Phosphorus is an essential mineral that is involved in energy production, muscle and skeletal growth, and amino acid and carbohydrate metabolism in animals.1 Although the National Research Council's recommended dietary NPP requirement for White Leghorns is 250 mg/hen/d (dependent on performance and bone strength),2 most commercial diets for laying hens are formulated with high concentrations of phosphorus (0.34% to 0.45% NPP; 450 mg/hen/d) to avoid phosphorus deficiency.3,4 Results of multiple studies3–5 indicate no significant differences in the performance and egg quality among hens fed diets with NPP contents ranging from 0.20% to 0.45%; however, hens fed a 0.45% NPP diet had significantly higher phosphorus excretion, compared with hens fed diets with lower NPP contents.5 Dietary NPP content is positively correlated with plasma IgM concentration in European whitefish,6 antibody titers against sheep blood cells in broiler chickens,a and the cell-mediated immune response in pigs.7 The effect of high dietary NPP content on the immunity of laying hens is poorly understood.
Consumption of meat and eggs contaminated with bacteria, particularly Salmonella enterica serovar Typhimurium, is a major source of foodborne infections in humans.8 Therefore, control of Salmonella infection in chicken flocks is an important public health issue. In mammalian species, phosphorus status affects the immune response to Salmonella infection.9–11 The susceptibility of guinea pigs to experimental infection with virulent S Typhimurium was inversely associated with dietary phosphorus concentration.9 Three days after experimental infection, the clearance rate of S Typhimurium by the reticuloendothelial system for guinea pigs fed a diet with 1.0% phosphorus was significantly greater than that of guinea pigs fed a diet with 0.4% phosphorus.11 To our knowledge, information regarding the effect of dietary NPP content on the immune response in chickens infected with Salmonella spp is lacking.
In avian species, cytokines have an integral role in the immune response against Salmonella infection.12 Changes in cytokine expression following infection with Salmonella spp have been investigated in avian epithelial cells and monocytes in vitro13–15 and in newly hatched chickens in vivo.16–18 Interferon-γ, IL-12, and IL-18 are associated with a protective immune response, whereas IL-4 and IL-10 aid in the downregulation of the inflammatory response against Salmonella spp.19 The aim of the study reported here was to investigate the effect of high dietary concentrations of NPP on the intestinal lymphocyte subpopulations and the expression of various cytokines in the cecal tonsil and spleen of laying hens experimentally infected with S Typhimurium.
Materials and Methods
Animals
Sixty-four 50-week-old Roman hens were selected from a Salmonella-free flock.b Hens that were not laying eggs or laying eggs with defective shells were excluded from the study population. All hens were seronegative for antibodies against Salmonella spp as determined by a commercial ELISAc that was performed in accordance with the manufacturer's instructions. Cloacal swab specimens were obtained from each hen and cultured for Salmonella spp as described20 to ensure that the selected hens were Salmonella-free. The hens were transferred to adjacent individual cages in an environmentally controlled biosafety level 2 building and allowed to acclimate for 7 days. Hens had ad libitum access to food and water and were maintained in 16 hours of light and 8 hours of darkness each day. All study protocols were approved by and conducted under the guidelines of the Animal Health and Care Committee of Sichuan Agricultural University.
Diets
Hens were randomly allocated by means of a computerized random-number generator to receive a diet that contained either 0.22% (control diet; n = 32) or 0.42% (high-P diet; 32) NPP for 6 weeks (Appendix 1). The diets were formulated to contain adequate concentrations of all nutrients as recommended by the National Research Council2 and did not contain any antimicrobial agents.
Salmonella Typhimurium strain
A spontaneous amikacin- and neomycin-resistant strain of S Typhimurium SC0906 obtained from the Veterinary Laboratory of Sichuan Agricultural University was used in the study. Salmonella Typhimurium SC0906 is virulent in young chicks < 7 days old and is capable of persistent colonization of the gastrointestinal tract of older birds. The bacteria were maintained in glycerol stock solution at −70°C. Prior to the experimental inoculation of hens, the stock bacteria solution was thawed and inoculated into sterile tubes that contained 10 mL of sterile tryptone soy broth,d and that S Typhimurium preculture solution was incubated at 37°C for 18 hours. Subsequently, 5 mL of the S Typhimurium preculture solution was transferred to 100 mL of tryptone soy broth and shaken and incubated at 37°C for 18 hours. To determine the concentration of viable S Typhimurium in the culture solution, 1-mL aliquots were serially diluted with sterile PBSS (pH, 7.2) to dilutions of 1:102 to 1:109, streaked on a culture plate containing xylose lysine deoxycholate agar,d and incubated at 37°C for 24 hours. Following incubation, black-colored bacterial colonies were counted, and the S Typhimurium culture solution was diluted with PBSS as necessary to achieve a concentration of 5 × 107 CFUs of S Typhimurium/mL.
Inoculation procedure
After the assigned diet had been fed for 6 weeks, 16 hens in the control and high-P diet groups were inoculated with 5 × 107 CFUs of S Typhimurium (1 mL of the culture solution), and the remaining 16 hens in each group were inoculated with 1 mL of PBSS (pH, 7.2). For both inoculations, a flexible tube was orally passed into the crop and a syringe was used to instill the assigned inoculant directly into the crop. Within each group, the S Typhimurium–inoculated hens were isolated in a room separate from the PBSS-inoculated hens; however, the light-and-dark schedule, temperature, and other rearing conditions were held constant for all hens.
