Am Vet Med Assoc 2006; 229: 557–561.
14. Zielinski GC, Piscitelli HG, Urbani LA. Experimental reproduction of bovine infectious keratoconjunctivitis in calves inoculated with Moraxella bovis in solid phase. Rev Med Vet (B Aires) 2007; 88: 73–77.
15. Allen LJ, George LW, Willits NH. Effect of penicillin or penicillin and dexamethasone in cattle with infectious bovine keratoconjunctivitis. J Am Vet Med Assoc 1995; 206: 1200–1203.
16. Shryock TR, White DW, Werner CS. Antimicrobial susceptibility of Moraxella bovis. Vet Microbiol 1998; 61: 305–309.
17. Eastman TG, George LW, Hird DW, et al. Combined parenteral and oral administration of oxytetracycline for control of infectious bovine keratoconjunctivitis. J Am Vet Med Assoc 1998; 121: 560–563.
18. George LW, Mihalyi J, Edmondson A, et al. Topically applied furazolidone or parenterally administered oxytetracycline for the treatment of infectious bovine keratoconjunctivitis. J Am Vet Med Assoc 1988; 192: 1415–1422.
19. Angelos JA, Dueger EL, George LW, et al. Efficacy of florfenicol for treatment of naturally occurring infectious bovine keratoconjunctivitis. J Am Vet Med Assoc 2000; 216: 62–64.
20. Dueger EL, George LW, Angelos JA, et al. Efficacy of a long-acting formulation of ceftiofur crystalline-free acid for the treatment of naturally occurring infectious bovine keratoconjunctivitis. Am J Vet Res 2004; 65: 1185–1188.
21. Davidson HJ, Stokka GL. A field trial of autogenous Moraxella bovis bacterin administered through either subcutaneous or subconjunctival injection on the development of keratoconjunctivitis in a beef herd. Can Vet J 2003; 44: 577–580.
22. O'Connor AM, Brace S, Gould S, et al. A randomized clinical trial evaluating a farm-of-origin autogenous Moraxella bovis vaccine to control infectious bovine keratoconjunctivitis (pinkeye) in beef cattle. J Vet Intern Med 2011; 25: 1447–1453.
23. Stolp H. The Bdellovibrios: bacterial parasites of bacteria. Annu Rev Phytopathol 1973; 11: 53–76.
24. Lambert C, Sockett RE. Laboratory maintenance of Bdellovibrio. Curr Protoc Microbiol 2008; 9: 7B.2.1–7B.2.3.
25. Rogosky AM, Moak PL, Emmert EA. Differential predation by Bdellovibrio bacteriovorus 109J. Curr Microbiol 2006; 52: 81–85.
26. Boileau MJ, Clinkenbeard KD, Iandolo JJ. Assessment of Bdellovibrio bacteriovorus 109J killing of Moraxella bovis in an in vitro model of infectious bovine keratoconjunctivitis. Can J Vet Res 2011; 75: 285–291.
27. AVMA. AVMA guidelines for the euthanasia of animals: 2013 edition. Available at: www.avma.org/KB/Policies/Documents/euthanasia.pdf. Accessed Mar 9, 2016.
28. Angelos JA, Hess JF, George LW. Cloning and characterization of a Moraxella bovis cytotoxin gene. Am J Vet Res 2001; 62: 1222–1228.
29. Untergrasser A, Cutcutache I, Koressaar T, et al. Primer3—new capabilities and interfaces. Nucleic Acids Res 2012; 40: e115.
30. Koressaar T, Remm M. Enhancements and modifications of primer design program Primer3. Bioinformatics 2007; 23: 1289–1291.
31. Wurtzel O, Dori-Bachash M, Pietrokovski S, et al. Mutation detection with next-generation resequencing through a mediator genome. PLoS ONE 2010; 5: e15628.
32. Gilger BC. Concerns with analysis of correlated eye data. Vet Ophthalmol 2011; 14: 214.
33. Kadouri D, O'Toole GA. Susceptibility of biofilms to Bdellovibrio bacteriovorus attack. Appl Environ Microbiol 2005; 71: 4044–4051.
34. Wilcox GE. Bacterial flora of the bovine eye with special reference to the Moraxella and Neisseria. Aust Vet J 1970; 46: 253–257.
