The thymus is a primary lymphoid organ best recognized for its capacity to generate T lymphocytes.1,2 Unlike most organs, the thymus begins to involute soon after birth, and its morphology and function continue to regress with age.3,4 The morphology of the thymus has been described for various species such as cattle,5 Japanese serow (Capricornis crispus),6 rats,7 and humans.8 The thymus of humans is multilobular and has well-developed Hassall corpuscles, whereas the thymus of mice is bilobar and has poorly developed Hassall corpuscles.9 The most prominent histologic change associated with thymic involution is the replacement of the functional lymphoepithelial tissue with adipose and connective tissues.
T lymphocytes are the central regulatory and effector cells of the immune system. They develop within the thymus. Thus, the thymus has a critical role in the functional development of the immune system.1 The CD3 antigen is associated with the T-cell receptor and is present in all T lymphocytes. It has been hypothesized that a decrease in thymic function is responsible for a marked decrease in the expression of CD3.10,11
The thymic medulla has a specialized microenvironment that contains a high density of TDCs, which might be involved in T-cell activation, proliferation, and tolerance induction.12,13 Ito et al14 demonstrated that TDCs could be defined by expression of the multifunctional protein S100 β. With age, the number of TDCs decreases markedly as the cellularity of the thymus decreases. Results of other studies15,16 indicate that involution of the thymus is associated with a progressive decline in the number of TDCs.
Apoptosis occurs during the development and regulation of the immune system, which leads to deletion of self-reactive T and B cells, regulation of immunologic memory, and lysis of target cells by cytotoxic T cells and natural killer cells.17 In mice, the frequency of apoptosis of bone marrow–derived pre–B cells18 and T cells19 increases with age. Consequently, apoptosis is responsible for the decrease in cellularity that is the hallmark of age-dependent involution of the thymus.20 Caspase-3 labeling is a reliable immunohistochemical method to identify and quantify apoptotic cells in the lymphoid tissue of humans.21
Yaks (Bos grunniens) are native plateau animals that are found extensively in the central Asian highlands. In China, yaks are mainly found on plateaus at altitudes of 3,000 to 5,000 m above sea level.22 Highland plateaus are characterized by strong UV radiation and atmospheric oxygen content and environmental temperatures that are substantially lower than those at lower elevations. Consequently, plateau animals are frequently exposed to strong UV radiation and can develop hypoxia and hypothermia, all of which may adversely affect their immune function. For example, hypoxia suppresses the function of T, natural killer, and antigen-presenting cells.23,24 However, animals and humans that are native to highland plateaus have evolved and adapted to the harsh environment and are less susceptible to disease caused by UV radiation, hypoxia, and hypothermia than are individuals that reside at lower elevations. Additionally, results of epidemiological surveys25,26 suggest that yaks that reside on highland plateaus (plateau yaks) develop bacterial and parasitic infections only sporadically. It is unknown whether age-related morphological changes associated with thymic involution in plateau yaks are similar to those observed in humans and other mammals.
Elucidation of the age-related morphological changes of healthy plateau yaks would aid in understanding thymic immune system adaptations to high elevations (plateaus). The purpose of the study reported here was to evaluate age-related changes in the morphology and protein expression of the thymus of healthy plateau yaks of various ages and compare those changes with those of other animals.
Materials and Methods
Animals and tissue collection
The study was approved by the State Forestry Administration, and all procedures were performed in compliance with guidelines for the care and use of laboratory animals adopted by the Ministry of Science and Technology of the People's Republic of China. Fifteen male yaks were enrolled in the study. The yaks were allocated to 3 age groups (newborn [1 to 7 days old; n = 5], juvenile [5 to 7 months old; 5], and adult [3 to 4 years old; 5]). All yaks were considered healthy on the basis of results of a physical examination and serum biochemical analysis.
Each yak was euthanized with pentobarbital sodium (200 mg/kg, IV). The thymus was harvested within 10 minutes after euthanasia. For mRNA and protein expression analyses, fresh thymic tissue was washed with diethylpyrocarbonate-treated water and stored in liquid nitrogen. For histologic and immunohistochemical analyses, small specimens of thymic tissue were fixed in a solution of 4% paraformaldehyde in a phosphate buffer (pH, 7.3).
