Chickens evolved to lay eggs in nests, with the incubation process occurring in the presence of the previous generation. Hens are responsible for supplying heat, controlling the moisture environment, and rotating eggs. As a result, fertile eggs have close contact with a hen's microbiota, and newly hatched birds encounter a rich and diverse microbial environment from which they acquire their own intestinal microbiota. However, hatching has been automated to maximize commercial poultry production and limit disease transmission; this automation has resulted in newly hatched chicks that have limited contact with a hen's microbiota and delayed development of their own microbiota. Furthermore, modern commercial poultry breeds have been subjected to extensive genetic selection, which has made it possible to produce a bird for slaughter in < 6 weeks. The starter phase, which was not particularly important among the phases for chickens in the early 1950s, currently is a critical phase for enhancing production efficiency.1–3 Any delay in the establishment of the intestinal microbiota provides opportunities for pathogen colonization and may adversely affect growth performance.4
Chicks have an intestinal microbiota when they are delivered from a hatchery to a farm.5 This may primarily consist of environmental microbes and is probably a result of intensive handling during the interval between hatching and farm placement.6 This early microbiota can affect the establishment of beneficial bacteria because the intestinal microbiota is being modified by transient colonizers.7 To better colonize the intestines of chicks with a beneficial microbiota, commercial products have been developed for administration to 1-day-old chicks at poultry farms.4,8,9 The most efficacious of these products for competitively excluding pathogens are produced from adult birds; their microbial composition is relatively undefined, which reduces their commercial availability in some countries.10
It has been hypothesized that intestinal microbiota could be introduced into embryonating eggs to help establish a chick's early intestinal microbiota.6,11 In other species, early introduction of some bacterial species influences development of the microbiome, improves resistance to pathogens, and improves intestinal development and absorption of nutrients.12–16 These bacteria are considered pioneer colonizers because of their effects on host development. We hypothesized that in ovo inoculation of pioneer colonizers within an egg could improve the development of a chick and its intestinal microbiota after hatching. In addition, we compared results for 2 genetic lineages of poultry (a modern lineage and a heritage lineage) to evaluate whether the microbiota of these breeds would respond differently as a result of coevolution of the host and its microbiota.17–19 This information could facilitate manipulation of the microbiota during the early phase of chick development with the goal of producing a bird with better intestinal health and growth performance.
Materials and Methods
Sample
Ten newly hatched chicks and 40 fertile eggs were used to determine the intestinal microbiota of newly hatched chicks. In another experiment, 900 fertile eggs were inoculated with an intestinal microbiotic product to assess effects on hatchability. Finally, 1,560 chicks of 2 genetic strains (780 chicks of a modern lineage [Cobb500] and 780 chicks of a heritage lineage [Athens Canadian Random Bred]) of various age after hatching were used to assess effects of the probiotic on development of the intestinal microbiota of chickens. All experiments were reviewed and approved by the University of Georgia Animal Use Committee and were performed in compliance with guidelines of appropriate federal entities.
Microbiota of newly hatched chicks
Ten newly hatched chicks from a commercial hatchery were used to determine the status of the intestinal microbiota at the time of placement to a farm. Chicks were obtained from transport boxes at the time of delivery to a farm and before they had contact with water, food, or litter material. Chicks were placed in a sterile container and transported to the Poultry Diagnostic and Research Center. Chicks were euthanized by means of cervical dislocation. Samples of cecal contents were collected by use of decontaminated, sterile surgical tools, which had been prepared prior to use. Surgical tools were cleaned with soap, soaked in 30% bleacha for 30 minutes to destroy environmental DNA (decontamination), packaged individually, and sterilized in an autoclave. Cecal contents for the 10 chicks were pooled and stored frozen at −20°C until further processing.
Forty fertile (embryonating) eggs were obtained from the same commercial hatchery and incubated in a sanitized hatching cabinet at the Poultry Diagnostic and Research Center. Cecal contents were collected from embryos at days 18 and 20 of incubation and from chicks at 12 hours after hatching but prior to access to water and food (10 samples/time point). The remaining 10 eggs were disposed. Eggs were chemically disinfected with 30% bleach for 30 minutes to remove surface bacteria and inactivate bacterial DNA on the shell surface. Embryos were placed in sterile disposable Petri dishes, and samples of cecal contents were collected by use of decontaminated, sterile surgical tools. A new sterile surgical blade was used for each cecum; 10 samples were collected at each time point, pooled and homogenized, then divided into 2 portions. One portion was immediately assayed to determine bacterial viability. The other portion was fixed in PBS solution (137mM NaCl,b 2.7mM KCl,b 10mM Na2HPO4,b and 1.8mM KH2PO4b [pH, 7.0]) containing paraformaldehydeb (4%) at 4°C for use in fluorescence in situ hybridization analysis. During tissue collection, an open centrifuge tube containing 15 mL of PBS solution was used as a negative control sample to evaluate the contribution of air contamination during processing of the samples.
Detection of viable bacteria—Viability staining of cecal tissues and contents of embryos and chicks was used to differentiate live bacteria with intact cell membranes from permeabilized and dead bacteria. Bacteria were evaluated with a bacterial viability kitc used in accordance with the manufacturer's instructions. Escherichia coli 1932 was used as a positive control sample. Samples were fixed on glass slides, embedded in mounting oil, and examined microscopically by use of a microscoped equipped with a halogen lamp, a 470- to 490-nm excitation filter, and a 520-nm barrier filter.
Fluorescence in situ hybridization—Samples of cecal tissues collected from embryos at days 18 and 20 of incubation and from chicks 12 hours after hatching were fixed in PBS solution containing paraformaldehyde (4%) and embedded in paraffin. Tissues were cut at a thickness of 4 μm and fixed to a coated slide, heated at 60°C, and deparaffinized in xylene.b Escherichia coli 1932 cells heat-fixed on a coated slide were used as a positive control sample. Samples were hydrated in a graded series of ethanolb solutions (100%, 80%, and 50%) by incubation in each solution for 3 minutes; samples then were washed twice in PBS solution (3 min/wash) and permeabilized with proteinase Kb (100 μg/mL). Proteinase K was inactivated by incubation with 0.2% glycineb in PBS solution for 3 minutes; samples then were washed twice in PBS solution and dehydrated by use of a graded series of ethanol solutions (50%, 80%, and 100%). Blocking was performed by incubation for 30 minutes with 2X SSC (20X stock solution consisting of 3M NaCl and 0.3M sodium citrateb [pH, 7.5]) containing yeast tRNAe (0.25 μg/mL). Then, 50 μL of 2X SSC containing 1 ng of probe/µL was added to sections. A fluorescent-labeledf unibacterial probe (5′-GCTGCCTCCCGTAG-GAGT-3′) for total bacteria20 and an antisense probe (5′-ACTCCTACGGGAGGCAGC-3′) as a negative control sample21 were used. A coverslip was then affixed (rubber cement) over each section. The DNA on the slides was denatured at 95°C for 10 minutes, and hybridization was performed by incubation overnight in a humidified chamber at 65°C. Unbound probe was removed by washing at 37°C with 2X SSC followed by washing with 1X SSC (10 min/wash). Finally, slides were washed with 0.3X SSC at 65°C and then with 0.03X SSC at 65°C (10 min/wash). Slides were covered with mounting fluid,g and cells were assessed by use of fluorescence microscopy. Images were acquired with a charge-coupled digital camerah and the camera manufacturer's software.
