Abstract
OBJECTIVE To compare the characteristics and multipotential and in vivo cartilage formation capabilities of porcine adipose-derived stem cells (pASCs) with those of porcine skin-derived stem cell–like cells (pSSCs).
ANIMALS Three 6-month-old female pigs and four 6-week-old female athymic mice.
PROCEDURES Adipose and skin tissue specimens were obtained from each pig following slaughter and digested to obtain pASCs and pSSCs. For each cell type, flow cytometry and reverse transcription PCR assays were performed to characterize the expression of cell surface and mesenchymal stem cell markers, and in vitro cell cultures were performed to determine the adipogenic, osteogenic, and chondrogenic capabilities. Each cell type was then implanted into athymic mice to determine the extent of in vivo cartilage formation after 6 weeks.
RESULTS The cell surface and mesenchymal stem cell marker expression patterns, multipotential capability, and extent of in vivo cartilage formation did not differ significantly between pASCs and pSSCs.
CONCLUSIONS AND CLINICAL RELEVANCE Results suggested that pSSCs may be a viable alternative to pASCs as a source of progenitor cells for tissue engineering in regenerative medicine.
Since the 1990s, human embryonic stem cells, induced pluripotent stem cells, and MSCs have emerged as promising tools for regenerative medicine and tissue engineering.1 Among those, MSCs have several advantages, including safety and the potential for use of autologous cells for transplantation into humans.2 Tissue engineering with autologous tissue may resolve the issue of foreign cells being rejected by the immune system (immune rejection). Moreover, because the use of MSCs is not limited by religious or ethical issues, their potential for tissue regeneration is being actively researched.
Mesenchymal stem cells are widely used for several clinical applications including articular cartilage repair.3 Autologous or allogenic MSCs can be used to effectively treat mild to moderate cartilage damage.4,5 Historically, the most common sources of MSCs for treatment of cartilage damage have been autologous BMSCs and ASCs.3 Numerous factors such as the harvesting and expanding of cells and minimizing donor site complications and immune rejection must be considered when selecting a source of MSCs. Skin-derived MSCs might be a useful source of MSCs for the treatment of cartilage damage.
The skin is the largest organ of the body, and because of its location on the body, specimens can be obtained easily and quickly. Moreover, the use of skin-derived MSCs might minimize donor-site complications and host rejection. The histologic and physiologic properties of porcine skin are similar to those of human skin; therefore, porcine skin is becoming increasingly important for use in in vitro models. Mesenchymal stem cells have been successfully extracted and cultivated from porcine skin6,7 and adipose tissues.8 The accessibility and broad spectrum of applications for porcine skin as a tissue source for scientific experiments permit a wide range of biological research into its physiologic, anatomic, toxicological, and developmental properties.9–11 Porcine skin provides an easily accessible source of tissue for the isolation of adult stem cells, and a sufficient number of stem cells can be obtained from a small number of skin biopsy specimens. Similar to embryonic stem cells, adult stem cells from pigs and other large animals have great potential for use in the investigation of cell differentiation and fate and associated cell-signaling pathways.12–14 The purpose of the study reported here was to compare the characteristics and the multipotential and in vivo cartilage formation capabilities of pSSCs with those of the more commonly used pASCs.
Materials and Methods
Animals
All study protocols that involved the use of animals were approved by the Kangwon National University Institutional Animal Care and Use Committee. Three 6-month-old female pigs were used to obtain adipose and skin tissues for isolation of pASCs and pSSCs. Four 6-week-old female athymic micea were implanted with pASCs and pSSCs to assess in vivo cartilage formation.
Isolation of pASCs
From each pig, approximately 10 g of adipose tissue was obtained from the cranial portion of the abdominal wall immediately following slaughter. The adipose tissue specimens were minced into 2- to 4-mm pieces and digested with collagenase type Ib (2 mg/mL) for 45 minutes at 37°C with intermittent shaking. Specimens were then filtered through a 40-μm filterc and centrifuged for 5 minutes at 500 × g. Floating adipocytes were removed from the stromal-vascular fraction. The pASCs isolated from that fraction were cultured with DMEMb supplemented with 15% FBSb (vol/vol) and 1% penicillin and streptomycin suspension and incubated in humidified air with 5% CO2 (vol/vol) at 37°C. The culture medium was replaced every 2 days, and the cells were expanded until they reached confluence. The confluent cells were passaged twice.
