• 1. Holt DE, Brockman DJ. Laryngeal paralysis. In: King L, ed. Textbook of respiratory diseases in dogs and cats. Philadelphia: WB Saunders Co, 2004: 319327.

    • Search Google Scholar
    • Export Citation
  • 2. MacPhail CM, Monnet E. Outcome of and postoperative complications in dogs undergoing surgical treatment of laryngeal paralysis: 140 cases (1985–1998). J Am Vet Med Assoc 2001;218: 19491956.

    • Search Google Scholar
    • Export Citation
  • 3. Snelling SR, Edwards GA. A retrospective study of unilateral arytenoid lateralisation in the treatment of laryngeal paralysis in 100 dogs (1992–2000). Aust Vet J 2003;81: 464468.

    • Search Google Scholar
    • Export Citation
  • 4. White RAS. Arytenoid lateralization. An assessment of technique, complications and long term results in 62 dogs with laryngeal paralysis. J Small Anim Pract 1989;30: 543549.

    • Search Google Scholar
    • Export Citation
  • 5. LaHue TR. Treatment of laryngeal paralysis in dogs by unilateral cricoarytenoid laryngoplasty. J Am Anim Hosp Assoc 1989;25: 317324.

    • Search Google Scholar
    • Export Citation
  • 6. Venker-van Haagen AJ, Hartman W, Goedegebuure SA. Spontaneous laryngeal paralysis in young Bouviers. J Am Anim Hosp Assoc 1978;14: 714720.

    • Search Google Scholar
    • Export Citation
  • 7. Venker-van Haagen AJ, Bouw J, Hartman W. Hereditary transmission of laryngeal paralysis in Bouviers. J Am Anim Hosp Assoc 1981;17: 7576.

    • Search Google Scholar
    • Export Citation
  • 8. O'Brien JA, Hendricks JC. Inherited laryngeal paralysis. Analysis in the Husky cross. Vet Q 1986;8: 301302.

  • 9. Polizopoulou ZS, Koutinas AF, Papadopoulos GC, et al. Juvenile laryngeal paralysis in three Siberian Husky × Alaskan Malamute puppies. Vet Rec 2003;153: 624627.

    • Search Google Scholar
    • Export Citation
  • 10. Braund KG, Shores A, Cochrane S, et al. Laryngeal paralysis-polyneuropathy complex in young Dalmatians. Am J Vet Res 1994;55: 534542.

    • Search Google Scholar
    • Export Citation
  • 11. Mahony OM, Knowles KE, Braund KG, et al. Laryngeal paralysis-polyneuropathy complex in young Rottweilers. J Vet Intern Med 1998;12: 330337.

    • Search Google Scholar
    • Export Citation
  • 12. Shelton DG. Acquired laryngeal paralysis in dogs: evidence accumulating for a generalized neuromuscular disease. Vet Surg 2010;39: 137138.

    • Search Google Scholar
    • Export Citation
  • 13. Stanley BJ, Hauptman JG, Fritz MC, et al. Esophageal dysfunction in dogs with idiopathic laryngeal paralysis: a controlled cohort study. Vet Surg 2010;39: 139149.

    • Search Google Scholar
    • Export Citation
  • 14. Jeffery ND, Talbot CE, Smith PM, et al. Acquired idiopathic laryngeal paralysis as a prominent feature of generalized neuromuscular disease in 39 dogs. Vet Rec 2006;158: 1721.

    • Search Google Scholar
    • Export Citation
  • 15. Thieman KM, Krahwinkel DJ, Sims MH, et al. Histological confirmation of polyneuropathy in 11 dogs with laryngeal paralysis. J Am Anim Hosp Assoc 2010;46: 161167.

    • Search Google Scholar
    • Export Citation
  • 16. Gaber CE, Amis TX, LeCouteur RA. Laryngeal paralysis in dogs: a review of 23 cases. J Am Vet Med Assoc 1985;186: 377380.

  • 17. Braund KG, Steinberg S, Shores A, et al. Laryngeal paralysis in immature and mature dogs as one more sign of a more diffuse polyneuropathy. J Am Vet Med Assoc 1989;194: 17351740.

    • Search Google Scholar
    • Export Citation
  • 18. Shelton DG, Podell M, Poncelet L, et al. Inherited polyneuropathy in Leonberger dogs: a mixed or intermediate form of Charcot-Marie-Tooth disease? Muscle Nerve 2003;27: 471477.

    • Search Google Scholar
    • Export Citation
  • 19. Gabriel A, Poncelet L, VanHam L, et al. Laryngeal paralysis-polyneuropathy complex in young related Pyrenean Mountain Dogs. J Small Anim Pract 2006;47: 144149.

    • Search Google Scholar
    • Export Citation
  • 20. Inherited peripheral neuropathies database. Available at: www.molgen.vib-ua.be/CMTMutations/Home/IPN.cfm. Accessed Dec 1, 2015.

  • 21. Ekenstedt KJ, Becker D, Minor KM, et al. An ARHGEF10 deletion is highly associated with juvenile-onset inherited polyneuropathy in Leonberger and Saint Bernard dogs. PLoS Genet 2014;10: 111.

    • Search Google Scholar
    • Export Citation
  • 22. Chevalier-Larsen E, Holzbaur ELF. Axonal transport and neurodegenerative disease. Biochem Biophys Acta 2006; 1762:10941108.

  • 23. Holzbaur ELF. Motor neurons rely on motor proteins. Trends Cell Biol 2004;14: 233240.

  • 24. Martin M, Iyadurai SJ, Gassman A, et al. Cytoplasmic dynein, the dynactin complex, and kinesin are interdependent and essential for fast axonal transport. Mol Biol Cell 1999;10: 37173728.

    • Search Google Scholar
    • Export Citation
  • 25. LaMonte BH, Wallace KE, Holloway BA, et al. Disruption of dynein/dynactin inhibits axonal transport in motor neurons causing late-onset progressive degeneration. Neuron 2002;34: 715727.

    • Search Google Scholar
    • Export Citation
  • 26. Hafezparast M, Klocke R, Ruhrberg C, et al. Mutations in dynein link motor neuron degeneration to defects in retrograde transport. Science 2003;300: 808812.