Detection of bacteria by use of species-specific primers in a PCR assay—To determine the presence of potential pathogens within the cecal contents of newly hatched chicks, specific primers for Salmonella spp, E coli, Campylobacter spp, and Clostridium spp were used22–24 (Appendix). The DNA was extracted from cecal samples by use of a commercial kit.i The PCR assay was conducted in a reaction containing 50mM tris (pH, 8), 2.0mM MgCl2, 0.2mM deoxynucleoside triphosphates, 1μΜ of each primer, 0.05 U of Taq DNA polymerase,j and 25 ng of DNA (final reaction volume, 25 μL). Initial DNA denaturation was performed at 94°C for 3 minutes. This was followed by 35 cycles of denaturation at 94°C for 30 seconds, annealing at 60°C for 1 minute, and elongation at 68°C for 2 minutes. Finally, there was 1 cycle at 68°C for 7 minutes. Reactions were performed in an air thermocycler.k The PCR products were developed by use of agarose gel (1.5%) electrophoresis with a fluorescent dye.l
Viability of a probiotic product and effects on hatchability of eggs
A commercial competitive-exclusion product4,m consisting of intestinal microbiota derived from mature chickens was used. A sample (100 μg) of the commercial product was homogenized in PBS solution (1 part product:10 parts PBS solution [wt:vol]) and divided into 3 aliquots that served as replicates. Counts of total and viable bacteria were obtained by use of a viability stain.c The numbers of viable and nonviable bacteria were estimated from counts of 5 large blocks of a Neubauer chamber; counts were conducted for 2 replicates. Sterile water was used as a negative control sample. Fluorescence microscopy was used to evaluate bacteria as described previously. The number of bacteria per milliliter of sample was calculated by use of the following equation: T = N•A/(a/V), where T is the number of bacteria per milliliter, N is the mean number of bacteria, A is the dilution factor, a is the number of squares counted, and V is the volume of each square of the Neubauer chamber.
Nine hundred fertile eggs obtained from commercial broiler breeders were inoculated with the probiotic product to assess hatchability. The experiment was performed as 2 replicates for each treatment (50 eggs/replicate [100 eggs/treatment]). At day 18 of incubation, embryonic viability was determined by use of candling (observation of intact vasculature). Fertile eggs were inoculated with various doses of the probiotic product (2.6 × 108 viable bacteria/egg, 1.3 × 108 viable bacteria/egg, 6.7 × 107 viable bacteria/egg, 3.3 × 107 viable bacteria/egg, 3.3 × 106 viable bacteria/egg, or 3.3 × 105 viable bacteria/egg). There were 2 control groups (uninoculated eggs and eggs inoculated with saline [0.9% NaCl] solution). Each injection (0.1 mL) was administered into the amnion with a 21-gauge needle. Eggs were placed in a hatchery incubator after inoculation. Hatchability was defined as the ratio of the number of hatched chicks to the number of viable eggs inoculated at day 18 of incubation. Postmortem examination was performed on eggs that did not hatch, and the stage at which embryonic death occurred was determined.
In ovo inoculation with the probiotic product
Fertile eggs (n = 1,560) were obtained from 2 commercial broiler breeders (780 were of a modern lineage [Cobb500] and 780 were of a heritage lineage [Athens Canadian Random Bred]). All eggs were incubated in the same incubator. At day 18 of incubation, 0.1 mL of saline solution containing 3.3 × 105 viable bacteria of the probiotic product was inoculated into the amniotic fluid of 780 eggs (390 eggs of each genetic lineage); the remaining 780 uninoculated eggs (390 uninoculated eggs/lineage) represented control groups. An aliquot of the product used to inoculate fertile eggs was frozen at −20°C for later evaluation.
After eggs were inoculated, they were placed back into the incubator and allowed to hatch (day 0 = 12 hours after hatching). Then, 32 newly hatched chicks (16 for each lineage [8 from inoculated eggs and 8 from uninoculated eggs]) were selected arbitrarily. These chicks were collected prior to access to water, food, or litter material. Remaining chicks were distributed on the basis of lineage and in ovo treatment into 8 pens or floor cages. Chicks of the modern lineage were reared in floor pens for 42 days. Chicks of the heritage lineage were raised in cages because these chickens retain the ability to fly; these chicks were reared for only 30 days. Stocking density in each pen or cage was similar to that of a commercial flock. Chicks received a diet based on soy meal and corn that did not contain antimicrobials or coccidiostats; diets were available ad libitum. One chick from each pen or cage was selected arbitrarily at day 7 and at the end of the rearing period (n = 16 chicks/time period). The remaining birds were euthanized at the end of the experimental period.
Chicks were euthanized by means of cervical dislocation. Samples of cecal contents were collected from each chick as described previously. Samples for each treatment in each lineage at each time point were pooled and stored frozen at −20°C until further processing.
Construction and analysis of 16S pyrosequencing libraries
The 6 pooled cecal samples for each of the treatments in each lineage at each time point and the previously collected sample of the probiotic product were subjected to DNA isolation by use of a commercial extraction kit, as described elsewhere.25 The DNA was subjected to initial denaturation at 95°C for 3 minutes. Amplification of the V3-V6 regions of the bacterial 16S rRNA genes was then achieved by 20 cycles of denaturation at 94°C for 30 seconds, annealing at 60°C for 30 seconds, and extension at 68°C for 60 seconds. Final extension was at 68°C for 4 minutes. Bacterial primers were E coli 515R-NK26 and the 7-fold-degenerate primer E coli 27F YM + 3.27 For purposes of pyrosequencing, primers were synthesized with an adaptor or an adaptor and a barcode (ie, adaptor-primer or adaptor-barcode-primer); for each DNA sample, a specific 8-nucleotide barcoden was used.28 The DNA extracted from Bacteroides fragilis ATCC 25285, Clostridium perfringens ATCC 13124, and Lactobacillus gasseri ATCC 33323 was used as control samples to test for errors during PCR amplification and pyrosequencing.