Isolation of pSSCs
From each pig, a 4-cm2 full-thickness ear notch specimen was obtained immediately following slaughter. For each specimen, the cartilage was removed and the remaining dermis and epidermis were finely chopped and digested with 10 mL of a digestion solution containing 0.2% trypsin-EDTAd and 0.2% collagenase type I in Dulbecco PBSS for 30 minutes at 37°C with agitation to isolate pSSCs. Cells were recovered, plated in a 100-mm culture dishc in DMEM supplemented with 15% FBS and 1% penicillin and streptomycin suspension, and incubated in humidified air with 5% CO2 (vol/vol) at 37°C. The culture medium was replaced every 2 days, and the cells were expanded until they reached confluence. The confluent cells were passaged twice.
Flow cytometry of pASCs and pSSCs
Passage 2 pASCs and pSSCs were characterized by fluorescence-activated cell sorting analysis. For each cell culture, cells were detached and resuspended in Dulbecco PBSS supplemented with 1% FBS at a concentration of 1 × 106 cells/mL. Mesenchymal stem cell-specific markers anti-mouse CD29,c anti-mouse CD44,c anti-human CD90,c and anti-mouse CD45,e and a human MSC-negative cocktail (CD34, CD11b, CD19, CD45, and HLA-DR)c were used to characterize the cells. Negative control staining was performed with peridinin-chlorophyll protein-conjugated IgG2b, phycoerythrin-conjugated mouse IgG1, and mouse IgG2a isotype-negativec antibodies. Cells were analyzed with an automated system.c Living cells were gated in a dot plot of forward versus side scatter signals obtained on a linear scale; at least 5,000 gated events were acquired on a logarithmic fluorescence scale.
Induction of in vitro differentiation into 3 mesodermal cell types and analysis
Both pASCs and pSSCs (n = 3 samples for each cell type) were seeded in 24-well platesc at a density of 2 × 104 cells/cm2 for adipogenic and osteogenic differentiation or 1 × 104 cells/cm2 for chondrogenic differentiation and grown for 1 to 2 days in standard DMEM with 15% FBS. When the cells reached 70% to 80% confluence, the culture medium was replaced with the appropriate induction medium. To induce adipogenic differentiation, cells were cultured in DMEM containing 10% FBS, 0.5μ M isobutylmethlxanthine,d 0.2μ M indomethacin,d 1% penicillin and streptomycin suspension, 0.1 μ M dexamethasone,d and insulind (10 μg/mL) for 19 days. To induce osteogenic differentiation, cells were cultured in minimum essential medium-αb containing 10% FBS, 1% glutamax,b 0.2mM ascorbic acid,d 10mM glycerol 2-phosphate,d 1% penicillin and streptomycin suspension, and 0.1 μ M dexamethasone for 26 days. To induce chondrogenic differentiation, cells were cultured in DMEM containing 10% FBS, 1% penicillin and streptomycin suspension, 1% insulintransferrin-selenium-A supplement,b 50μ M ascorbic acid, 0.1 μ M dexamethasone, and TGF-β1f (10 ng/mL) for 26 days. The induction medium was replaced every 2 to 3 days. Noninduced control cells were cultured in DMEM supplemented with 10% FBS and 1% penicillin and streptomycin suspension.