Histologic examination and electron microscopy
Formalin-fixed tissue specimens were embedded in paraffin. The tissue was then sliced into 4-μm-thick sections and stained with H&E stain. Histologic examination was then performed with the aid of a light microscope.a
The ultrastructural characteristics of the thymus were evaluated with transmission electron microscopy. Small pieces (1 mm3) of fixed thymic tissue were postfixed in a 1% solution of osmium tetroxide for 2 hours, dehydrated with a graded ethanol series, and embedded in resin.b The embedded tissue was then cut into ultrathin (60- to 80-nm) sections with an ultramicrotome.c The tissue sections were stained with aqueous uranyl acetate and lead citrate and examined with a transmission electron microscoped at an accelerating voltage of 120 kV. All examinations were performed by 1 investigator (QZ) who was unaware of the age of the yak from which the specimen was obtained.
Gene expression
Total RNA was isolated from fresh frozen thymic tissues to determine expression of the genes for CD3 epsilon, S100 β, caspase-3, and β-actin. Briefly, RNA was eluted in 30 μL of RNase-free water, and its quality and quantity were assessed with a commercial analysis kite for automated electrophoresisf as described.27 First-strand cDNA was synthesized by use of oligo(dT) priming and reverse transcriptase.g The multiple alignment of cDNA sequences for CD3 epsilon, S100 β, and caspase-3 of yaks had > 99% similarity with those for domestic cattle (Bos taurus). To our knowledge, the genome sequences for CD3 epsilon, S100 β, and caspase-3 in yaks have not been published in Genbank; therefore, the RT-PCR primers (Appendix) used to determine the relative quantitative expressions of those genes were designed on the basis of Bos taurus sequences (X53270.1, BC134727.1, and NM_001077840.1). The RT-PCR primers used for β-actin were designed on the basis of a Bos grunniens sequence (DQ838049.1). A thermocyclerh was used for all RT-PCR reactions. Each reaction had a volume of 20 μL, which contained 200 ng of total cDNA and 100nM each of the appropriate forward and reverse primers. The RT-PCR reaction conditions were 3 minutes at 95°C, then 40 cycles of each of the following: 20 seconds at 95°C, 20 seconds at 60°C, and 15 seconds at 72°C. A melting curve analysis was performed from 65° to 95°C in 0.5°C increments, each of which lasted for 5 seconds, to confirm the presence of a single product and the absence of primer dimers. The threshold was determined automatically by the thermocycler software.11 The comparative cycle threshold method was used to quantify the relative expression of each gene as described.28 For each specimen, the relative expression of each gene was determined in duplicate, and a nontemplate control was used to monitor for contamination.
Protein expression
Expression of CD3 epsilon, S100 β, and caspase-3 protein in the thymus was determined by Western blot analysis. Fresh frozen tissue specimens were homogenized in ice-cold (4°C) cell lysis buffer solution that contained protease inhibitors (20mM Tris, 150mM sodium chloride, 1mM EDTA, 1mM ethylene glycol tetraacetic acid, 1mM tetrasodium pyrophosphate, 1mM glycerophosphate nonionic surfactant,i 200mM sodium orthovanadate, aprotinin [2 mg/mL], and leupeptin [2 mg/mL]). The tissue lysate, which included 50 μg of total protein, underwent separation by the use of 12% SDS PAGE and then was electrotransferred (100 V for 2 hours) onto nitrocellulose membranes.j The transferred membrane was blocked with 5% nonfat milk in Tris-buffered saline solution with Tween at 37°C for 2 hours, and then incubated with the diluted (1/500) primary antibody against the protein of interest (CD3,k S100 or caspase-3m) overnight (approx 12 hours). The membrane was then washed 3 times with Tris-buffered saline solution with Tween and incubated with secondary goat anti-rabbit antibodiesn for 2 hours. The respective protein bands were made visible by reaction with enhanced chemiluminescence reagents, followed by exposure to x-ray film. The intensity of the band produced for each protein of interest was compared with the intensity of band produced for β-actin to normalize the results.