Sample collection
Within both the control and high-P groups, 8 S Typhimurium–inoculated and 8 PBSS-inoculated hens were euthanized by means of IV injection of sodium pentobarbital (20 mg/kg) at 2 and 7 DPI. From each hen, 5 mL of blood was obtained from the right wing for determination of plasma biochemical variables associated with phosphorus metabolism. A 5-cm portion of the ileum approximately 5 cm proximal to the ileocecal junction was obtained aseptically for isolation of ileal lymphocytes. The cecal tonsils and spleen were obtained and frozen in liquid nitrogen, then stored at −80°C until analyzed for cytokine expression by means of RNA extraction and measurement.
Plasma biochemical variables
Plasma calcium and phosphorus concentrations were determined by the use of commercial assay kitse and an automated biochemical analyzer.f Plasma PTH concentration was determined by use of a radioimmunoassay.g Plasma 1,25-dihydroxyvitamin D3 concentration was determined by use of a commercially available ELISA.h
Ileal lymphocyte subpopulations
For each ileum specimen, the mucosa was scraped and washed with ice-cold HBSS without calcium chloride and magnesium sulfate.i The mucosa was then treated with 10mM dithiothreitoli in calcium- and magnesium-free HBSS with 5% fetal bovine serumj and incubated in 100μM EDTA in calcium- and magnesium-free HBSS with 5% fetal bovine serum at 37°C for 20 minutes with continuous swirling. The solution was then gently squeezed through a nylon mesh by use of a syringe plunger to prepare the cell suspension. The cell suspension was diluted with lymphocyte separation medium (density, 1.077 g/mL) and centrifuged at 200 × g for 20 minutes. The lymphocyte layer was collected and transferred to another centrifuge tube to which 2 mL of PBSS was added. The tube was centrifuged at 200 × g for 5 minutes, and the supernatant was discarded. The number of lymphocytes in the remaining pellet was calculated by use of a Neubauer counting chamber.k The trypan blue dye exclusion method was used to determine cell viability, which was consistently > 95%. Viable cells were diluted with PBSS to achieve a concentration of 1.0 × 106 cells/mL, and 1 mL of the cell suspension was transferred to another centrifuge tube and centrifuged at 200 × g for 5 minutes. The supernatant was discarded. Cells were stained with 10 μL of mouse anti-chicken CD4 coupled to phyto-erythrinl and mouse anti-chicken CD8α coupled to fluorescein isothiocyanatek for 15 minutes at room temperature (22 ± 2°C). Then 2 mL of PBSS was added to the tube and centrifugal elutriation was performed once. The supernatant was discarded. The cells were resuspended in 0.5 mL of PBSS, and within 45 minutes, the numbers of CD4+ and CD8+ lymphocytes in the suspension were determined by flow cytometry.m
Quantitative real-time PCR assay
A qualitative real-time PCR assayn was performed to extract the total RNA from each cecal tonsil and spleen specimen as described.21,22 The primers and annealing temperatures used for IL-1β, IL-6, IFN-γ, IL-4, IL-8, IL-10, IL-12, IL-18, and β-actin were summarized (Appendix 2). Amplification was conducted with denaturation for 15 minutes at 95°C, followed by 40 cycles of denaturation for 5 seconds at 95°C, and annealing and elongation for 30 seconds at specific temperatures for the various genes, and a final melting curve analysis. All reactions were run in duplicate, and the real-time PCR assay efficiency for each gene was calculated from the slope of the standard curve for that gene. The corresponding real-time PCR assay efficiency (E) of 1 cycle in the exponential phase was calculated as E = 10−1/slope. The relative expression ratio of a target gene was calculated from E and the cycle number of the crossing point (CP) deviation of the unknown sample versus a calibrator, and expressed in comparison to a reference gene.23
where ET is the real-time PCR assay efficiency of the target gene transcript, ER is the real-time PCR assay efficiency of the reference gene transcript, ΔCPtarget is the CP deviation of the calibrator - sample of the target gene transcript, and ΔCPreference is the CP deviation of the calibrator – sample of the reference gene transcript.
Statistical analysis
Descriptive statistics were calculated for each outcome of interest (plasma calcium, phosphorus, PTH, and 1,25-dihydroxyvitamin D3 concentrations; percentage of CD4+ and CD8+ lymphocytes in the ileal mucosa; and IL-1β, IL-6, IFN-γ, IL-4, IL-8, IL-10, IL-12, IL-18, and β-actin expression in the cecal tonsils and spleen). The distributions of the data for each outcome were analyzed for normality by means of a univariate procedure as described.24 Some data were transformed to improve the normality of the distributions for parametric analysis. Data for IL-8, IFN-γ, and IL-12 expression in the cecal tonsils were logarithmically transformed, and the inverse square root transformation was applied to the data for IL-10 expression in the cecal tonsil and IL-8, IFN-γ, IL-18 expression in the spleen. The study had a randomized complete design, and each outcome of interest was analyzed with a mixed ANOVA as described.24 Main (fixed) effects included in each model included dietary NPP content, inoculant (PBSS or S Typhimurium), postinoculation time (2 or 7 DPI), and all possible 2-way interactions among the main effects. Random effects included the effect of each subject, and the interactions between subject and dietary NPP content and between subject and inoculant. Differences among means were tested by the least significant difference method. All analyses were performed with a commercially available statistical software program,o and values of P < 0.05 were considered significant.