Following incubation with the induction medium for the required time, control and differentiated cells were fixed with 4% paraformaldehyde for 15 minutes at room temperature (approx 22°C) before staining. Control cells and cells that underwent adipogenic differentiation were stained with 0.6% oil Red O solutiond (wt/vol) for 1 hour at room temperature. The oil Red O solution stains adipose cells. Stained cells were examined with a light microscope.g Oil Red O was eluted with isopropanol and quantified by measuring the OD at 600 nm with an ELISA plate reader.h Control cells and cells that underwent osteogenic differentiation were stained with a von Kossa staining protocol, which identifies calcium. Cells were treated with 5% silver nitrated and exposed to strong light for 1 hour. The reaction was stopped by treatment with 5% sodium thiosulfate nitrated for 2 to 3 minutes, and the cells were examined under a light microscope. The amount of calcium deposited in each well was determined by use of a calcium assay kit.i The OD of the extracted dye was measured at 650 nm with an ELISA plate reader. Control cells and cells that underwent chondrogenic differentiation were stained with 0.5% Alcian blued in 0.1N hydrochloric acid (pH, 1.0) for 30 minutes at room temperature and then examined under a light microscope. Alcian blue stains glycosaminoglycan in cartilage blue. For quantitative measurement, Alcian blue–stained cultures were extracted with 200 μL of 6M guanidine hydrochloride for 2 hours at room temperature. The OD of the extracted dye was read at 650 nm with an ELISA plate reader.
Induction of chondrogenic differentiation in a 3-D pellet culture
Three-dimensional pellets were created from each cell line of pASCs and pSSCs derived from the same pig. For each sample, 2.5 × 105 cells/cm2 were transferred to a 15-mL centrifuge tube and centrifuged for 5 minutes at 500 × g to form a micromass pellet. The pelleted cells were incubated with the chondrogenic induction medium for 26 days. The induction medium was replaced every 2 to 3 days. Noninduced control cells were cultured in DMEM supplemented with 10% FBS and 1% penicillin and streptomycin suspension. After 26 days of incubation, the control and differentiated cells were fixed and stained with 0.5% Alcian blue in 0.1N hydrochloric acid (pH, 1.0) for 30 minutes at room temperature. Histologic specimens of pellets were fixed in formalin, embedded in paraffin, and transversely sectioned into 4-μm-thick slices. The slices were stained with H&Ed or Alcian blue stain.
RNA extraction and rtPCR assay
The total RNA was extracted from the control and differentiated cells by use of an RNA extraction solution.j For each sample, a commercial reverse transcription kitk was used to synthesize cDNA from 2 μg of RNA. An RT-PCR assay was performed under standard conditions by use of a PCR master mixk and primers for PPARγ2, aP2, Col I, Runx2, Col II, aggrecan, and GAPDH (Appendix). Briefly, the RT-PCR assay consisted of an initial denaturation step for 5 minutes at 95°C; 32 amplification cycles, each of which consisted of 30 seconds of denaturation at 95°C, 30 seconds of annealing at 62°C, and 1 minute of extension at 72°C; and a final extension for 10 minutes at 72°C. The PCR products were analyzed on a 1.2% agarose gell stained with ethidium bromided by the use of UV irradiation and a UV transilluminator.m
Implantation of pASCs and pSSCs for in vivo cartilage formation
Both pASCs and pSSCs were implanted into four 6-week-old female athymic mice to determine the extent of in vivo cartilage formation. Each mouse was anesthetized with ketamined (8 mg/kg, IP) and xylazined (1.15 mg/kg, IP). For each cell line of pASCs and pSSCs used for the 3-D pellet cultures, 1 × 106 cells and 1 μg of TGF-β1 were injected along with fibrin geln (fibrinogen-to-thrombin ratio, 1:1) into the dorsal subcutaneous space. Each mouse was injected 4 times with pASCs (n = 2) and pSSCs (2) obtained from the same pig.
Six weeks after implantation, the mice were anesthetized with ketamine (50 mg/kg, IP) and xylazine (10 mg/kg, IP), then euthanized by means of bilateral thoracotomy so that the implants could be retrieved. Tissue specimens obtained for histologic evaluation were fixed in neutral-buffered 10% formalin, embedded in paraffin, and transversely sectioned into 4- μm-thick slices. The sliced specimens were stained with Alcian blue stain to identify the glycosaminoglycan matrix within cartilaginous tissues. For each type (pASC or pSSC), at least 3 tissue slices were evaluated to determine the area of cartilage formation, which was measured by an image analysis systemo coupled to a light microscope. The area of cartilage formation was quantified as the percentage of cartilage formation (blue stain with lacuna structure) in the available pore space and other tissue areas (ie, [cartilage area/pore and other tissue areas] × 100%). Half of each specimen was used to evaluate chondrogenic gene (Col II and aggrecan) expression by RT-PCR assay.