    • Search Google Scholar
    • Export Citation
  • 27. Puls I, Oh SJ, Summer CJ, et al. Distal spinal and bulbar muscular atrophy caused by dynactin mutation. Ann Neurol 2005;57: 687694.

    • Search Google Scholar
    • Export Citation
  • 28. Puls I, Jonnakuty C, LaMonte BH, et al. Mutant dynactin in motor neuron disease. Nat Genet 2003;33: 455456.

  • 29. Levy JR, Summer CJ, Caviston JP, et al. A motor neuron disease-associated mutation in p150glued perturbs dynactin function and induces protein aggregation. J Cell Biol 2006;172: 733745.

    • Search Google Scholar
    • Export Citation
  • 30. BLAST, the Dog genome, National Center for Biotechnology Information, National Institutes of health, Bethesda, Md. Available at: www.ncbi.nlm.gov/genome/seq/CfaBlast.html. Accessed May 5, 2015.

    • Search Google Scholar
    • Export Citation
  • 31. Pruitt KD, Tatusova T, Maglott DR. NCBI Reference Sequence (RefSeq): a curated non-redundant sequence database of genomes, transcripts and proteins. Nucleic Acids Res 2005; 33: D501D504.

    • Search Google Scholar
    • Export Citation
  • 32. Lindblad-Toh K, Wade CM, Mikkelsen TS, et al. Genome sequence, comparative analysis and haplotype structure of the domestic dog. Nature 2005;438: 803819.

    • Search Google Scholar
    • Export Citation
  • 33. Hoeppner MP, Lundquist A, Pirun M, et al. An improved canine genome and a comprehensive catalogue of coding genes and non-coding transcripts. PLOS One 2014;9: 111.

    • Search Google Scholar
    • Export Citation
  • 34. Ye H, Kuruvilla R, Zweifel LS, et al. Evidence in support of signaling endosome-based retrograde survival of sympathetic neurons. Neuron 2003;39: 5768.

    • Search Google Scholar
    • Export Citation
  • 35. Terada S, Hirokawa N. Moving on to the cargo problems of microtubule-dependent motors in neurons. Curr Opin Neurobiol 2000;10: 566572.

    • Search Google Scholar
    • Export Citation
  • 36. Williamson TL, Cleveland DW. Slowing of axonal transport is a very early event in the toxicity of ALS-linked SOD1 mutants to motor neurons. Nat Neurosci 1999;2: 5056.

    • Search Google Scholar
    • Export Citation
  • 37. Zhang B, Tu P, Abtahian F, et al. Neurofilaments and orthograde transport are reduced in ventral root axons of transgenic mice that express human SOD1 with a G93A mutation. J Cell Biol 1997;139: 13071315.

    • Search Google Scholar
    • Export Citation
  • 38. Zhang B, Higuchi M, Yoshiyama Y, et al. Retarded axonal transport of R406W mutant tau in transgenic mice with a neurodegenerative tauopathy. J Neurosci 2004;24: 46574667.

    • Search Google Scholar
    • Export Citation
  • 39. Bennett CL, Lawson VH, Brickell KL, et al. Late-onset hereditary axonal neuropathies. Neurology 2008;71: 1420.

  • 40. Züchner S, Vance JM. Mechanisms of disease: a molecular genetic update on hereditary axonal neuropathies. Nat Clin Pract Neurol 2006;2: 4553.

    • Search Google Scholar
    • Export Citation
  • 41. Scherer SS. Finding the causes of inherited neuropathies. Arch Neurol 2006;63: 812816.

  • 42. Züchner S, Mersiyanova IV, Muglia M, et al. Mutations in the mitochondrial GTPase mitofusin 2 cause Charcot-Marie-Tooth neuropathy type 2A. Nat Genet 2004;36: 449451.

    • Search Google Scholar
    • Export Citation
  • 43. Lawson VH, Graham BV, Flanigan KM. Clinical and electrophysiological features of CMT2A with mutations in the mitofusin gene. Neurology 2005;65: 197204.

    • Search Google Scholar
    • Export Citation
  • 44. Cuesta A, Pedrola L, Sevilla T, et al. The gene encoding ganglioside-induced differentiation-associated protein 1 is mutated in axonal Charcot-Marie-Tooth type 4A disease. Nat Genet 2002;30: 2225.

    • Search Google Scholar
    • Export Citation
  • 45. Baxter RV, Othmane KB, Rochelle JM, et al. Ganglioside-induced differentiation-associated protein-1 is mutant in Charcot-Marie-Tooth disease type 4A/8q21. Nat Genet 2002;30: 2122.

    • Search Google Scholar
    • Export Citation
  • 46. Mersiyanova IV, Perepelov AV, Polyakov AV, et al. A new variant of Charcot-Marie-Tooth disease type 2 is probably the result of a mutation in the neurofilament-light gene. Am J Hum Genet 2000;67: 3746.

    • Search Google Scholar
    • Export Citation
  • 47. Antonellis A, Ellsworth RE, Sambugghin N, et al. Glycyl tRNA synthetase mutations in Charcot-Marie-Tooth disease type 2D and distal spinal muscular atrophy type V. Am J Hum Genet 2003;72: 12931299.

    • Search Google Scholar
    • Export Citation

Advertisement

Evaluation of the dynactin 1 gene in Leonbergers and Labrador Retrievers with laryngeal paralysis

View More View Less
  • 1 Department of Clinical Studies-Philadelphia, School of Veterinary Medicine, University of Pennsylvania, Philadelphia, PA 19104.
  • | 2 Department of Clinical Studies-Philadelphia, School of Veterinary Medicine, University of Pennsylvania, Philadelphia, PA 19104.
  • | 3 Department of Clinical Studies-Philadelphia, School of Veterinary Medicine, University of Pennsylvania, Philadelphia, PA 19104.

Abstract

OBJECTIVE To sequence exons and splice consensus sites of the dynactin subunit 1 (DCTN1) gene in Leonbergers and Labrador Retrievers with clinical laryngeal paralysis.