Immunohistochemical analysis
The spatial distribution of T lymphocytes, TDCs, and apoptotic thymocytes in the fixed thymic tissue was evaluated by immunohistochemical staining. Fixed tissue specimens were mounted on microscope slides in a routine manner and exposed to primary antibodies against CD3,k S100 β,1 and caspase-3,m followed by a multilink biotinylated rabbit anti-goat secondary antibody.o Then streptavidin-conjugated peroxidase was applied to the slide to catalyze color production from chromagen diaminobenzidine tetrachloride. The sections were counterstained with hematoxylin.21 To assess the specificity of the immunolabeling, negative control slides were created on which the primary antibody was replaced with bovine serum albumin while all other steps and conditions remained the same.
Statistical analysis
The histologic and ultrastructural characteristics of the thymus within each age group (newborn, juvenile, and adult) of yaks were described. The distributions of the relative mRNA and protein expression data were assessed for normality by the Shapiro-Wilk test. All data were distributed normally. Quantitative outcomes were compared among the 3 age groups by use of a 1-way ANOVA with the Tukey adjustment to account for multiple pairwise comparisons. Values of P < 0.05 were considered significant. All analyses were performed with statistical software.p
Results
Histologic and ultrastructural characteristics
The thymus was enclosed by a capsule that consisted of fibrous connective tissue. The capsule formed a septate gland and divided the thymus into several lobules. Each lobule included a peripheral dark-colored cortex that contained a high density of lymphocytes and an inner light-colored medulla that contained Hassall corpuscles (Figure 1). Ultrastructurally, the lymphocytes of the thymic parenchyma had irregularly shaped heterochromatin and either a peripherally or centrally located nucleolus (Figure 2).
Representative photomicrograph of a section of thymus from a healthy male newborn (1 to 7 days old) yak that depicts multiple thymic lobes. Co = Cortex. HC = Hassall corpuscle. M = Medulla. S = Interlobular septum. H&E stain; bar = 0.6 mm.
Citation: American Journal of Veterinary Research 77, 6; 10.2460/ajvr.77.6.567
Representative low-magnification electron micrograph of a section of thymus from a healthy male juvenile (5 to 7 months old) yak. Notice the cortical thymocytes have irregular heterochromatin and lymphocytes (L) have a peripherally or centrally located nucleolus. Bar = 10 μm.
Citation: American Journal of Veterinary Research 77, 6; 10.2460/ajvr.77.6.567
In newborn yaks, the thymus contained many thymocytes and had a clear corticomedullary junction and thin thymic capsule and interlobular septum (Figure 3). In juvenile yaks, the thymic septum was infiltrated by discrete fat cells. In adult yaks, the thymus had an unclear corticomedullary junction, and compared with the thymus in younger yaks, the thymocyte density was less, the thymic capsule and interlobular septum were thicker, and the amount of adipose and connective tissue in the parenchyma was greater. Hassall corpuscles were present in the thymus of yaks of all 3 age groups, although their morphology differed among the groups. In newborn yaks, there was a high number of Hassall corpuscles that were small and round in shape with rare necrotic or degenerative changes. In juvenile and adult yaks, the Hassall corpuscles were large and had many necrotic and degenerative changes (Figure 4).
Representative photomicrographs of a section of thymus from a healthy 1-day-old male yak (newborn; A), healthy 7-month-old male yak (juvenile; B), and healthy 3-year-old male yak (adult; C). Notice that the interlobular septum (S) of the juvenile yak (B) is thicker than that of the newborn yak (A) and is infiltrated by fat cells (F). The thymus of the adult yak (C) is characterized by an unclear corticomedullary junction and contains more fat tissue than do the thymuses of newborn and juvenile yaks. Co = Cortex. HC = Hassall corpuscle. M = Medulla. H&E stain; bar = 100 μm.
Citation: American Journal of Veterinary Research 77, 6; 10.2460/ajvr.77.6.567
Representative photomicrograph of a section of thymus from a healthy 5-month-old male yak. Notice that HCs are large and contain several lymphocytes and the medulla (M) is characterized by necrotic degenerative changes in the central area and oval epithelial cells at the periphery. H&E stain; bar = 20 μm.