Results
Plasma biochemical variables
Plasma concentrations of calcium, phosphorus, PTH, and 1,25-dihydroxyvitamin D3 for hens in each treatment group (DPI-inoculant-diet combination) were summarized (Table 1). The plasma calcium, PTH, and 1,25-dihydroxyvitamin D3 concentrations were significantly affected by the dietary NPP content, inoculant (PBSS or S Typhimurium), and the interaction between dietary NPP content and inoculant, whereas the plasma phosphorus concentration was significantly affected only by the inoculant. For hens inoculated with S Typhimurium, the plasma calcium and phosphorus concentrations were significantly decreased, compared with those for hens inoculated with PBSS, but did not differ significantly between hens at 2 and 7 DPI. Inoculation of hens with S Typhimurium significantly increased plasma 1,25-dihydroxyvitamin D3 concentration; however, the magnitude of that increase was greater for the hens fed the control diet, compared with that for hens fed the high-P diet. Inoculation with S Typhimurium also increased the plasma PTH concentration of hens fed the high-P diet but did not significantly affect the plasma PTH concentration of hens fed the control diet.
Mean ± SD values for select plasma biochemical variables at 2 and 7 DPI for laying hens that were fed a diet with 0.22% (control) or 0.42% (high-P) NPP for 6 weeks and then inoculated with 1 mL of PBSS or Salmonella enteritidis serovar Typhimurium (5 × 107 CFUs/mL).
| 2 DPI | 7 DPI | |||||||
|---|---|---|---|---|---|---|---|---|
| Control diet | High-P diet | Control diet | High-P diet | |||||
| Variable | PBSS | S Typhimurium | PBSS | S Typhimurium | PBSS | S Typhimurium | PBSS | S Typhimurium |
| Calcium (mmol/L) | 3.97 ± 0.24c | 2.74 ± 0.17a | 3.58 ± 0.23b | 2.87 ± 0.15a | 3.94 ± 0.22c | 2.79 ± 0.16a | 3.51 ± 0.25b | 2.73 ± 0.20a |
| Phosphorus (μmol/L) | 2.02 ± 0.22b | 1.38 ± 0.08a | 1.98 ± 0.29b | 1.35 ± 0.18a | 1.92 ± 0.25b | 1.36 ± 0.16a | 2.05 ± 0.22b | 1.34 ± 0.20a |
| PTH (μmol/L) | 84.3 ± 6.68ab | 83.8 ± 6.11a,b | 92.2 ± 9.21b,c | 104.5 ± 7.12d | 80.9 ± 8.77a | 81.4 ± 8.25a | 93.4 ± 6.34c | 111.9 ± 8.02d |
| 1,25-dihydroxyvitamin D3 (μmol/L) | 37.4 ± 2.11a | 62.0 ± 7.02c | 37.7 ± 3.25a | 49.4 ± 4.47b | 39.0 ± 5.61a | 66.1 ± 10.16c | 37.6 ± 6.30a | 51.3 ± 2.39b |
The inoculant was instilled through a flexible tube that was passed orally into the crop. For each DPI-diet-inoculant combination, the value represents the mean ± SD for 8 hens.
Within a row, values with different superscripts differ significantly (P < 0.05).
Intestinal lymphocyte subpopulations
The percentage of CD4+ lymphocytes in the ileal mucosa was significantly affected by the dietary NPP content (P < 0.001), inoculant (P = 0.004), number of DPI (P < 0.001), and the interaction between dietary NPP content and the number of DPI (P = 0.049). The percentage of ileal CD4+ lymphocytes was significantly greater in hens fed the high-P diet versus hens fed the control diet regardless of the inoculant (Figure 1). Following inoculation with S Typhimurium, hens fed the high-P diet had a greater percentage of ileal CD4+ lymphocytes than did hens fed the control diet, and the percentage of CD4+ lymphocytes for hens fed the high-P diet at 2 DPI was significantly greater than that for hens fed the control diet at 7 DPI.
The percentage of CD8+ lymphocytes in the ileal mucosa was significantly affected by the dietary NPP content (P < 0.001) and the inoculant (P < 0.001). Hens fed the high-P diet had a significantly greater percentage of ileal CD8+ lymphocytes than did hens fed the control diet (Figure 1). Inoculation with S Typhimurium also significantly increased the percentage of ileal CD8+ lymphocytes regardless of the diet fed.
Percentage of CD4+ (A) and CD8+ (B) lymphocytes in the ileal mucosa at 2 and 7 DPI for laying hens that were fed a diet with 0.22% (control [gray bars]; n = 32) or 0.42% (high-P [black bars]; 32) NPP for 6 weeks and then inoculated with 1 mL of PBSS or Salmonella enteritidis serovar Typhimurium (5 × 107 CFUs/mL). The inoculant was instilled through a flexible tube that was passed orally into the crop. Each bar and bracket represents the mean and SD for 8 hens. Values represented by bars with different letters differ significantly (P < 0.05). Notice that the y-axis scale differs for each panel.