ANIMALS 5 unrelated Leonbergers with laryngeal paralysis, 2 clinically normal Leonbergers, 7 unrelated Labrador Retrievers with laryngeal paralysis, and 2 clinically normal Labrador Retrievers.

PROCEDURES Primers were designed for the entire coding regions of the DCTN1 gene, a noncoding exon at the 5´ end of the gene, and a 900-bp single-nucleotide polymorphism (SNP)-rich region located 17 kb upstream of the DCTN1 gene by use of the CanFam3 assembly of the canine genome sequence. Sequences were generated and compared between clinically normal and affected dogs. The SNPs flanking the DCTN1 gene as well as a previously identified nonsynonymous SNP in exon 32 were genotyped in affected and clinically normal Leonbergers and Labrador Retrievers.

RESULTS None of the affected dogs were homozygous for any mutation affecting coding regions or splicing consensus sequences. Of the 16 dogs tested for the missense SNP in exon 32, all were homozygous for the reference allele, except for 2 affected and 1 clinically normal Labrador Retriever and 1 clinically normal Leonberger. The DCTN1 gene sequences (5 dogs) and haplotypes of polymorphic markers surrounding the DCTN1 gene (all dogs) were not consistent with the hypothesis that laryngeal paralysis was associated with inheritance of the same DCTN1 disease-causing allele within all Labrador Retrievers or Leonbergers evaluated.

CONCLUSIONS AND CLINICAL RELEVANCE Mutations in the DCTN1 gene did not appear to cause laryngeal paralysis in Leonbergers or Labrador Retrievers.

Abstract

OBJECTIVE To sequence exons and splice consensus sites of the dynactin subunit 1 (DCTN1) gene in Leonbergers and Labrador Retrievers with clinical laryngeal paralysis.

ANIMALS 5 unrelated Leonbergers with laryngeal paralysis, 2 clinically normal Leonbergers, 7 unrelated Labrador Retrievers with laryngeal paralysis, and 2 clinically normal Labrador Retrievers.

PROCEDURES Primers were designed for the entire coding regions of the DCTN1 gene, a noncoding exon at the 5´ end of the gene, and a 900-bp single-nucleotide polymorphism (SNP)-rich region located 17 kb upstream of the DCTN1 gene by use of the CanFam3 assembly of the canine genome sequence. Sequences were generated and compared between clinically normal and affected dogs. The SNPs flanking the DCTN1 gene as well as a previously identified nonsynonymous SNP in exon 32 were genotyped in affected and clinically normal Leonbergers and Labrador Retrievers.

RESULTS None of the affected dogs were homozygous for any mutation affecting coding regions or splicing consensus sequences. Of the 16 dogs tested for the missense SNP in exon 32, all were homozygous for the reference allele, except for 2 affected and 1 clinically normal Labrador Retriever and 1 clinically normal Leonberger. The DCTN1 gene sequences (5 dogs) and haplotypes of polymorphic markers surrounding the DCTN1 gene (all dogs) were not consistent with the hypothesis that laryngeal paralysis was associated with inheritance of the same DCTN1 disease-causing allele within all Labrador Retrievers or Leonbergers evaluated.

CONCLUSIONS AND CLINICAL RELEVANCE Mutations in the DCTN1 gene did not appear to cause laryngeal paralysis in Leonbergers or Labrador Retrievers.

Laryngeal paralysis in dogs is caused by denervation of the intrinsic laryngeal muscles, which prevents normal abduction and adduction of the arytenoid cartilages and vocal folds.1 As affected dogs increase their respiratory effort during hot weather or exercise, the narrow rima glottis increases resistance to effective airflow. This is compounded by swelling caused by turbulent airflow through the glottis. The net result is ineffective airflow, an increase in respiratory work, and, often, life-threatening hypoxemia and hyperthermia.1

Effective surgical treatment for laryngeal paralysis has been described,2–5 but the cause of the condition remains unclear. Although laryngeal paralysis may be a congenital condition in some breeds, including Bouviers des Flandres, Siberian Husky, Dalmatian, and Rottweiller,6–11 it commonly develops in middle-age to older large-breed dogs.1–5 In most of these dogs, no underlying cause for degeneration of the recurrent laryngeal nerves is identified. The possibility of a genetic cause of adult-onset laryngeal paralysis has been raised12 because some breeds (notably Labrador Retriever) appear to be overrepresented in populations of affected dogs.13–15

Dysfunction of the recurrent laryngeal nerve is the only neurologic abnormality clinically apparent in many affected dogs, but laryngeal paralysis has been described as the most obvious sign of an underlying central or peripheral polyneuropathy in some reports.14–19 Electrodiagnostic findings, including decreased amplitude of compound muscle action potentials and decreased nerve conduction velocity, support a die back form of axonal neuropathy,15,17 although this has not been confirmed histopathologically.15 Histologic examination of the muscular branch of the recurrent laryngeal and peroneal nerves in 1 study15 revealed loss of large nerve fibers, axonal degeneration, and endoneurial fibrosis with no evidence of nerve regeneration. Evaluation of biopsy specimens concurrently obtained from the cricoarytenoideus dorsalis and cranial tibial muscles revealed a pattern of neurogenic atrophy.15

A specific, inherited polyneuropathy that manifests initially as laryngeal paralysis has been described in Leonbergers.18 Affected dogs develop clinical signs when they are between 1 and 9 years of age. The first clinical sign reported by owners is often a change in bark. Laryngoscopy of affected dogs is diagnostic for laryngeal paralysis.18 The phenotype in these Leonbergers and other dog breeds with acquired laryngeal paralysis is similar to CMT disease, a group of hereditary motor and sensory neuropathies in humans that has an increasingly apparent genetic basis.20 An ARHGEF10 deletion has recently been described in Leonbergers with polyneuropathy.14 This deletion mutation is highly associated with the juvenile-onset form of the disease but does not explain later-onset cases.21