The PCR reactions were performed by use of an air thermocycler.k The PCR products were assessed by electrophoresis on 1% agarose gels; amplicons were stained with fluorescent dye and excised from the gels. Amplicons obtained from 3 replicates of the same sample were pooled to reduce amplification bias. Amplicons from the agarose gel were initially purified by use of a commercial gel extraction kito and then by a process that involved the use of magnetic beads.p Amplicons were resuspended in deionized water, and concentrations of each sample were determined with a spectrophotometer. Barcoded 16S amplicon samples were submitted to the University of Georgia Genomics Facility for pyrosequencing in accordance with established methods.
Phylogenetic composition of the product used to inoculate the eggs was assessed through use of a large-scale pyrosequencing 16S rDNA library. The OTUs (taxonomic term used to denote species when DNA sequences are used for detection and classification) were calculated. On the basis of these data, the Chao diversity index, Simpson diversity index, and Shannon diversity index were calculated. The Chao index estimated the number of species (OTUs) comprising the microbiota, and the Shannon index estimated the biodiversity on the basis of the uniformity of the sequences among the various OTUs.29
Data analysis
Bacterial viability data were analyzed by use of an ANOVAq and compared by use of the Tukey test.30 Hatchability was analyzed by use of frequency counts and cross-tabulation tablesr and compared by use of χ2 tests, whereby each egg was considered as 1 replicate. Analysis of 16S rRNA sequences was performed with open-source phylogenetic software.31,s Good-quality sequences were aligned by use of an rRNA gene databaset and further filtered. The 16S sequences were loaded on a metagenomics analysis server32,u to generate tables for genus and species frequencies with 97% similarity. Distances were calculated on preclustered sequences, and OTUs were formed by use of the average neighbor method. The Libshuff algorithm was used to estimate differences between pyrosequencing libraries. Statistical analyses related to the frequency of specific sequences representing microorganisms in samples were conducted with an ANOVA. Statistical analysis related to frequency-specific bacterial sequences in samples was analyzed by use of frequency counts and cross-tabulation tablesr and compared by use of χ2 tests. Values were considered significantly different at P ≤ 0.05.
Results
Intestinal microbiota of newly hatched chicks
Chicks were collected directly from transport boxes and did not have access to litter material, food, or water. Use of PCR assays targeting specific species of bacteria revealed that the cecal microbiota of newly hatched modern lineage chicks contained Clostridium spp, E coli, and Salmonella spp Figure 1). Because of several decades of evidence of vertical transmission of pathogens such as Salmonella enterica serovar Pullorum from broiler breeders to their progeny,33–35 we evaluated the presence and viability of microorganisms within the intestinal tract of chicks before and immediately after hatching. Microscopic evaluation of slides containing cecal tissues and contents subjected to differential staining techniques, 16S rRNA in situ hybridization, and viability staining revealed particles consistent with the size and shape of bacteria within the embryonic cecum at 18 days of incubation (Figure 2). These data indicated that chick embryos may contain viable bacteria prior to hatching.
Results of PCR assay for detection of Campylobacter spp (A), Clostridium spp (B), Escherichia coli (C), and Salmonella spp (D) within the cecum of newly hatched commercial broiler chicks. Chicks were obtained from a commercial farm. At the time of placement from the hatchery, the ceca were aseptically removed, and DNA was extracted. Lanes were as follows: M = 100-bp DNA molecular-weight marker, S = pooled cecal sample, + = bacterial positive control sample, and – = PCR assay contamination control sample that contained no DNA template. Numbers on the left side of each panel indicate the size of the DNA fragment in bp.
Citation: American Journal of Veterinary Research 77, 5; 10.2460/ajvr.77.5.514
Photomicrographs of a culture of Escherichia coli (control sample) and cecal contents and tissues obtained from chick embryos at days 18 and 20 of incubation and from chicks 12 hours after hatching (day of hatching). A live-dead stain (top row) and fluorescence in situ hybridization with a unibacterial fluorescent-labeled probe (middle row) and a negative control antisense probe (bottom row) were used to determine bacterial viability. Notice the particles consistent with the size and shape of bacteria (arrows). Bar = 10 μm.
Citation: American Journal of Veterinary Research 77, 5; 10.2460/ajvr.77.5.514
Viability of a probiotic product and effects on hatchability of eggs
Bacterial viability of the product was assessed to determine the number of viable cells inoculated into fertile eggs. Viability staining revealed that 75.6 ± 6.8% cells were viable. Inoculation of 3.3 × 106 viable bacteria/egg to 2.6 × 108 viable bacteria/egg caused embryonic death; however, inoculation of 3.3 × 105 viable bacteria/egg resulted in hatchability similar to that for the uninoculated group and the saline solution–inoculated group (Figure 3).
Mean ± SD hatchability of fertile eggs inoculated at day 18 of incubation with various doses of a commercial probiotic competitive-exclusion product. Hatchability was defined as the ratio of the number of hatched chicks to the number of viable eggs inoculated at day 18 of incubation. *Inoculated with saline (0.9% NaCl) solution.
Citation: American Journal of Veterinary Research 77, 5; 10.2460/ajvr.77.5.514
Composition of the probiotic product
After removal of poor-quality sequences, homopolymers, and chimeras, 35,713 sequences with good quality were obtained. There were 430 OTUs at the level of 97% similarity, which provided an estimate of 430 species comprising the probiotic. By use of this data, values for the Chao, Simpson, and Shannon diversity indices were calculated to be 702.400, 2.849, and 0.139, respectively. The most abundant bacterial group detected was Clostridia, with Peptostreptococcus anaerobius as the dominant species in the probiotic product (Figures 4 and 5).
Pie chart of the distribution for bacteria detected in a commercial probiotic competitive-exclusion product used for in ovo inoculation. Results were determined from a 16S rDNA library (n = 35,713 sequences) created by use of a sample of the product.
Citation: American Journal of Veterinary Research 77, 5; 10.2460/ajvr.77.5.514
Graph depicting the prevalence for the most common bacterial species detected in a commercial probiotic competitive-exclusion product. Results represent the taxonomic distribution for a 16S rDNA library (n = 35,713 sequences) created by use of a sample collected from the product. Percentages were calculated as follows: percentage = (sequences for a specific bacterial species/total number of sequences) × 100.
Citation: American Journal of Veterinary Research 77, 5; 10.2460/ajvr.77.5.514
In ovo inoculation of the probiotic product
To determine effects of the probiotic on the microbiota of chicks of modern and heritage lineages, 12 pyrosequencing libraries were analyzed. There were 163,010 sequences with good quality obtained (Table 1). Newly hatched modern lineage chicks from eggs that were not inoculated had an intestinal microbiota with a significantly lower number of OTUs and smaller Chao index, compared with results for newly hatched modern lineage chicks from eggs that were inoculated in ovo with probiotic; the same pattern was detected for 7-day-old chicks. Newly hatched and 7-day-old heritage lineage chicks from eggs that were not inoculated had a significantly higher Chao index than did heritage lineage chicks of the same ages that hatched from eggs inoculated in ovo with the probiotic. However, 30-day-old heritage lineage chicks had a higher number of OTUs and a higher Chao index when probiotic was administered in ovo, which indicated that the microbiota could be influenced over time by in ovo inoculation.