Citation: American Journal of Veterinary Research 77, 6; 10.2460/ajvr.77.6.567
CD3 epsilon expression and localization
The relative quantitative expression of CD3 epsilon mRNA decreased with age. Expression of CD3 epsilon mRNA in the thymus of newborn yaks was significantly greater (1.5 and 2.3 times, respectively) than that in juvenile and adult yaks. Expression of CD3 epsilon mRNA in the thymus of juvenile yaks did not differ significantly from that in adult yaks.
The CD3 epsilon protein was expressed widely throughout the thymus, and its expression decreased with age. Expression of CD3 epsilon protein in the thymus of newborn yaks was significantly greater (1.7 and 1.9 times, respectively) than that in juvenile and adult yaks. Expression of CD3 epsilon protein in the thymus of juvenile yaks did not differ significantly from that in adult yaks.
In adult yaks, T lymphocytes immunopositive for CD3 epsilon protein were present in both the cortex and medulla of the thymus. In CD3 epsilon–positive T cells, immunoreactivity was greatest in the cytoplasmic membrane and along the border of the cytoplasm (Figure 5).
Representative photomicrographs of thymus sections from healthy male yaks of various ages that are immunohisto-chemically stained for CD3 (A and B), S100 β (C and D), or caspase-3 (E and F). Notice that the CD3-positive cells are located in both the cortex (Co) and medulla (M; A) and that immunoreactivity is greatest in the cytoplasmic membrane of lymphocytes (B). Notice that S100 β-positive cells are primarily TDCs located in the corticomedullary junction and medullary zones (particularly around or inside Hassall corpuscles [HC]; C), and those cells are round or irregular in shape (D). Notice that caspase-3-positive cells are observed diffusely throughout the cortex and medulla (E), and those cells are primarily apoptotic lymphocyte-like cells (F). Bar = 50 μm (A, C, and E); bar = 20 μm (B, D, and F).
Citation: American Journal of Veterinary Research 77, 6; 10.2460/ajvr.77.6.567
S100 β expression and localization
The relative quantitative expression of S100 β mRNA decreased with age. Expression of S100 β mRNA in the thymus of newborn yaks was significantly greater (4.1 and 9.4 times, respectively) than that in juvenile and adult yaks. Expression of S100 β mRNA in the thymus of juvenile yaks was significantly greater than that in adult yaks.
The S100 β protein was expressed widely throughout the thymus, and its expression decreased with age. Expression of S100 β protein in the thymus of newborn yaks was significantly greater (4.3 and 15.7 times, respectively) than that in juvenile and adult yaks. Ex pression of S100 β protein in the thymus of juvenile yaks was significantly greater than that in adult yaks.
Thymic dendritic cells that stained positive for the S100 β protein were round or irregular in shape (Figure 5). Those cells were localized at the corticomedullary junction and in the medullary zones (particularly around or inside Hassall corpuscles) of all age groups.
Caspase-3 expression and localization
Unlike CD3 epsilon and S100 β, the relative quantitative expression of caspase-3 mRNA increased with age. Expression of caspase-3 mRNA in the thymus of adult yaks was 1.1 and 1.9 times greater than that in juvenile and newborn yaks, respectively. Expression of caspase-3 mRNA in the thymus of adult yaks did not differ significantly from that in juvenile yaks but was significantly greater than that in newborn yaks. Likewise, expression of caspase-3 mRNA in the thymus of juvenile yaks was significantly greater than that in newborn yaks.
The caspase-3 protein was expressed widely throughout the thymus, and its expression increased with age. Expression of the caspase-3 protein in the thymus of adult yaks was 1.2 and 2.2 times greater than that in juvenile and newborn yaks, respectively. Expression of caspase-3 protein in the thymus of adult yaks did not differ significantly from that in juvenile yaks but was significantly greater than that in newborn yaks. Likewise, expression of caspase-3 protein in the thymus of juvenile yaks was significantly greater than that in newborn yaks.
Cells that stained positive for caspase-3 protein were detected diffusely in both the cortex and medulla. The caspase-3 protein was primarily associated with the nuclei of apoptotic lymphocyte-like cells (Figure 5).