Although genetic and cellular mechanisms of peripheral nerve degeneration in dogs remain obscure, it is clear that intracellular transport of new proteins to axons and dendrites and retrograde transport of trophic factors and signaling molecules are vital for nerve differentiation and survival.22 Dynein is the major motor for retrograde transport of substances in axons; dynactin is a dynein-activator complex required for most of the cellular functions of cytoplasmic dynein.23 Disruption of the dynactin complex effectively blocks dynein-mediated functions, which appear to be vital to physiologic nerve health and function. Mutations in the p150 Glued component of dynactin inhibit both retrograde and normograde axonal transport in Drosophila spp.24 Targeted disruption of dynein or dynactin in motor neurons causes late-onset, progressive motor neuron disease in mice,25 and transgenic mice developed to have disruption of the dynactin complex also develop late-onset, progressive motor neuron degeneration.26 A human family with an inherited form of motor neuron disease caused by a mutation in dynactin has been described.27–29 Initial clinical signs in that family were related to bilateral laryngeal paralysis with subsequent weakness and atrophy in the hands, face, and distal parts of the pelvic limbs.27 The association between mutations or disruption of dynactin and disruption of axonal transport in Drosophila spp and mice, late-onset motor neuron degeneration, and the human phenotype associated with dynactin mutation suggests dynactin mutations as a potential cause of peripheral nerve degeneration and laryngeal paralysis in dogs. The objectives of the study reported here were to evaluate whether Labrador Retrievers are overrepresented in the population of dogs admitted for treatment of laryngeal paralysis and to assess dynactin mutations in Leonbergers and Labrador Retrievers with laryngeal paralysis.

Materials and Methods

Animals

Medical records at the Matthew J. Ryan Veterinary Hospital at the University of Pennsylvania were searched for the period from 1996 through 2006 to identify animals with confirmed laryngeal paralysis. The diagnosis of laryngeal paralysis was suspected on the basis of historical and clinical findings and confirmed by failure of abduction of the arytenoids visually detected in dogs lightly anesthetized by administration of barbiturate and actively gagging. A Pearson χ2 test was used to compare the number of Labrador Retrievers with laryngeal paralysis admitted to the emergency service and the outpatient clinic with the number of Labrador Retrievers in 500 arbitrarily identified admissions to each of those hospital services during the same time period.

A blood sample was typically collected from affected Leonbergers and Labrador Retrievers with suspected laryngeal paralysis as part of the routine preoperative hematologic and biochemical screening. An additional 2 mL of blood was collected from each of the dogs. Blood samples were placed into EDTA-containing tubes and stored at −70°C. Blood samples from clinically normal Labrador Retrievers and Leonbergers were collected from such dogs or were EDTA-anticoagulated blood samples scheduled to be discarded by the Clinical Laboratory of the Ryan Veterinary Hospital of the University of Pennsylvania School of Veterinary Medicine. Clinically normal dogs were monitored for 5 years to ensure they did not develop clinical signs of laryngeal paralysis. Informed consent was obtained from all owners, and the protocol was approved by a university institutional animal care and use committee.

Selection and sequencing of a candidate gene

The candidate gene studied was DCTN1, in which a single base mutation is associated with lower motor neuron disease, including laryngeal paralysis in humans.27–29 The DCTN1 gene in humans contains 33 exons encoding multiple alternatively spliced isoforms. The first 2 exons are used alternatively.30,31 Canine EST clones (accession Nos. DN424074, DN375058, and DN375536) and canine tissue RNA sequence data were used to determine the location of a 5´ untranslated exon in dogs that has been detected in human transcripts. The 5´ noncoding exon was referred to as alternative exon 1, and the next exon (which was the first coding exon of the 32 coding exons) was referred to as exon 1. All of the coding exons were contained within 20,000 bp on canine chromosome 17. Chromosomal coordinates were provided in terms of the CanFam3 genome assembly.32,33 Primer pairs for PCR amplification of alternative exon 1 and the 32 protein coding exons and flanking splicing signals were designed by use of a commercial software program.a The DNA fragments were amplified by use of standard PCR conditions, with annealing temperatures determined by gradient PCR assay.

The PCR reactions were performed with Taq DNA polymeraseb or another Taq DNA polymerase,c both with buffer,d in accordance with the manufacturers’ instructions. Annealing temperatures for the PCR reactions were determined by gradient PCR analysis. Primer sequences and optimal annealing temperatures were summarized (Appendix 1). The PCR reaction steps were as follows: initial denaturation at 95°C for 5 minutes; 35 cycles of amplification with denaturation at 94°C for 1 minute, annealing of primers at the optimal annealing temperature for 1 minute, and extension at 72°C for 1 minute; and final extension at 72°C for 7 minutes. The DNA was purified by use of commercial extraction kitse and submitted to the DNA Sequencing Facility at the University of Pennsylvania School of Medicine. The DNA sequences were aligned to the dog reference genome sequence (CanFam3) by use of a reference sequencing component of the software package.

Amplification by use of PCR assay and sequencing of DNA was also performed to determine the genotypes for SNPs in a 904-bp region (CFA17: 48,714,299–48,715,202) that was approximately 12 kb upstream of the DCTN1 gene and contained 10 previously annotated SNPs.

Results

Laryngeal paralysis was confirmed in 352 dogs between 1996 and 2006. Of these, 175 were admitted through the emergency service and 177 were admitted through the outpatient clinic. Of the 352 affected dogs, 126 (36%) were Labrador Retrievers. Thus, Labrador Retrievers were overrepresented because the proportion of affected Labrador Retrievers was significantly (P < 0.001) greater than the proportion of Labrador Retrievers in the random sample of dogs admitted to the emergency service and outpatient clinics for conditions other than laryngeal paralysis (90/999 [9%]).

All 32 coding exons and alternative exon 1, including splice consensus sites, were sequenced in 2 affected Leonbergers (a 7-year-old male and a 7-year-old spayed female), 1 clinically normal Leonberger (an 8-year-old spayed female), and 2 affected Labrador Retrievers (an 11-year-old neutered male and a 6-year-old spayed female). The 7-year-old affected male Leonberger had inherited Leonberger polyneuropathy as determined on the basis of examination of biopsy specimens of the cranial tibial muscle obtained 2 years before blood samples were collected for the present study. Examination of biopsy specimens revealed severe muscle atrophy as well as end-stage denervation and nerve fiber loss and associated axonal degeneration.