Statistical analysis
At least 3 independent sets of experiments for each condition were performed in triplicate. Descriptive statistics were generated. The data were determined to be normally distributed by means of a Shapiro-Wilk test. Data were pooled and reported as the mean ± SEM. For each outcome, a 2-tailed Student t test was used to make comparisons between pASCs and pSSCs. All analyses were performed with a commercially available statistical software program, p and values of P ≤ 0.05 were considered significant.
Results
Characterization of pASCs and pSSCs
The representative expressions of cell surface markers for pASC and pSSC cell lines were summarized (Figure 1). Mesenchymal stem cell-specific markers CD29, CD44, and CD90 were expressed at high levels in both pASCs (95.6% to 99.9%) and pSSCs (95.0% to 99.9%). Expression of CD45, which is a marker for hematopoietic cells, was low for both pASCs (0.3%) and pSSCs (0.3%), as was expression for the MSC-negative cocktail (pASCs, 1.0%; pSSCs, 1.3%). All cell lines had similar expression patterns for the cell surface markers within each cell type (pASC and pSCC; data not shown).
Results of fluorescence activated cell sorting analyses of MSC-specific (CD29, CD44, and CD90) and hematopoietic-specific (CD45 and an MSC-negative cocktail [CD34, CD11b, CD19, CD45, and HLA-DR; MHC NC]) markers for representative cell lines obtained from pASCs and pSSCs at the second passage. At least 5,000 gated events were analyzed for each marker. Notice the high expression of MSC-specific markers and low expression of hematopoietic-specific markers, which suggested that each cell line possessed MSC characteristics.
Citation: American Journal of Veterinary Research 76, 9; 10.2460/ajvr.76.9.814
Multipotential capability of pASCs and pSSCs
Quantitative analysis revealed that the expressions of adipose (mean ± SEM OD, 0.17 ± 0.004 for pASCs and 0.15 ± 0.007 for pSSCs) and glycosaminoglycan (mean ± SEM OD, 0.22 ± 0.018 for pASCs and 0.26 ± 0.016 for pSSCs) and the calcium concentration (mean ± SEM concentration, 0.15 ± 0.017 mg/mL for pASCs and 0.17 ± 0.014 mg/mL for pSSCs) for pASCs and pSSCs that were induced to undergo adipogenic, chondrogenic, and osteogenic differentiation, respectively, were significantly greater than those for the corresponding control cells but did not differ significantly between the 2 cell types (Figure 2). Results of the RT-PCR assays revealed high levels of expression of PPARγ2 and aP2 in adipogenic-induced cells, Col I and Runx2 in osteogenic-induced cells, and Col II and aggrecan in chondrogenic-induced cells regardless of cell type. Expression of PPARγ2, aP2, Col 1, Runx2, Col II, and aggrecan was not detected in the noninduced control pASCs and pSSCs. Within each cell type, all 3 cell lines had similar expression patterns for MSC marker genes (data not shown), and the quantitative results for those genes did not differ significantly between pASCs and pSSCs.
Representative photomicrographs of pASC and pSSC lines that were or were not (control) induced to differentiate into adipocytes (oil Red O stain), osteoblasts (von Kossa stain), or chondrocytes (Alcian blue stain). Notice that the pASCs and pSSCs were multipotent and responded similarly to induction of the respective cell types. Bar = 100 μm.