Number of sequences, number of 16S rDNA OTUs with 97% similarity, and results of diversity indices for samples of cecal contents collected from 96 chicks (n = 8/treatment) at various ages after hatching that were not inoculated (control treatment) or that were inoculated in ovo with a probiotic competitive-exclusion product.
| Lineage | Age (d) | Treatment | No. of sequences | No. of OTUs | Chao index | Shannon index |
|---|---|---|---|---|---|---|
| Modern | 0 | Control | 16,052 | 35 | 92.0 | 1.259 |
| Probiotic in ovo | 13,789 | 91* | 269.8* | 1.562 | ||
| 7 | Control | 5,560 | 285 | 503.3 | 4.422 | |
| Probiotic in ovo | 35,219 | 854* | 1,441.5* | 4.405 | ||
| 42 | Control | 11,065 | 740 | 1,107.5 | 4.939 | |
| Probiotic in ovo | 11,485 | 693 | 1,154.1 | 4.995 | ||
| Heritage | 0 | Control | 6,010 | 25 | 57.9 | 1.208 |
| Probiotic in ovo | 8,944 | 24 | 26.6* | 1.182 | ||
| 7 | Control | 10,456 | 162 | 297.0 | 3.051 | |
| Probiotic in ovo | 9,357 | 137 | 188.2* | 2.897 | ||
| 30 | Control | 13,576 | 564 | 875.2 | 4.401 | |
| Probiotic in ovo | 21,497 | 663† | 1,086.8* | 4.423 |
Day 0 = 12 hours after hatching.
Within a column within a day, value differs significantly (P < 0.001) from the value for the control treatment.
Within a column within a day, value differs significantly (P = 0.005) from the value for the control treatment.
Overall diversity (total number of OTUs at 97% similarity) was compared by the construction of rarefaction curves that depict the frequency with which various sequences are detected within the pyrosequencing library by means of a resampling without replacement approach (Figure 6). It also allows a prediction of species richness in each sample. Overall diversity and richness of the intestinal microbiota were lower in heritage lineage chicks than in modern lineage chicks. However, the species diversity was increased by in ovo inoculation of the probiotic product for both lineages. Intestinal microbiota of in ovo–inoculated modern lineage chicks had a composition that differed significantly from that of control modern lineage chicks at days 0 (P < 0.001) and 7 (P = 0.03). In ovo–inoculated and uninoculated heritage lineage chicks did not have significant differences in microbiota composition at day 7. Significant (P < 0.001) differences were detected between in ovo–inoculated and uninoculated chicks of the heritage lineage on day 0 and on day 30; however, composition of the bacterial populations in the probiotic product was significantly different from the microbiotas detected in the modern and heritage lineage chicks at all time points.
Rarefaction curves depicting the frequency of bacterial 16S rRNA gene OTUs (bacterial species) at 97% similarity for cecal contents collected from chicks of a heritage lineage (gray lines) and a modern lineage (black lines) that were inoculated in ovo with a probiotic competitive-exclusion product (solid lines) or were not inoculated (dotted lines).
Citation: American Journal of Veterinary Research 77, 5; 10.2460/ajvr.77.5.514
The microbiota of newly hatched chicks was dominated by 2 bacterial phyla, Firmicutes and Proteobacteria. By day 7, the abundance of Bacteroidetes and Actinobacteria increased, and at the final time point, the microbiota was primarily dominated by Firmicutes and Bacteroidetes. In ovo administration of the probiotic decreased the amount of Proteobacteria in newly hatched chicks and increased the amount of Bacteroidetes at day 7 in heritage lineage chicks (Figure 7). The ratio between Firmicutes and Bacteroidetes in the microbiota of chicks at the final time point differed for chicks administered probiotic in ovo, compared with the ratio for the control groups. The Firmicutes-to-Bacteroidetes ratio was 4.87 and 5.15 in the microbiota of in ovo-inoculated and control heritage lineage chicks, respectively. The Firmicutes-to-Bacteroidetes ratio was 3.81 and 5.34 in the microbiota of in ovo-inoculated and control modern lineage chicks, respectively.
Stacked bar charts of the distribution of phyla detected in a 16S rDNA pyrosequencing library created by use of cecal contents collected from modern lineage (A and B) and heritage lineage (C and D) chicks that were not inoculated in ovo (A and C) or were inoculated in ovo with a probiotic competitive-exclusion product (B and D). Day 0 = 12 hours after hatching.
Citation: American Journal of Veterinary Research 77, 5; 10.2460/ajvr.77.5.514
Ninety-six genera of bacteria were detected in the microbiota of heritage and modern lineage chicks in the control groups. Fifty-four genera were detected in both lineages, but some genera were exclusive to only the microbiota of modern (n = 13 genera) or heritage (29) lineage chicks. In ovo administration of probiotic resulted in an increase in the number of bacterial genera shared by both lineages. Modern and heritage lineage chicks inoculated in ovo with probiotic had 69 bacterial genera in common; 10 and 30 genera were detected in the microbiota of only modern and heritage lineage chicks, respectively.
Abundance of bacteria contributing > 1% of the sequences within the pyrosequencing library was analyzed. Immediately after eggs hatched (day 0), the cecal microbiota of modern lineage chicks was dominated by Enterococcus spp, Enterobacteriaceae, and Pelotomaculum spp (Clostridia class; Figure 8). At day 7, the composition evolved to include Lutispora spp and Dethiosulfatibacter spp, both of which are members of the Clostridia class. In ovo-inoculated chicks had Lutispora spp and Dethiosulfatibacter spp in their ceca immediately after hatching. At the end of the rearing period, the in ovo–inoculated chicks had a greater abundance of Bacteroidetes and Clostridia (Lutispora spp, Blautia spp, Pelotomaculum spp, and Faecalibacterium spp); however, Lactobacillus spp and the Bacteroidetes Prevotella spp and Alistipes spp were detected in smaller amounts than in the uninoculated chicks.
Stacked bar charts of the distribution of bacterial species detected in a 16S rDNA pyrosequencing library created by use of cecal contents collected from modern lineage chicks that were not inoculated in ovo (A) or that were inoculated in ovo with a probiotic competitive-exclusion product (B). Day 0 = 12 hours after hatching. In the legend, the organisms are listed in the order in which they appear in the bars within each graph (the first organism in the list in the column on the left is at the top of the bar on the left, and the last organism in the list in the column on the right is at the bottom of the bar on the right).