The sequences obtained also included complete sequencing of 25 of the DCTN1 introns as well as a 5´ noncoding exon as indicated by evaluation of available canine spliced EST sequences and RNA sequence data.28 Sequences were compared between clinically normal and affected dogs and also with the annotated canine genome sequence. No apparent disease-causing mutations were common among the protein-coding portions of the exons or among the splice consensus sequences. One affected Labrador Retriever was heterozygous for a missense SNP in exon 32 (rs22581520, which encoded an alanine-to-threonine substitution that was evident as heterozygous in the Boxer used for the canine reference genome sequencing). The 5 dogs for which sequences were obtained were heterozygous for a synonymous SNP in exon 16 as well as for a previously unidentified 2-bp insertion (ie, CT) that was observed 441 bp downstream of the stop codon (123 bp downstream of the predicted polyadenylylation site as determined on the basis of the human DCTN1 gene and the 3´ ends of ESTs). In addition, 2 previously unrecognized SNPs were detected in introns (Table 1).

Table 1—

Sequence variations determined by complete sequencing of the DCTN1 protein-coding regions in 3 Leonbergers (LEON) and 2 Labrador Retrievers (LABR).

LocationSNP IDPosition in geneReference/alternate baseLEON 5LEON 1LEON 6LABR 1LABR 2CFA17 location (CanFam3)
Intron 1New SNPIntron 2, 1,103 bpT/AA/TA/TA/TTT48,741,656
Intron 2rs22581479Intron 2C/TCCCC/TC48,742,594
Intron 2rs22581481Intron 2C/GGGGC/GG48,742,602
Intron 4rs22581483Intron 4C/TC/TC/TC/TC/TT48,743,251
Intron 4rs22581484Intron 4A/GGGGA/GG48,743,596
Intron 6rs22581486Intron 6G/AA/GA/GA/GA/GA/G48,746,290
Intron 6rs22581487Intron 6T/CC/TC/TC/TC/TC/T48,746,420
Exon 9rs22518283Exon 9/silentG/CCCCC/GC48,749,422
Exon 13rs22581514Exon 13/silentT/CCCCC/TC48,750,523
Exon 16rs22581515Exon 16/silentG/AA/GA/GA/GA/GA/G48,751,367
Intron 16New SNPIntron 16, 76 bpA/CCCCA/CC48,751,581
Intron 20rs22581516Intron 20T/GTTTG/TT48,753,210
Intron 20rs22581517Intron 20A/CCCCA/CC48,753,211
Exon 32rs22581520Exon 32/Ala>ThrG/AGGGA/GG48,758,777
IntergenicNew 2-bp insertion3’ of DCTN1*– –/CTCT/–CT/–CT/–CT/–CT/–48,759,296

The dog LEON 5 was clinically normal; the other 4 dogs were affected with laryngeal paralysis.

Represents the location 441 base pairs 3’ of the stop codon.

To further explore the missense SNP in exon 32 and to investigate the possibility of disease-associated noncoding polymorphisms, additional SNPs near the DCTN1 gene, including SNP markers 17 kb upstream of the DCTN1 first coding exon (which encompassed the presumed promoter area) and the in/del polymorphism directly 3´ of the gene from a larger collection of affected and clinically normal control Leonbergers and Labrador Retrievers, were sequenced (Table 2). The exon 32 missense mutation was observed in 1 copy in 4 dogs (2 affected dogs [both Labrador Retrievers] and 2 clinically normal dogs [1 Leonberger and 1 Labrador Retriever]). The Boxer's DNA that was used for the canine reference genome sequence was also heterozygous for this missense mutation, which ruled out this mutation as necessary for the development of laryngeal paralysis in Leonbergers or Labrador Retrievers. No individual SNP was associated (P > 0.167 for all SNPs; Fisher exact test) with laryngeal paralysis in Leonbergers or Labrador Retrievers, assuming both autosomal dominant or autosomal recessive inheritance. The pattern of genotypes (haplotypes) across the DCTN1 region in affected versus clinically normal dogs argued against the association of the same DCTN1 allele in dogs with laryngeal paralysis and ruled out a simple Mendelian mode of inheritance of a DCTN1 disease-causing allele, under the assumption that affected dogs inherited the same disease-causing allele from a common ancestor within either breed.

Table 2—

Sequence variations in 16 Labrador Retrievers and Leonbergers that were affected with laryngeal paralysis (AF) or were clinically normal (CN).

    Upstream region SNPsExon 323’ end
DogAge (y)SexStatus7 SNP haplotype*New SNP 48,714,780 G/Crs8756265 T/Crs22556191 A/Crs22581520 missense G/Ain/del CT
LABR 16FSAFHetRefHetHetHetHet
LABR 211MCAFRefRefRefAltRefHet
LABR 38FSAFRefRefRefAltRefHet
LABR 411FSAFRefHetHetAltRefHet
LABR 512FSAFHetHetAltHetHetHet
LABR 67FSAFAltRefAltRefRefHet
LABR 711FSAFAltRefAltRefRefRef
LABR 83FSCNHetRefHetHetRefHet
LABR 97MCCNHetHetAltHetHetAlt
LEON 17MAFRefRefRefAltRefHet
LEON 27MAFRefRefRefAltRefRef
LEON 410MCAFRefRefRefAltRefHet
LEON 67FSAFHetRefHetHetRefHet
LEON 87FSAFHetRefHetHetRefRef
LEON 34MCNHetRefHetHetRefRef
LEON 58FSCNRefRefRefAltRefHet
LEON 76FSCNAltRefAltRefHetHet

Alt = Alternative exon 1. FS = Spayed female. Het = Heterogenous. M = Sexually intact male. MC = Castrated male. Ref = Reference allele.

See Figure 1 for remainder of key.

Discussion

The overrepresentation of Labrador Retrievers in the study reported here, compared with both the outpatient clinic and emergency service canine populations, suggested a genetic component to laryngeal paralysis in this breed. However, on the basis of results of the present study, laryngeal paralysis in Leonbergers and Labrador Retrievers did not appear to be associated with a specific common mutation in the DCTN1 gene.