Citation: American Journal of Veterinary Research 76, 9; 10.2460/ajvr.76.9.814
Chondrogenic differentiation of pASCs and pSSCs in 3-D pellet cultures
The chondrogenic-induced cells formed pellets with compact rounded morphology, whereas the noninduced control cells formed small pellets with incompact morphology (Figure 3). The micropellets of the chondrogenic-induced pASCs and pSSCs stained positive with Alcian blue stain, which suggested that they contained proteoglycans. Evaluation of H&E-stained slides revealed that the micropellets of the induced pASCs and pSSCs also contained an accumulation of extracellular matrix and lacunae. Collagen type II and aggrecan were expressed in the induced pASCs and pSSCs but not in the noninduced control cells.
Representative photomicrographs of pASCs and pSSCs that were or were not (control) induced to differentiate into chondrocytes in 3-D cell culture and were stained with Alcian blue stain to identify cell morphology and detect glycosaminoglycans (A) or H&E stain to identify the extracellular matrix and lacunae (B). Bar = 200 μm. Insets—Photomicrographs of a tissue section for each representative cell culture pellet obtained at a low magnification; notice that the cell pellets of the chondrogenic-induced cells were larger and had a higher glycosaminoglycan content, compared with the cell pellets of the control cells, and the chondrogenic differentiation ability of pSSCs was equivalent to that of pASCs. Bar = 100 μm.
Citation: American Journal of Veterinary Research 76, 9; 10.2460/ajvr.76.9.814
In vivo cartilage formation of pASCs and pSSCs
One pASC implantation site and 2 pSSCs implantation sites remained visible in the mice 6 weeks after implantation. Results of Alcian blue staining revealed that both pASC and pSSC implants generated native cartilage tissue with strong expression of glycosaminoglycan and distinct lacunae (Figure 4), and RT-PCR assay results indicated that the chondrogenic markers Col II and aggrecan were expressed in the tissue generated from implants of both pASCs and pSSCs. Results of the quantitative analysis indicated that the extent of in vivo cartilage tissue formation did not differ significantly between the pASC and pSSC implants.
Representative photomicrographs of implant-induced cartilage tissue specimens obtained 6 weeks after implantation of pASCs (A) and pSSCs (B) into 6-week-old athymic mice. Each implant consisted of an injection of 1 × 106 pASCs or pSSCs and 1 μg of TGF-β1 along with a fibrin gel (fibrinogen-to-thrombin ratio, 1:1) into the dorsal subcutaneous space. Notice that the glycosaminoglycan content (blue-stained tissue) and lacuna structure for the cartilage formed from the transplanted pASCs were similar to those for the cartilage formed from the transplanted pSSCs. Alcian blue stain; bar = 200 μm.
Citation: American Journal of Veterinary Research 76, 9; 10.2460/ajvr.76.9.814
Discussion
Mesenchymal stem cells are an indispensable tool in regenerative medicine. Numerous sources of MSCs have been identified, and various methods have been used to culture cells for use in cell-based treatments. However, there remains a need for an optimal clinical-grade product, and high safety standards must be fulfilled. Investigators of another study15 reported that skin-derived floating spheres are easily accessed and might be a potential autologous source of stem cells for transplantation in regenerative medicine that are economical in terms of both cost and time. Results of the present study indicated that the in vitro and in vivo cartilage generation characteristics of pSSCs did not differ significantly from those of pASCs. Therefore, pSSCs might represent an easily accessible alternative to pASCs for use in the development of stem cell treatments.
Defining characteristics of MSCs include their ability to adhere to plastic, express specific surface antigens, and differentiate into adipocytes, osteoblasts, and chondroblasts in vitro.7,16 Mesenchymal stem cells should have positive localization of cell-surface proteins such as CD105, CD73, and CD90 but no localization of hematopoietic markers such as CD45, CD34, CD14, CD11b, CD79a, CD19, or HLA-DR. In the present study, expression of the typical markers characteristic of multipotent MSCs was assessed to confirm the multipotential capability of pASCs and pSSCs. Our results indicated that pASCs and pSSCs had very similar marker expression patterns and were able to differentiate into 3 mesodermal cell lineages (adipogenic, osteogenic, and chondrogenic) in vitro. Thus, both pASCs and pSSCs possessed the characteristics of MSCs.