Citation: American Journal of Veterinary Research 76, 8; 10.2460/ajvr.76.8.710
Cytokine expression in the cecal tonsils
The expression of mRNA for all genes evaluated was normalized to the expression of mRNA for β-actin (ie, relative expression). The relative expression of mRNA for the cytokines evaluated in the cecal tonsils was summarized (Table 2). The inoculant significantly (P < 0.001) affected the expression of all cytokines evaluated. Compared with hens inoculated with PBSS, hens inoculated with S Typhimurium had significantly increased expression of IL-1β, IL-6, IFN-γ, and IL-18 and decreased expression of IL-10. Hens inoculated with S Typhimurium had increased expression of IL-8 regardless of the diet fed, and the magnitude of that increase was significantly greater at 7 DPI than that at 2 DPI. Similarly, hens inoculated with S Typhimurium had significantly increased expression of IL-12, and the magnitude of that increase was significantly greater at 7 DPI than that at 2 DPI. Expression of IL-12 was also significantly affected by an interaction between dietary NPP content and inoculant. Expression of IL-4 was significantly decreased in hens fed the high-P diet and inoculated with S Typhimurium, compared with that in hens fed the control diet and inoculated with PBSS, which indicated a significant interaction between dietary NPP content and inoculant.
Mean ± SD values for relative expression of the mRNA of various cytokines in the cecal tonsils for the hens of Table 1.
| 2 DPI | 7 DPI | |||||||
|---|---|---|---|---|---|---|---|---|
| Control diet | High-P diet | Control diet | High-P diet | |||||
| Cytokine | PBSS | S Typhimurium | PBSS | S Typhimurium | PBSS | S Typhimurium | PBSS | S Typhimurium |
| IL-1β | 16.8 ± 5.81a | 70.3 ± 12.9b | 16.3 ± 3.58a | 78.0 ± 13.4b | 16.8 ± 2.98a | 78.5 ± 12.9b | 16.7 ± 5.81a | 79.9 ± 12.0b |
| IL-6 | 14.8 ± 2.37a | 45.7 ± 4.02b,c | 15.4 ± 3.58a | 45.0 ± 1.99b | 15.4 ± 1.77a | 48.3 ± 3.07c | 15.6 ± 1.89a | 43.9 ± 3.43b |
| IL-8 | 1.03 ± 0.20a | 50.3 ± 5.89b | 1.09 ± 0.14a | 60.5 ± 14.3b | 1.05 ± 0.26a | 400 ± 55.3c | 1.06 ± 0.24a | 381 ± 28.4c |
| IFN-γ | 1.92 ± 0.28a | 104 ± 12.9b | 1.85 ± 0.29a | 114 ± 13.5b | 2.15 ± 0.26a | 111 ± 16.1b | 2.02 ± 0.20a | 110 ± 8.60b |
| Il-4 | 4.82 ± 0.86e | 3.04 ± 0.32d | 1.98 ± 0.38b,c | 1.48 ± 0.28ab | 4.66 ± 0.70e | 3.00 ± 0.48d | 2.17 ± 0.43c | 1.33 ± 0.29a |
| IL-10 | 156 ± 21.4b | 30.3 ± 8.9a | 158 ± 20.7b | 30.5 ± 9.7a | 154 ± 22.1b | 31.9 ± 7.5a | 160 ± 26.4b | 29.3 ± 6.7a |
| IL-12 | 1.03 ± 0.12a | 36.9 ± 1.94b | 1.19 ± 0.09a | 45.4 ± 4.30c | 1.04 ± 0.18a | 74.4 ± 3.82d | 1.15 ± 0.10a | 77.0 ± 3.89d |
| IL-18 | 36.9 ± 4.2a | 77.6 ± 4.8b | 38.9 ± 5.0a | 76.1 ± 6.1b | 36.4 ± 3.5a | 77.8 ± 6.7b | 37.6 ± 5.4a | 78.2 ± 7.6b |
Gene expression was normalized to β-actin expression (ie, relative expression).
See Table 1 for remainder of key.
Cytokine expression in the spleen
Cytokine expression in the spleen varied from that in the cecal tonsils (Table 3). Expression of IL-12 was significantly affected by all main factors evaluated (ie, dietary NPP content, inoculant, number of DPI, and the interactions between dietary NPP content and number of DPI, between dietary NPP content and inoculant, and between inoculant and number of DPI), whereas expression of IL-4 was not significantly affected by any of the main effects. Expression of IL-1β in the spleen was significantly affected by dietary NPP content (P = 0.013) and inoculant (P < 0.001). Expression of IL-1β was greater in hens fed the high-P diet, compared with that in hens fed the control diet, and S Typhimurium-inoculated hens had significantly increased IL-1β expression, compared with that of PBSS-inoculated hens. Expression of IL-6 and IL-18 was significantly affected by dietary NPP content, inoculant, and the interaction between dietary NPP content and inoculant. Splenic expression of both IL-6 and IL-18 was generally greater in hens fed the high-P diet, compared with that in hens fed the control diet, and was significantly greater in hens inoculated with S Typhimurium, compared with that in hens inoculated with PBSS. Expression of IL-8 was significantly affected by inoculant (P < 0.001), number of DPI (P < 0.001), and the interaction between inoculant and number of DPI (P < 0.001). Splenic expression of IL-8 in hens inoculated with S Typhimurium was generally greater than that in hens inoculated with PBSS, and the magnitude of that increase was greater in hens at 7 DPI than in hens at 2 DPI. Expression of IL-10 was significantly affected by inoculant (P = 0.005), number of DPI (P = 0.010), and the interactions between dietary NPP content and number of DPI (P = 0.006) and between inoculant and number of DPI (P < 0.001). Splenic expression of IL-10 was generally greater in hens inoculated with S Typhimurium, compared with that in hens inoculated with PBSS, and the magnitude of that increase was greater in hens at 7 DPI that were fed the high-P diet, compared with that in hens at 2 DPI that were fed the control diet. Expression of IFN-γ was significantly affected by dietary NPP content (P = 0.011), inoculant (P < 0.001), number of DPI (P < 0.001), and the interaction between inoculant and number of DPI (P < 0.001). Splenic expression of IFN-γ did not differ significantly among hens inoculated with PBSS regardless of diet or number of DPI. Inoculation of hens with S Typhimurium tended to cause a significant increase in IFN-γ expression, and the magnitude of that increase was greater at 7 DPI than at 2 DPI.