Citation: American Journal of Veterinary Research 77, 5; 10.2460/ajvr.77.5.514
In ovo–inoculated heritage lineage chicks had a higher percentage of sequences representing Enterococcus spp in the cecal microbiota on day 0 (Figure 9). Enterobacteriaceae and Pelotomaculum spp were detected in the lowest amounts. Bacteroides spp were observed in the microbiota of 7-day-old chicks that received probiotic in ovo. At the end of the rearing period, bacterial genera representing > 1% of the sequences were Bacteroidetes and the Clostridia Alistipes spp, Blautia spp, Sporobacterium spp, Syntrophococcus spp, and Pelotomaculum spp in in ovo–inoculated chicks. Lactobacillus spp and Faecalibacterium spp were in greater abundance in chicks of the control group.
Stacked bar charts of the distribution of bacterial species detected in a 16S rDNA pyrosequencing library created by use of cecal contents collected from heritage lineage chicks that were not inoculated in ovo (A) or that were inoculated in ovo with a probiotic competitive-exclusion product (B). Day 0 = 12 hours after hatching. See Figure 8 for remainder of key.
Citation: American Journal of Veterinary Research 77, 5; 10.2460/ajvr.77.5.514
Matching OTUs in the commercial product with those in cecal samples collected at days 0, 7, and 42 from in ovo–inoculated modern lineage chicks was used to determine whether bacteria from the probiotic colonized the chicks (Figure 10). There were 25 OTUs in common between the product and cecal samples collected from in ovo–inoculated newly hatched chicks. The common sequences included Lutispora spp (8 OTUs), Enterococcus spp (4 OTUs), Pelotomaculum spp (2 OTUs), Blautia spp (2 OTUs), Bacteroides spp (1 OTU), Dethiosulfatibacter spp (1 OTU), Enterobacteriaceae (2 OTUs), Lactobacillus spp (1 OTU), Eubacterium spp (2 OTUs), and Negativicoccus spp (2 OTUs). There were only 10 OTUs in common between the product and in ovo–inoculated newly hatched chicks and 7-day-old chicks. Shared species related to Lutispora spp detected at day 0 were not detected at day 7, for which the prevalent sequences were Enterococcus spp (2 OTUs), Pelotomaculum spp (1 OTU), Blautia spp (2 OTUs), Bacteroides spp (1 OTU), Dethiosulfatibacter spp (1 OTU), Enterobacteriaceae (1 OTU), Lactobacillus spp (1 OTU), and Eubacterium spp (1 OTU). There were 7 OTUs in common between the product and samples obtained at days 0, 7, and 42: Enterococcus spp (1 OTU), Pelotomaculum spp (1 OTU), Blautia spp (2 OTUs), Bacteroides spp (1 OTU), Dethiosulfatibacter spp (1 OTU), and Enterobacteriaceae (1 OTU).
Venn diagrams of the shared and unique OTUs (bacterial species) detected in cecal contents collected from modern lineage (A) or heritage lineage (B) chicks of various ages (0, 7, 30, or 42 days; day 0 = 12 hours after hatching) that were inoculated in ovo with a probiotic competitive-exclusion product and for a sample of the product (Probiotic). Numbers in parentheses indicate the number of OTUs.
Citation: American Journal of Veterinary Research 77, 5; 10.2460/ajvr.77.5.514
In addition, the persistence of probiotic bacteria for newly hatched in ovo–inoculated heritage lineage chicks was evaluated (Figure 10). At day 0, there were 9 OTUs in common between the product and treated chicks, which included Enterococcus spp (5 OTUs), Staphylococcus spp (1 OTU), Pelotomaculum spp (1 OTU), Dethiosulfatibacter spp (1 OTU), and Enterobacteriaceae (1 OTU). At day 7, there were 4 OTUs in common between samples collected at days 0 and 7, which included Enterococcus spp (2 OTUs), Dethiosulfatibacter spp (1 OTU), and Enterobacteriaceae (1 OTU). At the end of rearing, there was only one OTU related to Dethiosulfatibacter spp and another related to Enterobacteriaceae in common among all samples. This indicated that although organisms from the probiotic product may have colonized the intestinal tract of the chicks, development of the microbiota was a dynamic process throughout development of the chicks.
Discussion
Animals develop a symbiotic relationship with a specific array of prokaryotes.36 Because this microbial population can persist from generation to generation, it has been hypothesized that animals have coevolved with their microbiota, and the speciation of an animal host has been accompanied by the divergent association of its microbiota.17 This phenomenon has been clearly established by use of DNA sequence analysis of bacteria acquired from various host animals.37–40 It is especially clear in poultry, where the pressure for breeding of heavy animals with outstanding energy efficiency during the past 50 years has resulted in modern lineage birds with specific microbiota, compared with those of heritage lineage birds.41 Consistent with results of previous studies,33–35,42–45 we detected viable microorganisms within the ceca of embryos, and these bacteria would be seed microorganisms for the intestinal microbiota of newly hatched chicks. Modern lineage chicks had a more diverse microbiota, compared with the microbiota of heritage lineage chicks. Evolutionary forces on both the host and microbiome are thought to be important for shaping diversity of the intestinal tract.46–50 Ecological theory suggests that for group selection to take place, the resident community must occasionally be transferred to a new habitat.51 A new habitat was likely created by genetic selection that focused on a line of chickens with improved growth performance. Modern lineage chickens have desirable body phenotypes for commercial production and potentially more nutritionally efficient microbiota, compared with those for heritage lineage chickens.
Interactions between bacteria and host tissues must be managed to reduce the effects of pathogens17; management of these interactions could be accomplished by the use of bacterial products derived from mature animals.4 The presence of pathogens in newly hatched chicks may modify the intestinal environment with inflammation of the intestinal tissue.52 However, these organisms may also delay or prevent the acquisition of a beneficial microbiota because they may occupy crucial early ecological niches. Neonatal chicks possess a microbiota with low diversity that is not effective for competitive exclusion of undesirable microorganisms. In the study reported here, we hypothesized that in ovo inoculation of beneficial microorganisms could create a more diverse microbiota capable of filling diverse intestinal niches and resisting colonization by pathogens. Chicks from eggs inoculated in ovo with the probiotic competitive-exclusion product had an increase in microbial diversity. In addition, the product reduced the abundance of Enterobacteriaceae, the family of organisms that includes Salmonella spp and E coli.