The chondrogenic efficacy has been compared between ASCs and BMSCs,17,18 and results suggest that the chondrogenic differentiation potential of ASCs is less than17 or similar to18 the chondrogenic differentiation potential of BMSCs. However, results of other studies19–21 suggest that ASCs have some advantages over BMSCs. For example, compared with BMSCs, ASCs are easier to expand in culture and a large number of cells can be obtained from a small amount of readily obtained tissue,19 and ASCs have a low senescence rate and do not cause immune rejection.20,21 In the present study, results of the 2-D and 3-D culture systems confirmed that successful differentiation of pASCs and pSSCs into chondrocytes was characterized by expression of typical chondrogenic genes such as Col II and aggrecan, and results of the quantitative analysis suggested that the chondrogenic differentiation ability of pSSCs was equivalent to that of pASCs.
Currently, MSCs are the most widely used type of stem cells in regenerative medicine, and their efficacy is being investigated for use in several clinical applications (eg, repair of articular cartilage).22 Animal models developed to evaluate the efficacy of MSCs for repairing articular cartilage defects have frequently involved rabbits4,23,24 and sheep.25 In the present study, implantation of athymic mice with pASCs and pSSCs resulted in successful in vivo cartilage formation characterized by strong glycosaminoglycan expression and lacunae. We did not use an injection of fibrin gel alone as a control in the present study because, when injected in vivo, the fibrin matrix completely disappears within a few weeks and the implants would not be visible for retrieval.26 Although human ASCs27,28 and pSSCs7 have been used in in vivo osteogenic experiments, to our knowledge, the present study is the first to evaluate the use of pSSCs for in vivo cartilage formation.
Results of the present study indicated that both pSSCs and pASCs possessed the characteristic features of MSCs and had similar ability to differentiate into chondrocytes in vitro and form cartilage in vivo. Therefore, pSSCs may be a viable alternative to pASCs for use in cellular differentiation and tissue engineering research because of their potential application in a variety of areas and ease of accessibility.
Acknowledgments
Supported by the Basic Science Research Program through the National Research Foundation of Korea funded by the Ministry of Education (NRF-2013R1A1A2006182) and by the Kangwon National University Institute of Veterinary Science.
The authors declare no financial conflicts of interest.
Dr. Hwang and Ms. Bae contributed equally to this work.
The authors thank B. W. Lee for technical assistance.
ABBREVIATIONS
| aP2 | Adipocyte fatty acid binding protein 2 |
| ASC | Adipose-derived stem cell |
| BMSC | Bone marrow–derived mesenchymal stem cell |
| Col I | Collagen type I |
| Col II | Collagen type II |
| DMEM | Dulbecco modified Eagle medium |
| FBS | Fetal bovine serum |
| GAPDH | Glyceraldehyde-3-phosphate dehydrogenase |
| MSC | Mesenchymal stem cell |
| OD | Optical density |
| pASC | Porcine adipose-derived stem cell |
| PPARγ2 | Peroxisome proliferator-activated receptor gamma 2 |
| pSSC | Porcine skin-derived stem cell–like cell |
| PCR | Reverse transcription |
| Runx2 | Runt-related transcription factor 2 |
| TGF | Transforming growth factor |
Footnotes
BAL b/c nude athymic mice, Orientbio, Seongnam, Korea.
Gibco, Grand Island, NY.
BD Sciences, San Diego, Calif.
Sigma-Aldrich Corp, St Louis, Mo.
BioLegend, San Diego, Calif.
ProSpec-Tany TechnoGene Ltd, Rehovot, Israel.
TE300, Nikon Corp, Tokyo, Japan.
VersaMax ELISA microplate reader, Molecular Devices, Sunnyvale, Calif.
QuantiChrom calcium assay kit (DICA-500), BioAssay Systems, Hayward, Calif.
Invitrogen, Karlsruhe, Germany.
Bioneer Corp, Daejeon, Korea.
Amresco, Solon, Ohio.