Mean ± SD values for relative expression of the mRNA of various cytokines in the spleen for the hens of Table 1.
| 2 DPI | 7 DPI | |||||||
|---|---|---|---|---|---|---|---|---|
| Control diet | High-P diet | Control diet | High-P diet | |||||
| Cytokine | PBSS | S Typhimurium | PBSS | S Typhimurium | PBSS | S Typhimurium | PBSS | S Typhimurium |
| IL-lβ | 5.55 ± 2.13a,b | 7.84 ± 2.18c,d | 6.79 ± 1.78a,b,c | 9.61 ± 1.82d | 4.84 ± 1.51a | 7.49 ± 1.49b,c | 5.09 ± 1.80a | 9.60 ± 1.42d |
| IL-6 | 5.27 ± 1.34a | 7.32 ± 2.45a,b,c | 5.45 ± 2.03a | 8.89 ± 2.48b,c | 6.77 ± 1.44ab | 5.43 ± 1.77a | 7.12 ± 3.46a,b,c | 9.68 ± 3.46c |
| IL-8 | 6.43 ± 1.92b | 6.12 ± 1.36b | 6.24 ± 2.48b | 8.94 ± 1.98b | 6.30 ± 2.06b | 16.5 ± 2.79a | 6.74 ± 1.83b | 19.1 ± 4.06a |
| IFN-γ | 0.80 ± 0.26a | 2.24 ± 0.39a | 1.05 ± 0.71a | 8.43 ± 2.63b | 1.10 ± 0.39a | 17.8 ± 5.57c | 1.36 ± 0.49a | 20.8 ± 6.42c |
| Il-4 | 3.37 ± 0.71 | 3.49 ± 1.29 | 4.42 ± 1.42 | 3.97 ± 1.47 | 3.38 ± 1.30 | 3.73 ± 0.98 | 3.55 ± 1.36 | 4.71 ± 1.58 |
| IL-10 | 7.05 ± 2.77a,b,c | 8.02 ± 2.79b,c | 8.33 ± 2.89b,c | 4.62 ± 1.15a | 5.50 ± 1.74a,b | 9.30 ± 2.13c | 6.80 ± 1.67a,b,c | 14.1 ± 3.64d |
| IL-12 | 4.62 ± 2.15a | 4.97 ± 1.89a | 4.42 ± 2.04a | 5.63 ± 1.70a | 5.03 ± 2.09a | 6.56 ± 1.79a | 5.84 ± 2.49a | 16.0 ± 3.63b |
| IL-18 | 5.17 ± 2.44a | 12.8 ± 2.16b | 5.77 ± 2.73a | 16.4 ± 4.03c,d | 4.95 ± 1.40a | 13.8 ± 2.30b,c | 4.83 ± 1.90a | 19.2 ± 4.86d |
See Tables 1 and 2 for key.
Discussion
Results of the present study suggested that there was a Th1–cytokine reaction in the cecal tonsils and spleen of S Typhimurium–inoculated hens, and dietary NPP content altered the plasma concentrations of calcium regulation hormones and affected splenic cytokine expression. Thus, feeding laying hens a diet with a high NPP content might improve the immune response of hens exposed to S Typhimurium.
Characterization of the metabolic effects associated with an immunologic challenge is important for the maintenance of nutrient homeostasis during an infection.25 The immune response to an infection generally results in the release of various cytokines from activated macrophages.26 In the present study, plasma calcium and phosphorus concentrations were significantly decreased in hens orally inoculated with S Typhimurium, compared with those in hens inoculated with PBSS. This finding was similar to results of another study27 in which the serum calcium and phosphorus concentrations of sows following intramammary infusion of lipopolysaccharide were significantly decreased, compared with those of sows following intramammary infusion of saline (0.9% NaCl) solution. Serum calcium and phosphorus concentrations are likewise decreased in dairy cows following IV infusion of Escherichia coli endotoxin.28 Additionally, in the present study, hens fed the high-P diet and inoculated with S Typhimurium had significantly greater plasma PTH and 1,25-dihydroxyvitamin D3 concentrations than did hens inoculated with PBSS, which suggested that the immune response of hens against S Typhimurium might activate osteolysis by osteoclasts, thereby increasing mobilization of calcium and phosphorus from bone. To our knowledge, studies conducted to investigate the effect of immune system activation on macromineral homeostasis are lacking. It is possible that the decrease in plasma calcium and phosphorus concentrations observed in the S Typhimurium–inoculated hens of the present study was caused by the immune response to the bacterium, which resulted in an increased demand for calcium and phosphorus to meet requirements for cellular energy metabolism and nucleic acid formation.