The probiotic product used in the present study was selected on the basis of studies4,9,53 that confirmed its ability to competitively exclude Salmonella spp and improve intestinal health. Clostridia were the major class of bacteria detected in this commercial product and are the most abundant component of chicken cecal microbiota.54,55 The product was developed by use of cecal samples collected from a flock of healthy Salmonella-free chickens.4 Clostridium butyricum was one of the abundant constituents, and it has been tested as a probiotic for use in broiler chickens.56 Many clostridial species (eg, P anaerobius) have the ability to produce butyrate,57,58 which is a short-chain fatty acid that can be used as an energy source by intestinal cells and has been related to good intestinal health.59,60 Enterococcus cecorum was detected within the probiotic product; it can be a pathogen and cause lumbar osteomyelitis in poultry.61,62 However, it is also a member of the normal intestinal microbiome of healthy chickens.62
The probiotic product was effective for increasing the establishment of some genera within the intestines of newly hatched modern lineage chicks. Therefore, it acted as a source of pioneer colonizers, which augment the development of a complex microbiota by modifying the intestinal environment. The first organisms to colonize the intestines determine the composition of the climax microbiota by creating a microenvironment necessary for development of a complex microbiota.63 Pioneer colonizers reduce the succession of transient species within the intestinal microbiota and maintain stability of a favorable microbiota,64 thereby reducing pathogenic colonization and positively affecting host intestinal development. In the present study, newly hatched heritage lineage chicks inoculated in ovo had a microbiota that differed from that of the control group; however, the probiotic competitive-exclusion product did not appear to efficiently colonize the ceca of these chicks. Fewer bacterial species were persistent within the ceca of newly hatched heritage lineage chicks, compared with the number of persistent bacterial species in the ceca of newly hatched modern lineage chicks. However, the microbiota of heritage lineage chicks exhibited increased diversity, which indicated that although the composition of the product may not have been ideal for this lineage, it was capable of altering the development of the microbiota. The probiotic was derived from mature modern lineage chickens, and it is possible that genetic differences among poultry breeds may have resulted in differences in the intestinal habitats. There was early establishment of Bacteroidetes in the intestines of in ovo–inoculated heritage lineage chicks. Bacteroidetes are believed to complement eukaryotes by providing degradation enzymes that target resistant dietary polymers, such as plant cell wall components.65 The interaction between Bacteroidetes and a host is known to be mutualism rather than commensalism because there is an increase in the fitness of both partners.66 Furthermore, in ovo inoculation increased the proportion of Firmicutes and Bacteroidetes within the older chicks, which is a characteristic that has been correlated with improved energy recovery from diets.67–69
A better intestinal microbiota could promote intestinal health. Bacteroides spp can promote the development of intestinal mucosa, mesenteric nerves, and the secretory immune system, whereas Blautia spp is found to be less abundant in humans with digestive disorders.70,71 In older birds, more bacterial genera related to Bacteroides spp and Blautia spp were detected in both chicken lineages. The evolutionary principles that drive the ecological composition of metaorganisms are not currently known. Microorganisms do not live in isolation. They have evolved, and continue to evolve, in the context of complex microbiota and specific environmental conditions. The intestinal tract is an intricate environment, and in ovo introduction of exogenous bacterial species could affect the composition and function of the microbiota. In the study reported here, bacteria in a competitive-exclusion probiotic product administered in ovo acted as pioneer colonizers and changed the composition of the climax microbiota. However, many of the species that comprised the product were transient in the intestines of the chicks. Thus, the use of such products in ovo could augment early establishment of a beneficial microbiome in poultry and could represent a strategy for preventing intestinal colonization by pathogens and improvement of productive indexes such as feed efficiency and weight gain.
Acknowledgments
Supported by the USDA (USDA NIFA 2009-03561 [Lee]) and by USDA Formula Funds (Pedroso).
The authors declare that there were no conflicts of interest.
ABBREVIATIONS
| ATCC | American Type Culture Collection |
| OTU | Operational taxonomic unit |
| SSC | Saline-sodium citrate buffer |
Footnotes
Clorox bleach, The Clorox Co, Oakland, Calif.
Fisher Scientific, Waltham, Mass.
Live/Dead BacLight viability stain, Molecular Probes, Grand Island, NY.
Nikon Instruments, Melville, NY.
Life Technology, Grand Island, NY.
Cy3-labeled unibacterial probe Bact338, Integrated DNA Technologies, Coralville, Iowa.
Vectashield, Vector Laboratories Inc, Burlingame, Calif.
SPOT RT3, SPOT Imaging Solutions, Sterling Heights, Mich.
MoBio Laboratories, Carlsbad, Calif.
Roche Molecular Biochemicals, Indianapolis, Ind.
Rapidcycler, BioFire Diagnostics, Idaho Falls, Idaho.
Sybr Green, Invitrogen, Carlsbad, Calif.
Aviguard, Lallemand, Malvern, Worcestershire, England.
Provided by Dr. William Whitman, Department of Microbiology, Franklin College of Arts and Sciences, University of Georgia, Athens, Ga.
Qiagen QIAquick gel extraction kit, Qiagen, Valencia, Calif.
Agencourt AMpure magnetic beads, Beckman Coulter Inc, Brea, Calif.
PROC GLM, SAS, version 8.1, SAS Institute Inc, Cary, NC.
PROC FREQ, SAS, version 8.1, SAS Institute Inc, Cary, NC.
MOTHUR version 1.21.0, University of Michigan, Lansing, Mich.
Silva, Microbial Genomics and Bioinformatics Research Group, Celsiusstraβe, Bremen, Germany.
MG-RAST, Argonne National Laboratory, Argonne, Ill.
References
1. Farkhoy M, Modirsanei M, Ghavidel O, et al. Evaluation of protein concentration and limiting amino acids including lysine and met + cys in prestarter diet on performance of broilers. Vet Med Int 2012; 2012: 394189.
2. Longo FA, Menten JFM, Pedroso AA, et al. Diferentes fontes de proteína na dieta pré-inicial de frangos de corte. R Bras Zootec 2005; 34: 112–122.
3. Longo FA, Menten JFM, Pedroso AA, et al. Performance and carcass composition of broilers fed different carbohydrate and protein sources in the prestarter phase. J Appl Poult Res 2007; 16: 171–177.
4. Hofacre CL, Froyman R, Gautrias B, et al. Use of Aviguard and other intestinal bioproducts in experimental Clostridium perfringens-associated necrotizing enteritis in broiler chickens. Avian Dis 1998; 42: 579–584.
5. Pedroso AA, Menten JFM, Lambais MR. The structure of bacterial community in the intestines of newly hatched chicks. J Appl Poult Res 2005; 14: 232–237.
6. Edens FW, Parkhurst CR, Casas IA, et al. Principles of ex ovo competitive exclusion and in ovo administration of Lactobacillus reuteri. Poult Sci 1997; 76: 179–196.
7. Hooper LV, Falk PG, Gordon JI. Analyzing the molecular foundations of commensalism in the mouse intestine. Curr Opin Microbiol 2000; 3: 79–85.
8. Ferreira AJ, Ferreira CS, Knobl T, et al. Comparison of three commercial competitive-exclusion products for controlling Salmonella colonization of broilers in Brazil. J Food Prot 2003; 66: 490–492.
9. Nakamura A, Ota Y, Mizukami A, et al. Evaluation of Aviguard, a commercial competitive exclusion product for efficacy and after-effect on the antibody response of chicks to Salmonella. Poult Sci 2002; 81: 1653–1660.