CN–08, Vilber Lourmat, Torcy, France.
Greenplast kit, Green Cross Corp, Chungbuk, Korea.
KS400, Carl Zeiss, Jena, Germany.
SAS, version 9.3, SAS Institute Inc, Cary, NC.
References
1. Badylak SF, Nerem RM. Progress in tissue engineering and regenerative medicine. Proc Natl Acad Sci U S A 2010; 107: 3285–3286.
2. Trounson A. New perspectives in human stem cell therapeutic research. BMC Med 2009; 7: 29.
3. Kristjánsson B, Honsawek S. Current perspectives in mesenchymal stem cell therapies for osteoarthritis. Stem Cells Int [serial online] 2014; 2014: 194318. Available at: www.hindawi.com/journals/sci/2014/194318/. Accessed Oct 20, 2014.
4. Nejadnik H, Hui JH, Feng Choong EP, et al. Autologous bone marrow–derived mesenchymal stem cells versus autologous chondrocyte implantation: an observational cohort study. Am J Sports Med 2010; 38: 1110–1116.
5. Vangsness CT Jr, Farr J II, Boyd J, et al. Adult human mesenchymal stem cells delivered via intra-articular injection to the knee following partial medial meniscectomy: a randomized, double-blind, controlled study. J Bone Joint Surg Am 2014; 96: 90–98.
6. Dyce PW, Zhu H, Craig J, et al. Stem cells with multilineage potential derived from porcine skin. Biochem Biophys Res Commun 2004; 316: 651–658.
7. Kang EJ, Byun JH, Choi YJ, et al. In vitro and in vivo osteogenesis of porcine skin-derived mesenchymal stem cell–like cells with a demineralized bone and fibrin glue scaffold. Tissue Eng Part A 2010; 16: 815–827.
8. Huang T, He D, Kleiner G, et al. Neuron-like differentiation of adipose-derived stem cells from infant piglets in vitro. J Spinal Cord Med 2007; 30(suppl 1):S35–S40.
9. Dick IP, Scott RC. Pig ear skin as an in-vitro model for human skin permeability. J Pharm Pharmacol 1992; 44: 640–645.
10. Simon GA, Maibach HI. The pig as an experimental animal model of percutaneous permeation in man: qualitative and quantitative observations—an overview. Skin Pharmacol Appl Skin Physiol 2000; 13: 229–234.
11. Jacobi U, Kaiser M, Toll R, et al. Porcine ear skin: an in vitro model for human skin. Skin Res Technol 2007; 13: 19–24.
12. Ringe J, Kaps C, Schmitt B, et al. Porcine mesenchymal stem cells. Induction of distinct mesenchymal cell lineages. Cell Tissue Res 2002; 307: 321–327.
13. Schwartz PH, Nethercott H, Kirov II, et al. Expression of neurodevelopmental markers by cultured porcine neural precursor cells. Stem Cells 2005; 23: 1286–1294.
14. Iohara K, Zheng L, Ito M, et al. Side population cells isolated from porcine dental pulp tissue with self-renewal and multipotency for dentinogenesis, chondrogenesis, adipogenesis, and neurogenesis. Stem Cells 2006; 24: 2493–2503.
15. Vishnubalaji R, Al-Nbaheen M, Kadalmani B, et al. Skin-derived multipotent stromal cells—an archrival for mesenchymal stem cells. Cell Tissue Res 2012; 350: 1–12.
16. Dominici M, Le Blanc K, Mueller I, et al. Minimal criteria for defining multipotent mesenchymal stromal cells. The International Society for Cellular Therapy position statement. Cytotherapy 2006; 8: 315–317.
17. Huang JI, Kazmi N, Durbhakula MM, et al. Chondrogenic potential of progenitor cells derived from human bone marrow and adipose tissue: a patient-matched comparison. J Orthop Res 2005; 23: 1383–1389.
18. Solchaga LA, Penick K, Porter JD, et al. FGF-2 enhances the mitotic and chondrogenic potentials of human adult bone marrow–derived mesenchymal stem cells. J Cell Physiol 2005; 203: 398–409.