We elected to sequence the DCTN1 gene because of the association between dynactin mutations and late-onset axonal degeneration in mice and similarities in the phenotype between a family of humans with a dynactin mutation with laryngeal paralysis and Labrador Retrievers and Leonbergers with laryngeal paralysis. The clinical phenotype in affected humans is characterized by adult-onset laryngeal paralysis; weakness and muscle atrophy in the face, hands, and legs develop subsequently.27 The phenotype in this human family was not identical to the disease or diseases seen in Leonbergers and Labrador Retrievers, however. In the affected humans, there was no clinical or electrophysiologic evidence of a sensory abnormality.27 To the authors’ knowledge, quantitative sensory testing has not been performed in dogs with laryngeal paralysis, but clinical signs of ataxia and proprioceptive deficits occur in some affected animals,13–15 which possibly suggests concurrent sensory neuropathy.12

Many phenotypes are complex with many contributing genetic and environmental influences. Sequencing of a single gene suspected of an association with laryngeal paralysis in Leonbergers or Labrador Retrievers on the basis of phenotypic similarities with mice and humans was perhaps overly optimistic, especially in Labrador Retrievers. Although Labrador Retrievers have been prominently represented in other reports of laryngeal paralysis,13–15 the disease has not been described in families or lines of this breed, which suggests that the disease may be a complex trait with a major contributing gene in Labrador Retrievers. Pedigree analysis of affected dogs and an entire genome association study are logical steps for investigation of the genetic basis of laryngeal paralysis in Labrador Retrievers.

A genome-wide association study21 of Leonbergers identified a highly associated and likely causative mutation in the ARHGEF10 gene. This gene codes for a rho GTPase involved in neuronal growth and axonal migration. The identified 10-bp deletion generates a premature stop codon that likely truncates 50% of the protein. Dogs that are homozygous for this mutation develop clinical signs before 4 years of age.21

Dynein is a motor protein complex that is vital for retrograde axonal transport of material to the cell body for degradation and transport of neurotrophic factors for neuron survival and function.23,34 Dynactin is a protein complex that tethers substances for transport within axons to the dynein light intermediate chains.35 The dynein-dynactin microtubule motor proteins are vital for retrograde axonal transport27; disruption of axonal transport has been implicated in amyotrophic lateral sclerosis,36,37 frontotemporal dementia,38 and motor neuron degeneration.26,27 The DCTN1 mutation described in the human family was a single base pair change resulting in a substitution of serine for glycine at position 59 in all affected family members.28 We did not identify a mutation in the DCTN1 gene in dogs with laryngeal paralysis in the present study, but this should not preclude further investigation of axonal transport motors in dogs with peripheral neuropathies. Dominant genetic interactions between kinesin; the major anterograde transport motor, dynein; and dynactin have been identified.24 Mutations in either motor result in inhibition of axonal transport24; in turn, this may lead to late-onset progressive motor neuron disease.25

In humans, inherited motor and sensory neuropathies are classically referred to as CMT syndrome. These are a heterogeneous group of diseases that have traditionally been divided phenotypically into those with slow nerve conduction velocities (CMT1-demyelinating) and those with normal to near-normal nerve conduction velocities and low amplitude compound motor and sensory nerve potentials (CMT2-axonal).39 This phenotypic classification has been called into question by the discovery of identical mutations or mutations on the same gene in families previously classified as CMT1 and CMT2 on the basis of nerve conduction velocities and histopathologic findings.40 The phenotype of Leonberger polyneuropathy and Labrador Retrievers with laryngeal paralysis is that of an axonal polyneuropathy and most similar to CMT2. In humans, CMT2 is associated with mutations in at least 12 genes and many more chromosomal linkage assignments.41 Many of the genes associated with CMT2 code for proteins involved with mitochondrial functions,42–45 endosomal trafficking,46 and RNA processing.47 Investigations of these and other genes may provide further insights into the underlying causes of Leonberger polyneuropathy and laryngeal paralysis in Labrador Retrievers.

Acknowledgments

Supported by an American Kennel Club Canine Health Foundation ACORN grant.

ABBREVIATIONS

CMT

Charcot-Marie-Tooth

DCTN1

Dynactin subunit 1

EST

Expressed sequence tag

SNP

Single-nucleotide polymorphism

Footnotes

a.

DNASTAR, DNASTAR Inc, Madison Wis.

b.

Platinum Taq DNA polymerase, Invitrogen/Thermo Fisher Scientific Inc, Waltham, Mass.

c.

TaKaRa La Taq DNA polymerase, Clontech Laboratories Inc, Mountain View, Calif.

d.

GC II buffer, Clontech Laboratories Inc, Mountain View, Calif.

e.

QIA Quik, PCR purification or gel extraction kits, QIAgen, Valencia, Calif.

References

  • 1. Holt DE, Brockman DJ. Laryngeal paralysis. In: King L, ed. Textbook of respiratory diseases in dogs and cats. Philadelphia: WB Saunders Co, 2004: 319327.

    • Search Google Scholar
    • Export Citation
  • 2. MacPhail CM, Monnet E. Outcome of and postoperative complications in dogs undergoing surgical treatment of laryngeal paralysis: 140 cases (1985–1998). J Am Vet Med Assoc 2001;218: 19491956.

    • Search Google Scholar
    • Export Citation
  • 3. Snelling SR, Edwards GA. A retrospective study of unilateral arytenoid lateralisation in the treatment of laryngeal paralysis in 100 dogs (1992–2000). Aust Vet J 2003;81: 464468.

    • Search Google Scholar
    • Export Citation
  • 4. White RAS. Arytenoid lateralization. An assessment of technique, complications and long term results in 62 dogs with laryngeal paralysis. J Small Anim Pract 1989;30: 543549.

    • Search Google Scholar
    • Export Citation
  • 5. LaHue TR. Treatment of laryngeal paralysis in dogs by unilateral cricoarytenoid laryngoplasty. J Am Anim Hosp Assoc 1989;25: 317324.

    • Search Google Scholar
    • Export Citation
  • 6. Venker-van Haagen AJ, Hartman W, Goedegebuure SA. Spontaneous laryngeal paralysis in young Bouviers. J Am Anim Hosp Assoc 1978;14: 714720.