10. Methner U, Barrow PA, Martin G, et al. Comparative study of the protective effect against Salmonella colonisation in newly hatched SPF chickens using live, attenuated Salmonella vaccine strains, wild-type Salmonella strains or a competitive exclusion product. Int J Food Microbiol 1997; 35: 223–230.
11. Maiorano G, Sobolewska A, Cianciullo D, et al. Influence of in ovo prebiotic and synbiotic administration on meat quality of broiler chickens. Poult Sci 2012; 91: 2963–2969.
12. Tomas J, Wrzosek L, Bouznad N, et al. Primocolonization is associated with colonic epithelial maturation during conventionalization. FASEB J 2013; 27: 645–655.
13. Olszak T, An D, Zeissig S, et al. Microbial exposure during early life has persistent effects on natural killer T cell function. Science 2012; 336: 489–493.
14. Buchon N, Broderick NA, Chakrabarti S, et al. Invasive and indigenous microbiota impact intestinal stem cell activity through multiple pathways in Drosophila. Genes Dev 2009; 23: 2333–2344.
15. Cherbuy C, Honvo-Houeto E, Bruneau A, et al. Microbiota matures colonic epithelium through a coordinated induction of cell cycle-related proteins in gnotobiotic rat. Am J Physiol Gastrointest Liver Physiol 2010; 299: G348–G357.
16. El Aidy S, van Baarlen P, Derrien M, et al. Temporal and spatial interplay of microbiota and intestinal mucosa drive establishment of immune homeostasis in conventionalized mice. Mucosal Immunol 2012; 5: 567–579.
17. McFall-Ngai MJ. Negotiations between animals and bacteria: the ‘diplomacy’ of the squid-vibrio symbiosis. Comp Biochem Physiol A Mol Integr Physiol 2000; 126: 471–480.
18. Kuechler SM, Gibbs G, Burckhardt D, et al. Diversity of bacterial endosymbionts and bacteria-host co-evolution in Gondwanan relict moss bugs (Hemiptera: Coleorrhyncha: Peloridiidae). Environ Microbiol 2013; 15: 2031–2042.
19. Hongoh Y, Deevong P, Inoue T, et al. Intra- and interspecific comparisons of bacterial diversity and community structure support coevolution of gut microbiota and termite host. Appl Environ Microbiol 2005; 71: 6590–6599.
20. Amann RI, Binder BJ, Olson RJ, et al. Combination of 16S rRNA-targeted oligonucleotide probes with flow cytometry for analyzing mixed microbial populations. Appl Environ Microbiol 1990; 56: 1919–1925.
21. Wallner G, Amann R, Beisker W. Optimizing fluorescent in situ hybridization with rRNA-targeted oligonucleotide probes for flow cytometric identification of microorganisms. Cytometry 1993; 14: 136–143.
22. Amit-Romach E, Sklan D, Uni Z. Microflora ecology of the chicken intestine using 16S ribosomal DNA primers. Poult Sci 2004; 83: 1093–1098.
23. Wang RF, Cao WW, Cerniglia CE. PCR detection and quantitation of predominant anaerobic bacteria in human and animal fecal samples. Appl Environ Microbiol 1996; 62: 1242–1247.
24. Denis M, Refregier-Petton J, Laisney MJ, et al. Campylobacter contamination in French chicken production from farm to consumers. Use of a PCR assay for detection and identification of Campylobacter jejuni and Camp. coli. J Appl Microbiol 2001; 91: 255–267.
25. Lu J, Hofacre C, Smith F, et al. Effects of feed additives on the development on the ileal bacterial community of the broiler chicken. Animal 2008; 2: 669–676.
26. Acosta-Martinez VSK, Dowd SE, Sun Y, et al. Tag-encoded pyrosequencing analysis of bacterial diversity in a single soil type as affected by management and land use. Soil Biol Biochem 2008; 40: 2762–2770.
27. Frank JA, Reich CI, Sharma S, et al. Critical evaluation of two primers commonly used for amplification of bacterial 16S rRNA genes. Appl Environ Microbiol 2008; 74: 2461–2470.
28. Hamady M, Walker JJ, Harris JK, et al. Error-correcting barcoded primers for pyrosequencing hundreds of samples in multiplex. Nat Methods 2008; 5: 235–237.
29. Hill TC, Walsh KA, Harris JA, et al. Using ecological diversity measures with bacterial communities. FEMS Microbiol Ecol 2003; 43: 1–11.
30. SAS. Procedures guide: statistical procedures. Cary, NC: SAS Institute Inc, 2008.
31. Schloss PD, Westcott SL, Ryabin T, et al. Introducing mothur: open-source, platform-independent, community-supported software for describing and comparing microbial communities. Appl Environ Microbiol 2009; 75: 7537–7541.
32. Aziz RK, Bartels D, Best AA, et al. The RAST server: rapid annotations using subsystems technology. BMC Genomics 2008; 9: 75.
33. Beach JR, Davis DE. Acute infection in chicks and chronic infection of the ovaries of hens caused by the fowl typhoid organisms. Hilgardia 1927; 2: 411–423.
34. Beaudette FR. The possible transmission of fowl typhoid through the egg: preliminary report. J Am Vet Med Assoc 1925; 67: 741–745.
35. Beaudette FR. Fowl typhoid and bacillary white diarrhoea, in Proceedings. 11th Int Vet Cong 1930; 3: 705–723.
36. McFall-Ngai MJ. The development of cooperative associations between animals and bacteria: establishing détente among domains. Am Zool 1998; 38: 593–608.
37. Ley RE, Lozupone CA, Hamady M, et al. Worlds within worlds: evolution of the vertebrate gut microbiota. Nat Rev Microbiol 2008; 6: 776–788.
38. McFall-Ngai MJ, Heath-Heckman EA, Gillette AA, et al. The secret languages of coevolved symbioses: insights from the Euprymna scolopes-Vibrio fischeri symbiosis. Semin Immunol 2012; 24: 3–8.
39. Ashen JB, Goff LJ. Molecular and ecological evidence for species specificity and coevolution in a group of marine algal-bacterial symbioses. Appl Environ Microbiol 2000; 66: 3024–3030.
40. Layton A, McKay L, Williams D, et al. Development of Bacteroides 16S rRNA gene TaqMan-based real-time PCR assays for estimation of total, human, and bovine fecal pollution in water. Appl Environ Microbiol 2006; 72: 4214–4224.
41. Lumpkins BS, Batal AB, Lee MD. Evaluation of the bacterial community and intestinal development of different genetic lines of chickens. Poult Sci 2010; 89: 1614–1621.
42. Cox NA, Richardson LJ, Maurer JJ, et al. Evidence for horizontal and vertical transmission in Campylobacter passage from hen to her progeny. J Food Prot 2012; 75: 1896–1902.