19. Dragoo JL, Carlson G, McCormick F, et al. Healing full-thickness cartilage defects using adipose-derived stem cells. Tissue Eng 2007; 13: 1615–1621.
20. Peterson B, Zhang J, Iglesias R, et al. Healing of critically sized femoral defects, using genetically modified mesenchymal stem cells from human adipose tissue. Tissue Eng 2005; 11: 120–129.
21. Puissant B, Barreau C, Bourin P, et al. Immunomodulatory effect of human adipose tissue–derived adult stem cells: comparison with bone marrow mesenchymal stem cells. Br J Haematol 2005; 129: 118–129.
22. Im GI, Kim DY, Shin JH, et al. Repair of cartilage defect in the rabbit with cultured mesenchymal stem cells from bone marrow. J Bone Joint Surg Br 2001; 83: 289–294.
23. Berninger MT, Wexel G, Rummeny EJ, et al. Treatment of osteochondral defects in the rabbit's knee joint by implantation of allogeneic mesenchymal stem cells in fibrin clots. J Vis Exp [serial online] 2013;(75):e4423. Available at: www.jove.com/video/4423/treatment-osteochondral-defects-rabbit-s-kneejoint-implantation. Accessed Oct 20, 2014.
24. Grigolo B, Lisignoli G, Desando G, et al. Osteoarthritis treated with mesenchymal stem cells on hyaluronan-based scaffold in rabbit. Tissue Eng Part C Methods 2009; 15: 647–658.
25. Guo X, Wang C, Duan C, et al. Repair of osteochondral defects with autologous chondrocytes seeded onto bioceramic scaffold in sheep. Tissue Eng 2004; 10: 1830–1840.
26. Yasuda H, Kuroda S, Shichinohe H, et al. Effect of biodegradable fibrin scaffold on survival, migration, and differentiation of transplanted bone marrow stromal cells after cortical injury in rats. J Neurosurg 2010; 112: 336–344.
27. Hicok KC, Du Laney TV, Zhou YS, et al. Human adipose-derived adult stem cells produce osteoid in vivo. Tissue Eng 2004; 10: 371–380.
28. Hattori H, Sato M, Masuoka K, et al. Osteogenic potential of human adipose tissue–derived stromal cells as an alternative stem cell source. Cells Tissues Organs 2004; 178: 2–12.
Appendix
Forward (F) and reverse (R) nucleotide sequences of primers used in an RT-PCR assay to amplify PPARγ2, aP2, Col I, Runx2, aggrecan, Col II, and GAPDH.
| Gene | Sequence of primers | Product length (bp) | GenBank accession No. | Annealing temperature (°C) | No. of cycles |
|---|---|---|---|---|---|
| PPARγ2 | F: GCGCCCTGGCAAAGCACT | 238 | AF103946 | 60 | 30 |
| R: TCCACGGAGCGAAACTGACAC | |||||
| aP2 | F: GGCCAAACCCAACCTGA | 167 | AF102872 | 58 | 30 |
| R: GGGCGCCTCCATCTAAG | |||||
| Col I | F: CCAAGAGGAGGGCCAAGAAGAAGG | 232 | AF201723 | 60 | 30 |
| R: GGGGCAGACGGGGCAGCACTC | |||||
| Runx2 | F: CAGACCAGCAGCACTCCATA | 171 | EU668154 | 58 | 30 |
| R: AACGCCATCGTTCTGGTTAG | |||||
| Aggrecan | F: TTCCCTGAGGCCGAGAAC | 194 | AF201722 | 67 | 42 |
| R: GGGCGGTAATGGAACACAAC | |||||
| Col II | F: CTGGAGCTCCTGGCCTCGTG | 138 | AF201724 | 67 | 42 |
| R: CAGATGCGCCTTTGGGACCAT | |||||
| GAPDH | F: GGGCATGAACCATGAGAAGT | 230 | AF017079 | 58 | 30 |
| R: AAGCAGGGATGATGTTCTGG |