35. Alexander D. Infectious bovine keratoconjunctivitis: a review of cases in clinical practice. Vet Clin North Am Food Anim Pract 2010; 26: 487–503.
36. Holman DB, Timsit E, Alexander TW. The nasopharyngeal microbiota of feedlot cattle. Sci Rep 2015; 26: 15557.
37. Doughari HJ, Ndakidemi PA, Human IS, et al. The ecology, biology and pathogenesis of Acetinobacter spp: an overview. Microbes Environ 2011; 26: 101–112.
Appendix 1
Description of the OLS system used during clinical evaluation of the eyes of dairy calves that were experimentally inoculated with Moraxella bovis Epp63–300 immediately after corneal scarification was achieved with a grid keratotomy (day 0) and topically treated with an artificial tear solution (0.2 mL/eye) with (treatment group) or without (control group) lyophilized Bdellovibrio bacteriovorus 109J (concentration, 10.1 log genomic equivalences (GE)/mL) every 48 hours for 6 treatments (on days 1, 3, 5, 7, 9, and 11). Eyes were evaluated on days 2, 4, 6, 8, 10, and 12 (just prior to euthanasia and harvesting of eyes for histologic examination). An OLS was independently assigned to each eye at each evaluation.
| OLS | Description |
|---|---|
| 1 | No visible lesions |
| 2 | Corneal opacity (no fluorescein stain uptake); no conjunctival hyperemia |
| 3 | Conjunctival hyperemia |
| 4 | Corneal opacity (no fluorescein stain uptake) with conjunctival hyperemia |
| 5 | Fluorescein stain uptake in grid keratotomy (< 5 mm)* |
| 6 | Fluorescein stain uptake in coalescing superficial corneal ulcer < 5 mm*† |
| 7 | Fluorescein stain uptake in coalescing superficial corneal ulcer ≥ 5 mm*† |
| 8 | Fluorescein stain uptake in coalescing deep corneal ulcer < 5 mm*‡ |
| 9 | Fluorescein stain uptake in coalescing deep corneal ulcer ≥ 5 mm*‡ |
| 10 | Descemetocele (deep ulcer with no fluorescein stain uptake) or corneal perforation*‡ |
Accompanied by conjunctival hyperemia.
Epithelial loss only.
Stromal loss; grossly visible divot in the corneal surface.
Appendix 2
Scoring system used to quantify the number of CFUs of M bovis present in bacterial cultures.
| Score | No. of CFUs of β-hemolytic M bovis present on BAP |
|---|---|
| 0 | No growth |
| 0.5 | ≥ 1 to > 10 CFUs in first quadrant |
| 1 | ≥ 10 CFUs in first quadrant |
| 2 | ≥ 10 CFUs in second quadrant |
| 3 | ≥ 10 CFUs in third quadrant |
| 4 | ≥ 10 CFUs in fourth quadrant |
Appendix 3
Description of forward (F) and reverse (R) primers used in RT-PCR assays for identification of M bovis (Mbx) and B bacteriovorus 109J (Bb).
| Primers | Sequence (5′→ 3′) | Amplicon size (bp) |
|---|---|---|
| MbxF | TAGGACGCTCTGGTTCAGGT | 103 |
| MbxR | AATGCCAAATCGTTTCCATC | |
| Bb16F | GCCGAACACTGACACTGAGA | 108 |
| Bb16R | GGGGTCAATACCTCCAACAA |
Appendix 4
Description of the OHS system used during histologic evaluation of the eyes described in Appendix 1.
| Multiplier | Distribution (ie, location of the corneal lesion) |
|---|---|
| 0.2 | L = Limbal |
| 0.2 | MF = Multifocal |
| 0.4 | F = Focal (< 2 10X-fields) |
| 0.7 | R = Regional (> 2 10X-fields) |
| 1 | D = Diffuse |
| Multiplier | Severity of the corneal lesion |
| 0 | Within normal limits; no detectable abnormality |
| 0.1 | Minimal detectable focal lesion (not ulcerated) |
| 0.5 | Mild lesion without overt ulceration |
| 1 | Mild lesion with shallow ulceration |
| 2 | Moderate (ulceration of superficial 1/3–1/2 of the corneal stroma) |
| 3 | Severe (ulceration into deeper half of the corneal stroma)* |
None of the corneas were perforated.
See Appendix 1 for remainder of key.