43. Donoghue AM, Blore PJ, Cole K, et al. Detection of Campylobacter or Salmonella in turkey semen and the ability of poultry semen extenders to reduce their concentrations. Poult Sci 2004; 83: 1728–1733.
44. Doyle MP, Erickson MC. Reducing the carriage of foodborne pathogens in livestock and poultry. Poult Sci 2006; 85: 960–973.
45. Okamura M, Tachizaki H, Kubo T, et al. Comparative evaluation of a bivalent killed Salmonella vaccine to prevent egg contamination with Salmonella enterica serovars Enteritidis, Typhimurium, and Gallinarum biovar Pullorum, using 4 different challenge models. Vaccine 2007; 25: 4837–4844.
46. Ley RE, Peterson DA, Gordon JI. Ecological and evolutionary forces shaping microbial diversity in the human intestine. Cell 2006; 124: 837–848.
47. Dillon RJ, Dillon VM. The gut bacteria of insects: nonpathogenic interactions. Annu Rev Entomol 2004; 49: 71–92.
48. Engel P, Moran NA. The gut microbiota of insects—diversity in structure and function. FEMS Microbiol Rev 2013; 37: 699–735.
49. Dethlefsen L, Eckburg PB, Bik EM, et al. Assembly of the human intestinal microbiota. Trends Ecol Evol 2006; 21: 517–523.
50. Dethlefsen L, McFall-Ngai M, Relman DA. An ecological and evolutionary perspective on human-microbe mutualism and disease. Nature 2007; 449: 811–818.
51. Wilson DS. A theory of group selection. Proc Natl Acad Sci U S A 1975; 72: 143–146.
52. Quinteiro-Filho WM, Gomes AV, Pinheiro ML, et al. Heat stress impairs performance and induces intestinal inflammation in broiler chickens infected with Salmonella Enteritidis. Avian Pathol 2012; 41: 421–427.
53. Pedroso AA, Hurley-Bacon AL, Zedek AS, et al. Can probiotics improve the environmental microbiome and resistome of commercial poultry production? Int J Environ Res Public Health 2013; 10: 4534–4559.
54. Lu J, Idris U, Harmon B, et al. Diversity and succession of the intestinal bacterial community of the maturing broiler chicken. Appl Environ Microbiol 2003; 69: 6816–6824.
55. Jozefiak D, Rutkowski A, Kaczmarek S, et al. Effect of beta-glucanase and xylanase supplementation of barley- and rye-based diets on caecal microbiota of broiler chickens. Br Poult Sci 2010; 51: 546–557.
56. Yang CM, Cao GT, Ferket PR, et al. Effects of probiotic, Clostridium butyricum, on growth performance, immune function, and cecal microflora in broiler chickens. Poult Sci 2012; 91: 2121–2129.
57. Collins MD, Lawson PA, Willems A, et al. The phylogeny of the genus Clostridium: proposal of five new genera and eleven new species combinations. Int J Syst Bacteriol 1994; 44: 812–826.
58. Wilson MJ, Hall V, Brazier J, et al. Evaluation of a phenotypic scheme for identification of the ‘butyrate-producing’ Peptostreptococcus species. J Med Microbiol 2000; 49: 747–751.
59. Kim YS, Tsao D, Siddiqui B, et al. Effects of sodium butyrate and dimethylsulfoxide on biochemical properties of human colon cancer cells. Cancer 1980; 45: 1185–1192.
60. Hamer HM, Jonkers D, Venema K, et al. Review article: the role of butyrate on colonic function. Aliment Pharmacol Ther 2008; 27: 104–119.
61. Robbins KM, Suyemoto MM, Lyman RL, et al. An outbreak and source investigation of enterococcal spondylitis in broilers caused by Enterococcus cecorum. Avian Dis 2012; 56: 768–773.
62. Boerlin P, Nicholson V, Brash M, et al. Diversity of Enterococcus cecorum from chickens. Vet Microbiol 2012; 157: 405–411.
63. Hooper LV, Gordon JI. Commensal host-bacterial relationships in the gut. Science 2001; 292: 1115–1118.
64. Collett SR. The “seed, feed and weed” approach to managing intestinal health in drug-free production systems. The Poultry Informed Professional 2012; May/June:1–9. Available at: vet.uga.edu/images/uploads/pdrc/PIPMay-June2012Final.pdf. Accessed Dec 1, 2015.
65. Thomas F, Hehemann JH, Rebuffet E, et al. Environmental and gut bacteroidetes: the food connection. Front Microbiol 2011; 2: 93.
66. Bäckhed F, Ley RE, Sonnenburg JL, et al. Host-bacterial mutualism in the human intestine. Science 2005; 307: 1915–1920.
67. Abdallah Ismail N, Ragab SH, Abd Elbaky A, et al. Frequency of Firmicutes and Bacteroidetes in gut microbiota in obese and normal weight Egyptian children and adults. Arch Med Sci 2011; 7: 501–507.
68. Payne AN, Chassard C, Zimmermann M, et al. The metabolic activity of gut microbiota in obese children is increased compared with normal-weight children and exhibits more exhaustive substrate utilization. Nutr Diabetes 2011; 1: e12
69. Bervoets L, Van Hoorenbeeck K, Kortleven I, et al. Differences in gut microbiota composition between obese and lean children: a cross-sectional study. Gut Pathog 2013; 5: 10.
70. Hooper LV, Midtvedt T, Gordon JI. How host-microbial interactions shape the nutrient environment of the mammalian intestine. Annu Rev Nutr 2002; 22: 283–307.
71. Kakiyama G, Pandak WM, Gillevet PM, et al. Modulation of the fecal bile acid profile by gut microbiota in cirrhosis. J Hepatol 2013; 58: 949–955.
Appendix
Primers used in a PCR assay for detection of potential pathogens among pooled DNA samples extracted from cecal microbiota of newly hatched commercial broiler chicks.
| Bacterial group | Primer | Sequence (5′-3′) | Expected size (bp) | Reference |
|---|---|---|---|---|
| Salmonella spp | Sal201-f | CGGGCCTCTTGCCATCAGGTG | 396 | 22 |
| Sal597-r | CACATCCGACTTGACAGACCG | |||
| Escherichia coli | Eco-f | CACACGCTGACGCTGACCA | 585 | 23 |
| Eco-r | GACCTCGGTTTAGTTCACAGA | |||
| Campylobacter spp | Camp-f | GGACGGTAACTAGTTTAGTATT | 857 | 24 |
| Camp-r | ATCTAATGGCTTAACCATTAAAC | |||
| Clostridium spp | Clos58-f | AAAGGAAGATTAATACCGCATAA | 722 | 22 |
| Clos780-r | ATCTTGCGACCGTACTCCCC |