Discussion
Results of the present study indicated that the morphology of the thymus of yaks was most similar to that of humans. As yaks age, the functional area of the thymus decreases and the amount of thymic connective and adipose tissue increases. That finding was consistent with the age-related characteristics of the thymus of humans,8 guinea pigs,29 horses,30 and other domestic ruminants.5,6 Consequently, we concluded that the general microarchitecture of the postnatal thymus of yaks is similar to that of humans and other mammals.
In the present study, the size and morphology of Hassall corpuscles varied with age. Hassall corpuscles are infrequent and small in the thymus of murine species,31 but are large and numerous in the thymus of humans.32 Those characteristics suggest that Hassall corpuscles are well developed in the thymus of humans and poorly developed in the thymus of murine species. The fact that the size and number of Hassall corpuscles in the thymus of yaks increased with age suggested that the corpuscles continue to develop after birth and might have an active effect on phagocytosis and the secretion of cytokines.
In humans and rodents, increasing age is associated with a decrease in the expression of anti-CD3 antibody.10,11,33 In the yaks of the present study, expression of CD3 mRNA and protein in the thymus also decreased with age, which we attributed to thymic involution. On the basis of the results of the present study, it appeared that adipose and connective tissues accumulate in the thymus throughout the lifetime of yaks, which leads to a decrease in active thymopoiesis and the production of T lymphocytes. Investigators of another study11 reported that the number of CD3-positive T lymphocytes in the peripheral blood, spleen, and digestive tract mucosa decreases with age. Thus, age-related thymic involution affects the number of T lymphocytes in secondary lymphoid tissues.
Expression of S100 β mRNA and protein in the thymus decreased with age for the yaks of the present study, which was consistent with the results of studies12,15 that involved the thymus of humans. In those studies,12,15 expression of S100 β antigens began to decline at birth. That decline accelerates in adults and might be correlated with a decrease in accessory cells, which induces thymocyte negative selection and self-tolerance.15,16 On the basis of these collective findings, we believe that the age-related decrease in the number of TDCs is the result of thymic involution and, by extrapolation, accounts for the decrease in an individual's capability to respond to antigen signals as they age.
In the thymus of yaks, TDCs were localized at the corticomedullary junction and in the medullary zones, which was consistent with their location in the thymus of rats,16 calves,13 and humans.12,15 We concluded that the thymic medulla might be a major antigen-trapping site where many antigen-presenting cells induce T-cell maturation and differentiation. Moreover, several S100 β–positive TDCs were observed closely adhered to Hassall corpuscles, which suggested that the epithelial cells of the corpuscles might be involved in communication between thymic lymphocytes and antigen-presenting cells and that the secretion of Hassall corpuscles might induce functional maturity of TDCs.
Results of the present study suggested that the thymic microenvironment of yaks changes with age, and those changes decrease the capacity of the thymus to generate thymocytes. Results of an in vitro study20 indicate that T lymphocytes of elderly individuals are more susceptible to activation-induced apoptosis than are T lymphocytes of young individuals. Investigators of another study34 reported that thymocyte expression of death genes such as p53, caspase-3, and bax increases with age. Similarly, thymocyte expression of caspase-3 mRNA and protein increased with age for the yaks of the present study and might have been associated with a decrease in thymic function and output of mature T lymphocytes.
To our knowledge, the present study was the first to describe age-related morphological changes in the thymus of yaks. The morphology of the thymus of yaks was most consistent with that of humans, and age-related changes in thymic expression of CD3, S100 β, and caspase-3 for yaks were similar to those of humans and other mammals. Thus, yaks might serve as a model to study thymic immune system adaptations to high elevations.
Acknowledgments
This study was supported by the National Natural Science Foundation of China (Grant No. 31360594 &31572478).
The first 2 authors contributed equally to this manuscript.
ABBREVIATIONS
| CD3 | Cluster of differentiation 3 |
| RT-PCR | Real-time PCR |
| TDC | Thymic dendritic cell |
Footnotes
Olympus DP71, Tokyo, Japan.
Polysciences, Warrington, Pa.
Du Pont Co, Diagnostic and BioResearch Systems, Wilmington, Del.
JEOL LTD, Tokyo, Japan.