Cell-mediated immunity is critical for the protection of young chickens against S Typhimurium infection,29 but the cell-mediated immune response of mature laying hens against Salmonella infection remains to be elucidated. In the present study, laying hens orally inoculated with S Typhimurium had a significantly greater proportion of ileal CD8+ lymphocytes at 2 and 7 DPI than did hens inoculated with PBSS. This finding suggested that S Typhimurium inoculation caused a strong cell-mediated immune response in hens. A similar increase in the proportion of CD8+ lymphocytes in the cecum and spleen has been observed in young chickens following inoculation with S Typhimurium30 or Salmonella Enteritidis31; however, the time required after inoculation for that increase to develop (4 to 5 DPI) was longer than that required (2 DPI) in the mature hens of the present study. This delay in the cell-mediated response of young chickens might simply be the result of an immature intestinal immune system. Regardless, results of the present study and those other studies30,31 indicated that the important role of CD8+ lymphocytes in the neutralization or killing of S Typhimurium in chickens is similar to that described in mammalian species.32
In the present study, the percentage of CD4+ lymphocytes at 7 DPI was also significantly increased for S Typhimurium–inoculated hens, compared with that for PBSS-inoculated hens. A similar increase in the percentage of intestinal CD4+ lymphocytes was observed in naïve mice that were inoculated with virulent S Typhimurium.33 The increase in the proportion of CD4+ lymphocytes in the intestine might enhance the cytotoxic immune response that mediates the activation of CD8+ lymphocytes and macrophages in hens infected with S Typhimurium in a manner analogous to that described in mice.33
Hens fed the high-P diet had an increase in the proportions of CD8+ and CD4+ lymphocytes in the ileal mucosa irrespective of whether they were inoculated with S Typhimurium. The addition of phytase to the diet of broilers increases phosphorus release, which in turn causes an increase in the proportion of CD4+ and CD8+ T cells in the blood.34 The percentage of circulating leukocytes was greater in guinea pigs fed a diet with a high phosphorus content, compared with that in guinea pigs fed a control diet.10 Results of multiple studies35–37 indicate that PTH stimulates various components of the immune system including peripheral blood lymphocytes and causes T-lymphocyte proliferation. In the present study, the plasma calcium concentration for hens fed the high-P (0.42% NPP) diet was significantly lower than that for hens fed the control (0.22% NPP) diet. This decrease in plasma calcium concentration might have stimulated the release of PTH, which may have primed the immune system, making it better prepared to process and eliminate pathogens. In humans, 1,25-dihyrdoxyvitamin D3 decreases proliferation of peripheral blood mononuclear cells38 and suppresses IL-2 production and proliferation of lymphocytes stimulated by phytohemagglutinin.39 The lower proportions of CD4+ and CD8+ lymphocytes in the ileal mucosa might be associated with the decrease in plasma PTH concentration and the increase in plasma 1,25-dihydroxyvitamin D3 concentration in the hens fed the control diet, as compared with those fed the high-P diet.
Results of the present study indicated that inoculation of laying hens with S Typhimurium caused an increase in the mRNA expression of IL-1β, IL-6, and IL-8 in the cecal tonsils and spleen at 2 and 7 DPI, and were similar to findings of other studies16,17 that involved newly hatched chicks. Activation of macrophages and T lymphocytes by IL-6 may prime the acquired immune system,40 and IL-8 may act as a chemokine to recruit heterophils in chickens.17 Hens that were inoculated with S Typhimurium had greater recruitment of immune cells in the intestine than did hens inoculated with PBSS, and had greater expression of IL-6 and IL-8 in the cecal tonsils at 7 DPI than at 2 DPI, which likely was a reflection of the late expression pattern for those cytokines.17 Interferon-γ has a critical role in the elimination of intercellular pathogens such as Salmonella spp41,42 because it is a necessary Th1 cytokine for macrophage activation.43 Expression of IFN-γ was increased in the cecal tonsils and spleen at 2 and 7 DPI in the S Typhimurium–inoculated hens of the present study, in the cecal tonsils of 1-day-old chicks that were inoculated with 107 CFUs of S Enteritidis,18 and in the spleen of 1-week-old chicks that were inoculated with 108 CFUs of S Typhimurium.17 Interleukin-12 and IL-18 induce production of IFN-γ,44,45 whereas IL-4 antagonizes IFN-γ function and suppresses the inflammatory immune response,46,47 and IL-10 inhibits expression of major histocompatability complex class 2 and costimulatory molecules.48 In the present study, inoculation of hens with S Typhimurium caused an increase in the expression of IL-12 and IL-18 in the cecal tonsils and had no apparent effect on IL-4 and IL-10 expression, which indicated an important adaptation by the immune system to increase antigen presentation capability and mount a proinflammatory response.49 Inoculation of young chicks with various S enterica serovars also increased expression of IL-12 and IL-18 in the cecal tonsils18,50; however, inoculation of young chicks with S Typhimurium did not affect IL-10 expression in the cecal tonsils at 1 and 5 DPI.50,51 The prominent increase in IFN-γ expression and concurrent increase in the expression of IL-12 and IL-18 detected in the S Typhimurium–inoculated hens of the present study and young chicks of other studies17,51 indicate the importance of the Th1 immune response against Salmonella infection.