    • Search Google Scholar
    • Export Citation
  • 7. Venker-van Haagen AJ, Bouw J, Hartman W. Hereditary transmission of laryngeal paralysis in Bouviers. J Am Anim Hosp Assoc 1981;17: 7576.

    • Search Google Scholar
    • Export Citation
  • 8. O'Brien JA, Hendricks JC. Inherited laryngeal paralysis. Analysis in the Husky cross. Vet Q 1986;8: 301302.

  • 9. Polizopoulou ZS, Koutinas AF, Papadopoulos GC, et al. Juvenile laryngeal paralysis in three Siberian Husky × Alaskan Malamute puppies. Vet Rec 2003;153: 624627.

    • Search Google Scholar
    • Export Citation
  • 10. Braund KG, Shores A, Cochrane S, et al. Laryngeal paralysis-polyneuropathy complex in young Dalmatians. Am J Vet Res 1994;55: 534542.

    • Search Google Scholar
    • Export Citation
  • 11. Mahony OM, Knowles KE, Braund KG, et al. Laryngeal paralysis-polyneuropathy complex in young Rottweilers. J Vet Intern Med 1998;12: 330337.

    • Search Google Scholar
    • Export Citation
  • 12. Shelton DG. Acquired laryngeal paralysis in dogs: evidence accumulating for a generalized neuromuscular disease. Vet Surg 2010;39: 137138.

    • Search Google Scholar
    • Export Citation
  • 13. Stanley BJ, Hauptman JG, Fritz MC, et al. Esophageal dysfunction in dogs with idiopathic laryngeal paralysis: a controlled cohort study. Vet Surg 2010;39: 139149.

    • Search Google Scholar
    • Export Citation
  • 14. Jeffery ND, Talbot CE, Smith PM, et al. Acquired idiopathic laryngeal paralysis as a prominent feature of generalized neuromuscular disease in 39 dogs. Vet Rec 2006;158: 1721.

    • Search Google Scholar
    • Export Citation
  • 15. Thieman KM, Krahwinkel DJ, Sims MH, et al. Histological confirmation of polyneuropathy in 11 dogs with laryngeal paralysis. J Am Anim Hosp Assoc 2010;46: 161167.

    • Search Google Scholar
    • Export Citation
  • 16. Gaber CE, Amis TX, LeCouteur RA. Laryngeal paralysis in dogs: a review of 23 cases. J Am Vet Med Assoc 1985;186: 377380.

  • 17. Braund KG, Steinberg S, Shores A, et al. Laryngeal paralysis in immature and mature dogs as one more sign of a more diffuse polyneuropathy. J Am Vet Med Assoc 1989;194: 17351740.

    • Search Google Scholar
    • Export Citation
  • 18. Shelton DG, Podell M, Poncelet L, et al. Inherited polyneuropathy in Leonberger dogs: a mixed or intermediate form of Charcot-Marie-Tooth disease? Muscle Nerve 2003;27: 471477.

    • Search Google Scholar
    • Export Citation
  • 19. Gabriel A, Poncelet L, VanHam L, et al. Laryngeal paralysis-polyneuropathy complex in young related Pyrenean Mountain Dogs. J Small Anim Pract 2006;47: 144149.

    • Search Google Scholar
    • Export Citation
  • 20. Inherited peripheral neuropathies database. Available at: www.molgen.vib-ua.be/CMTMutations/Home/IPN.cfm. Accessed Dec 1, 2015.

  • 21. Ekenstedt KJ, Becker D, Minor KM, et al. An ARHGEF10 deletion is highly associated with juvenile-onset inherited polyneuropathy in Leonberger and Saint Bernard dogs. PLoS Genet 2014;10: 111.

    • Search Google Scholar
    • Export Citation
  • 22. Chevalier-Larsen E, Holzbaur ELF. Axonal transport and neurodegenerative disease. Biochem Biophys Acta 2006; 1762:10941108.

  • 23. Holzbaur ELF. Motor neurons rely on motor proteins. Trends Cell Biol 2004;14: 233240.

  • 24. Martin M, Iyadurai SJ, Gassman A, et al. Cytoplasmic dynein, the dynactin complex, and kinesin are interdependent and essential for fast axonal transport. Mol Biol Cell 1999;10: 37173728.

    • Search Google Scholar
    • Export Citation
  • 25. LaMonte BH, Wallace KE, Holloway BA, et al. Disruption of dynein/dynactin inhibits axonal transport in motor neurons causing late-onset progressive degeneration. Neuron 2002;34: 715727.

    • Search Google Scholar
    • Export Citation
  • 26. Hafezparast M, Klocke R, Ruhrberg C, et al. Mutations in dynein link motor neuron degeneration to defects in retrograde transport. Science 2003;300: 808812.

    • Search Google Scholar
    • Export Citation
  • 27. Puls I, Oh SJ, Summer CJ, et al. Distal spinal and bulbar muscular atrophy caused by dynactin mutation. Ann Neurol 2005;57: 687694.

    • Search Google Scholar
    • Export Citation
  • 28. Puls I, Jonnakuty C, LaMonte BH, et al. Mutant dynactin in motor neuron disease. Nat Genet 2003;33: 455456.

  • 29. Levy JR, Summer CJ, Caviston JP, et al. A motor neuron disease-associated mutation in p150glued perturbs dynactin function and induces protein aggregation. J Cell Biol 2006;172: 733745.

    • Search Google Scholar
    • Export Citation
  • 30. BLAST, the Dog genome, National Center for Biotechnology Information, National Institutes of health, Bethesda, Md. Available at: www.ncbi.nlm.gov/genome/seq/CfaBlast.html. Accessed May 5, 2015.

    • Search Google Scholar
    • Export Citation
  • 31. Pruitt KD, Tatusova T, Maglott DR. NCBI Reference Sequence (RefSeq): a curated non-redundant sequence database of genomes, transcripts and proteins. Nucleic Acids Res 2005; 33: D501D504.