Experion RNA StdSens analysis kit, Bio-Rad Laboratories Inc, Munich, Germany.
Esperion Automated Electrophoresis Station, BioRad, Munich, Germany.
SuperScript II RNase H reverse transcriptase, Gibco, BRL, Life Technologies GmbH, Eggenstein, Germany.
LightCycler480 thermocycler, Invitrogen Corp, Carlsbad, Calif.
Triton X-100, Sigma-Aldrich Corp, St Louis, Mo.
Bio-Rad Laboratories Inc, Hercules, Calif.
Anti-CD3, Abcam, Cambridge, England.
Anti-S100 β, Abcam, Cambridge, England.
Anti-caspase-3, Abcam, Cambridge, England.
SP kit (rabbit), Bioss, Beijing, China.
Rabbit anti-goat IgM whole serum, Bioss, Beijing, China.
SPSS Statistics, version 20.0, IBM Corp, Armonk, NY.
References
1. Janeway CA Jr, Travers P, Walport M, et al. Immunobiology: the immune system in health and disease. 5th ed. New York: Garland Science Publishing, 2001; 90–91.
2. Haynes BF, Hale LP. The human thymus. A chimeric organ comprised of central and peripheral lymphoid components. Immunol Res 1998; 18: 175–192.
3. Flores KG, Li J, Sempowski GD, et al. Analysis of the human thymic perivascular space during aging. J Clin Invest 1999; 104: 1031–1039.
4. Gruver AL, Hudson LL, Sempowski GD. Immunosenescence of ageing. J Pathol 2007; 211: 144–156.
5. Lubis I, Ladds PW, Reilly LR. Age associated morphological changes in the lymphoid system of tropical cattle. Res Vet Sci 1982; 32: 270–277.
6. Sugimura M, Suzuki Y, Atoji Y, et al. Morphological studies on the thymus of Japanese serows, Capricornis crispus. Research Bulletin of the Faculty of Agriculture, Gifu University. 1983; 48: 113–119.
7. Plecas-Solarovi B, Pesic V, Radojevic K, et al. Morphometrical characteristics of age-associated changes in the thymus of old male Wistar rats. Anat Histol Embryol 2006; 35: 380–386.
8. Haynes BF, Sempowski GD, Wells AF, et al. The human thymus during aging. Immunol Res 2000; 22: 253–261.
9. Pearse G. Normal structure, function and histology of the thymus. Toxicol Pathol 2006; 34: 504–514.
10. Thoman ML. The pattern of T lymphocyte differentiation is altered during thymic involution. Mech Ageing Dev 1995; 82: 155–170.
11. Mitchell WA, Lang PO, Aspinall R. Tracing thymic output in older individuals. Clin Exp Immunol 2010; 161: 497–503.
12. Aita M, Franzé A, Gabrielli F. S-100 immunoreactive interdigitating cells in normal and in Down's syndrome human thymuses. Cell Biol Int Rep 1991; 15: 645–659.
13. Bielefeldt Ohmann H, Basse A. Interdigitating cells in the lymphoid tissues of bovine fetuses and calves. An electron-microscopic study. Cell Tissue Res 1984; 235: 153–158.
14. Ito M, Minamiya Y, Kawai H, et al. Tumor-derived TGFbeta-1 induces dendritic cell apoptosis in the sentinel lymph node. J Immunol 2006; 176: 5637–5643.
15. Nakahama M, Mohri N, Mori S, et al. Immunohistochemical and histometrical studies of the human thymus with special emphasis on age-related changes in medullary epithelial and dendritic cells. Virchows Arch B Cell Pathol Incl Mol Pathol 1990; 58: 245–251.
16. Hsiao L, Takahashi K, Takeya M, et al. Differentiation and maturation of macrophages into interdigitating cells and their multicellular complex formation in the fetal and postnatal rat thymus. Thymus 1991; 17: 219–235.
17. Gupta S. Molecular steps of cell suicide: an insight into immune senescence. J Clin Immunol 2000; 20: 229–239.
18. Kirman I, Zhao K, Wang Y, et al. Increased apoptosis of bone marrow pre-B cells in old mice associated with their low number. Int Immunol 1998; 10: 1385–1392.