For the PBSS-inoculated hens of the present study, dietary NPP content did not affect the expression of any cytokine in the cecal tonsils except IL-4, which was significantly decreased in hens fed the high-P diet, compared with that in hens fed the control diet. Conversely, for the S Typhimurium–inoculated hens, splenic expression of IFN-γ at 2 DPI and IL-12 and IL-18 at 7 DPI was increased in hens fed the high-P diet, compared with that in hens fed the control diet. These results suggested that the Th1 immune response of laying hens against Salmonella infection was enhanced by an increase in dietary NPP intake. 1,25-dihydroxyvitamin D3 suppresses IL-2 production39 and inhibits the development of Th1 cells that produce IFN-γ.52,53 The lower plasma 1,25-dihydroxyvitamin D3 concentrations observed in hens fed the high-P diet, compared with those in hens fed the control diet, likely contributed to the increase in the splenic expression of Th1 cytokines in hens that were inoculated with S Typhimurium. In the present study, IL-4 expression in the cecal tonsils of hens fed the high-P diet was significantly decreased, compared with that of hens fed the control diet. Parathyroid hormone interacts with IL-4 to inhibit immunoglobulin production.54 Consequently, high dietary NPP content might decrease IL-4 expression, which in turn could reduce the inhibition of immunoglobulin production by PTH and enhance the adaptive immune response.
In the present study, inoculation of laying hens with S Typhimurium induced a cell-mediated immune response that was characterized by an increase in the expression of various Th1 cytokines in the cecal tonsils and spleen. That immune response was enhanced in hens fed a diet with a high (0.42%) NPP content versus hens fed a diet with a low (0.22%) NPP content.
Acknowledgments
Supported by grants from the Specific Research Team Supporting Program of Sichuan Agricultural University, Laying Hens Industry Chain Program of Sichuan Province (2011NZ0073; 2014NZ0002), and Safety Production Technology Integration and Demonstration of Livestock and Poultry Products (2014BAD13B04).
The authors thank Brittany B. Rice for assistance with manuscript preparation.
The authors declare that they have no conflicts of interest.
ABBREVIATIONS
| DPI | Days postinoculation |
| HBSS | Hanks balanced salt solution |
| IFN | Interferon |
| IL | Interleukin |
| NPP | Nonphytate phosphorus |
| PTH | Parathyroid hormone |
| Th | T helper |
Footnotes
Aslam SM. Immune functions in broiler chicks as influenced by dietary phosphorus and vitamin D. PhD dissertation, North Carolina State University, Raleigh, NC, 1995.
Poultry Research Center, Sichuan Agricultural University, Ya'an, China.
Sun Biomedical Technology Co Ltd, Beijing, China.
Qingdao Haibo Bio-tech Co Ltd, Qingdao, China.
Nanjing Jiancheng Biotechnology Institute, Nanjing, China.
Model Hitachi 917, Hitachi Co Ltd, Tokyo, Japan.
Northern Institute of Biotechnology, Beijing, China.
DRG Instruments GmbH, Marburg, Germany.
TaKaRa, Dalian, China.
Zhejing Tianhang Biological Technology Co Ltd, Hanzhou, China.
Hausser Scientific, Blue Bell, Pa.
Pharmingen, BD, Franklin Lakes, NJ.
FACSCalibur, BD, Franklin Lakes, NJ.
CFX96 Touch Deep Well Real-Time PCR Detection System, Bio-Rad Laboratories, Hercules, Calif.
PROC MIXED, SAS, version 9.3, SAS Institute Inc, Cary, NC.
References
1. Pond WG, Church DC, Pond KR, et al. Basic animal nutrition and feeding. 5th ed. Hoboken, NJ: Wiley, 2005; 125.
2. National Research Council. Nutrient requirements of poultry. Washington, DC: National Academy Press, 1994; 19.
3. Keshavarz K. Nonphytate phosphorus requirement of laying hens with and without phytase on a phase feeding program. Poult Sci 2000; 79: 748–763.
4. Boling SD, Douglas MW, Johnson ML, et al. The effects of dietary available phosphorus levels and phytase on performance of young and older laying hens. Poult Sci 2000; 79: 224–230.
5. Snow JL, Rafacz KA, Utterback PL, et al. Hy-Line W-36 and Hy-Line W-98 laying hens respond similarly to dietary phosphorus levels. Poult Sci 2005; 84: 757–763.
6. Jokinen EI, Vielms J, Anltonen TM, et al. The effect of dietary phosphorus deficiency on the immune responses of European whitefish (Coregonus lavaretus L.). Fish Shellfish Immunol 2003; 15: 159–168.
7. Kegley EB, Spears JW, Auman SK. Dietary phosphorus and an inflammatory challenge affect performance and immune function of weanling pigs. J Anim Sci 2001; 79: 413–419.
8. Humphrey TJ. Contamination of eggs and poultry meat with Salmonella enterica serovar Enteritidis. In: Saeed AM, ed. Salmonella enterica serovar Enteritidis in humans and animals: epidemiology, pathogenesis and control. Ames, Iowa: Iowa University State Press, 1999; 183–192.
9. Nabb DP, O'Dell BL. Influence of dietary factors upon Salmonella typhimurium infection in the guinea pig. J Nutr 1964; 84: 191–199.
10. Doak RL, Garner GB, Huebner PF, et al. Effect of dietary phosphorus on blood phosphorus and leukocyte levels in experimental salmonellosis. Proc Soc Exp Biol Med 1972; 141: 953–957.