    • Search Google Scholar
    • Export Citation
  • 32. Lindblad-Toh K, Wade CM, Mikkelsen TS, et al. Genome sequence, comparative analysis and haplotype structure of the domestic dog. Nature 2005;438: 803819.

    • Search Google Scholar
    • Export Citation
  • 33. Hoeppner MP, Lundquist A, Pirun M, et al. An improved canine genome and a comprehensive catalogue of coding genes and non-coding transcripts. PLOS One 2014;9: 111.

    • Search Google Scholar
    • Export Citation
  • 34. Ye H, Kuruvilla R, Zweifel LS, et al. Evidence in support of signaling endosome-based retrograde survival of sympathetic neurons. Neuron 2003;39: 5768.

    • Search Google Scholar
    • Export Citation
  • 35. Terada S, Hirokawa N. Moving on to the cargo problems of microtubule-dependent motors in neurons. Curr Opin Neurobiol 2000;10: 566572.

    • Search Google Scholar
    • Export Citation
  • 36. Williamson TL, Cleveland DW. Slowing of axonal transport is a very early event in the toxicity of ALS-linked SOD1 mutants to motor neurons. Nat Neurosci 1999;2: 5056.

    • Search Google Scholar
    • Export Citation
  • 37. Zhang B, Tu P, Abtahian F, et al. Neurofilaments and orthograde transport are reduced in ventral root axons of transgenic mice that express human SOD1 with a G93A mutation. J Cell Biol 1997;139: 13071315.

    • Search Google Scholar
    • Export Citation
  • 38. Zhang B, Higuchi M, Yoshiyama Y, et al. Retarded axonal transport of R406W mutant tau in transgenic mice with a neurodegenerative tauopathy. J Neurosci 2004;24: 46574667.

    • Search Google Scholar
    • Export Citation
  • 39. Bennett CL, Lawson VH, Brickell KL, et al. Late-onset hereditary axonal neuropathies. Neurology 2008;71: 1420.

  • 40. Züchner S, Vance JM. Mechanisms of disease: a molecular genetic update on hereditary axonal neuropathies. Nat Clin Pract Neurol 2006;2: 4553.

    • Search Google Scholar
    • Export Citation
  • 41. Scherer SS. Finding the causes of inherited neuropathies. Arch Neurol 2006;63: 812816.

  • 42. Züchner S, Mersiyanova IV, Muglia M, et al. Mutations in the mitochondrial GTPase mitofusin 2 cause Charcot-Marie-Tooth neuropathy type 2A. Nat Genet 2004;36: 449451.

    • Search Google Scholar
    • Export Citation
  • 43. Lawson VH, Graham BV, Flanigan KM. Clinical and electrophysiological features of CMT2A with mutations in the mitofusin gene. Neurology 2005;65: 197204.

    • Search Google Scholar
    • Export Citation
  • 44. Cuesta A, Pedrola L, Sevilla T, et al. The gene encoding ganglioside-induced differentiation-associated protein 1 is mutated in axonal Charcot-Marie-Tooth type 4A disease. Nat Genet 2002;30: 2225.

    • Search Google Scholar
    • Export Citation
  • 45. Baxter RV, Othmane KB, Rochelle JM, et al. Ganglioside-induced differentiation-associated protein-1 is mutant in Charcot-Marie-Tooth disease type 4A/8q21. Nat Genet 2002;30: 2122.

    • Search Google Scholar
    • Export Citation
  • 46. Mersiyanova IV, Perepelov AV, Polyakov AV, et al. A new variant of Charcot-Marie-Tooth disease type 2 is probably the result of a mutation in the neurofilament-light gene. Am J Hum Genet 2000;67: 3746.

    • Search Google Scholar
    • Export Citation
  • 47. Antonellis A, Ellsworth RE, Sambugghin N, et al. Glycyl tRNA synthetase mutations in Charcot-Marie-Tooth disease type 2D and distal spinal muscular atrophy type V. Am J Hum Genet 2003;72: 12931299.

    • Search Google Scholar
    • Export Citation

Appendix

Primers used in a PCR assay of the DCTN1 gene.

Reverse primer sequenceProduct size (bp)Annealing temperature (°C)Sequencing primer nameSequencing primer sequence
TTTTGCCTTGCTCTTCTTCCACTT95366
CTCGGAGGAACGTGTCAGAAGC1,03060*
GTTGCTCACCCGGCCTCTACCC36766
TAAGGCCATTCCAACCCACTAACC64566
ATCATTCTTGCCCTTTGCTTCATC89663
GCCATCCCAGCCCCAAGGTC1,74466DCTNin2.FTCGGGGGAGGAAAGATTGGAGAT
   DCTNin4.RGAGGCTGGAGACTGGAAGGCTAAC
ACAAACCGTGGTGAAGAAGTGATG1,10666
CCACCCCCACTCTCACATCAAAAA58466DCTNin6b.fCTGGTACTTCTTCTGCTCTCATTG
CAGCCCCAGGGTCAAAAGCAAGAG64166
CGCCTTGTCTTCTGCCCGTTTCA82566
GTAACTGGATGCTGCCCCGTCTGA76366
TGGACAGCAGGGGGCACAAT1,10466
TGGGGCCATTCATCACAC68066
CCTCCCCTTCACAACCCACCATCT1,05066
GGCGGATGTCACTGCACGATGTTT1,56466DCTNin 16.FCCCCCTCCCCACTGCCACTG
   DCTNin19.RAGCCCTTCTGCCCCATCACCATT
GGCGGATGTCACTGCACGATGTTT77066
ATCCCCAAGCCCCTCCAAAGACC1,15466
AGGGGGTCAGGTGGGAGTAGAAAG60966
AGAGTGTAGGGGGAGGGGTTAGGA74966
AAGGCCAGACTGCAGACCCAAAAG70566
TGGGCCAAAGGGAGGGGATAC85766
CAACCCCATCCATATCCCACATC85866
GCCGGTGTCGCTGTCCA68566
CCTGGTCTAGCCCTTTCCCTCTTG78566

LA Taq with buffer II; all others were platinum Taq.

— = Not applicable.

Contributor Notes

Address correspondence to Dr. Holt (dholt@vet.upenn.edu).