19. Zhou T, Edwards CK III, Mountz JD. Prevention of age-related T cell apoptosis defect in CD2-fas-transgenic mice. J Exp Med 1995; 182: 129–137.
20. Sainz RM, Mayo JC, Reiter R, et al. Apoptosis in primary lymphoid organs with aging. Microsc Res Tech 2003; 62: 524–539.
21. Resendes AR, Majó N, Segalés J, et al. Apoptosis in normal lymphoid organs from healthy normal, conventional pigs at different ages detected by TUNEL and cleaved caspase-3 immunohistochemistry in paraffin-embedded tissues. Vet Immunol Immunopathol 2004; 99: 203–213.
22. Wiener G, Han JL, Long RJ. The yak. 2nd ed. Bangkok, Thailand: Regional Office for Asia and the Pacific Food and Agriculture Organization of the United Nations, 2003;136–137.
23. Mancino A, Schioppa T, Larghi P, et al. Divergent effects of hypoxia on dendritic cell functions. Blood 2008; 112: 3723–3734.
24. Ohta A, Diwanji R, Kini R, et al. In vivo T cell activation in lymphoid tissues is inhibited in the oxygen-poor microenvironment. Front Immunol 2011; 2: 27.
25. Ji Q-M. Advances in research of yak resources in China. J Nat Resour 2001; 16: 564–570.
26. Yin M-Y, Zhou D-H, Liu JZ, et al. Prevalence of yak main parasitic diseases in china and strategies for its control. China Anim Husb Vet Med 2014; 41: 227–230.
27. Fleige S, Pfaffl MW. RNA integrity and the effect on the real-time qRT-PCR performance. Mol Aspects Med 2006; 27: 126–139.
28. Pfaffl MW, Horgan GW, Dempfle L. Relative expression software tool (REST) for group-wise comparison and statistical analysis of relative expression results in real-time PCR. Nucleic Acids Res 2002; 30: e36.
29. Hale LP, Clark AG, Li J, et al. Age-related thymic atrophy in the guinea pig. Dev Comp Immunol 2001; 25: 509–518.
30. Contreiras EC, Lenzi HL, Meirelles MN, et al. The equine thymus microenvironment: a morphological and immunohistochemical analysis. Dev Comp Immunol 2004; 28: 251–264.
31. Farr AG, Dooley JL, Erickson M. Organization of thymic medullary epithelial heterogeneity: implications for mechanisms of epithelial differentiation. Immunol Rev 2002; 189: 20–27.
32. Raica M, Encica S, Motoc A, et al. Structural heterogeneity and immunohistochemical profile of Hassall corpuscles in normal human thymus. Ann Anat 2006; 188: 345–352.
33. Gill J, Malin M, Sutherland J, et al. Thymic generation and regeneration. Immunol Rev 2003; 195: 28–50.
34. Herndon FJ, Hsu HC, Mountz JD. Increased apoptosis of CD45RO- T cells with aging. Mech Ageing Dev 1997; 94: 123–134.
Appendix
Primers for CD3 epsilon, S100 β, caspase-3, and β-actin used for RT-PCR assays performed on thymus specimens obtained from healthy yaks of various ages.
| PCR product size | Primer name | Primer sequence |
|---|---|---|
| 195 bp | Yak CD3 real-time S | 5′–ACCCAATCCAGACTATGAGC–3′ |
| Yak CD3 real-time AS | 5′–CCACAAGGCAGAAGAACAG–3′ | |
| 114 bp | Yak S100 β real-time S | 5′–GAGGAAATCAAAGAGCAGGAGGT–3′ |
| Yak S100 β real-time AS | 5′–AGTGGTAATCATGGCAACGAAAG–3′ | |
| 149 bp | Yak caspase 3 real-time S | 5′–TGTCAAACAACAGCAATGACGA–3′ |
| Yak caspase 3 real-time AS | 5′–CAGCACAAACATCACAAAACCA–3′ | |
| 207 bp | Yak β-actin real-time S | 5′–AGGCTGTGCTGTCCCTGTATG–3′ |
| Yak β-actin real-time AS | 5′–GCTCGGCTGTGGTGGTAAA–3′ |