11. Doak RL, Garner GB, O'Dell BL. Effect of dietary phosphorus on reticuloendothelial clearance of Salmonella organisms in endotoxin treated guinea pigs. Life Sci 1973; 13: 959–968.
12. Swaggerty CL, Kaiser P, Rothwell L, et al. Heterophil cytokine mRNA profiles from genetically distinct lines of chickens with differential heterophil-mediated innate immune responses. Avian Pathol 2006; 35: 102–108.
13. Kaiser P, Rothwell L, Galyov EE, et al. Differential cytokine expression in avian cells in response to invasion by Salmonella typhimurium, Salmonella enteritidis and Salmonella gallinarum. Microbiology 2000; 146: 3217–3226.
14. Kaiser MG, Cheeseman JH, Kaiser P, et al. Cytokine expression in chicken peripheral blood mononuclear cells after in vitro exposure to Salmonella enterica serovar Enteritidis. Poult Sci 2006; 85: 1907–1911.
15. Li S, Zhang MZ, Yan L, et al. Induction of CXC chemokine messenger-RNA expression in chicken oviduct epithelial cells by Salmonella enterica serovar Enteritidis via the type three secretion system-1. Avian Dis 2009; 53: 396–404.
16. Withanage GS, Kaiser P, Wigley P, et al. Rapid expression of chemokines and proinflammatory cytokines in newly hatched chickens infected with Salmonella enterica serovar Typhimurium. Infect Immun 2004; 72: 2152–2159.
17. Withanage GS, Wigley P, Kaiser P, et al. Cytokine and chemokine responses associated with clearance of a primary Salmonella enterica serovar Typhimurium infection in the chicken and in protective immunity to rechallenge. Infect Immun 2005; 73: 5173–5182.
18. Berndt A, Wilhelm A, Jugert C, et al. Chicken cecum immune response to Salmonella enterica serovars of different levels of invasiveness. Infect Immun 2007; 75: 5993–6007.
19. Eckmann L, Kagnoff MF. Cytokines in host defense against Salmonella. Microbes Infect 2001; 3: 1191–1200.
20. Methner U, Al-Shabibi S, Meyer H. Experimental oral infection of specific pathogen-free laying hens and cocks with Salmonella Enteritidis strains. Zentralbl Veterinarmed B 1995; 42: 459–469.
21. Pan Z, Fang Q, Geng S, et al. Analysis of immune-related gene expression in chicken peripheral blood mononuclear cells following Salmonella enterica serovar Enteritidis infection in vitro. Res Vet Sci 2012; 93: 716–720.
22. Hong YH, Lillehoj HS, Lillehoj EP, et al. Changes in immune-related gene expression and intestinal lymphocyte subpopulations following Eimeria maxima infection of chickens. Vet Immunol Immunopathol 2006; 114: 259–272.
23. Pfaffl MW. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res 2001; 29: e45.
24. SAS user's guide: statistics. Version 9.03. Cary, NC: SAS Institute Inc, 2003;2085–2220.
25. Adi S, Pollock AS, Shigenage JK, et al. Role of monokines in the metabolic effects of endotoxin. J Clin Invest 1992; 89: 1603–1609.
26. Webel DM, Finck BN, Baker DH, et al. Time course of increased plasma cytokines, cortisol, and urea nitrogen in pigs following intraperitoneal injection of lipopolysaccharide. J Anim Sci 1997; 75: 1514–1520.
27. Wang JF, Wang M, Ma JL, et al. The influence of intramammary lipopolysaccharide infusion on serum Ca, P, vitamin D, cytokines and cortisol concentrations in lactating sows. J Vet Med A Physiol Pathol Clin Med 2006; 53: 113–118.
28. Sandstedt H, Larsson L, Kvart C. Effect of E. coli ectotoxin on calcium and phosphate concentration in serum of dairy cows. Nord Vet Med 1984; 36: 406–407.
29. Sasai K, Yoshimura K, Lillehoj HS, et al. Analysis of splenic and thymic lymphocyte subpopulations in chickens infected with Salmonella enteritidis. Vet Immunol Immunopathol 1997; 59: 359–367.
30. Berndt A, Methner U. Gamma/delta T cell response of chickens after oral administration of attenuated and non-attenuated Salmonella typhimurium strains. Vet Immunol Immunopathol 2001; 78: 143–161.
31. Noujaim JC, Andreatti Filho RL, Lima ET, et al. Detection of T lymphocytes in intestine of broiler chicks treated with Lactobacillus spp. and challenged with Salmonella enterica serovar Enteritidis. Poult Sci 2008; 87: 927–933.
32. Briles DE, Benjamin W Jr, Posey B, et al. Independence of macrophage activation and expression of the alleles of the Ity (immunity to Typhimurium) locus. Microb Pathog 1986; 1: 33–41.
33. Mastroeni P, Villarreal-Ramos B, Hormaeche CE. Effect of late administration of anti-TNF alpha antibodies on a Salmonella infection in the mouse model. Microb Pathog 1993; 14: 473–480.
34. Liu N, Ru YJ, Cowieson AJ, et al. Effects of phytate and phytase on the performance and immune function of broilers fed nutritionally marginal diets. Poult Sci 2008; 87: 1105–1111.
35. Shasha SM, Kristal B, Barzilai M, et al. In vitro effect of PTH on normal T cell functions. Nephron 1988; 50: 212–216.
36. Klinger M, Alexiewicz JM, Linker-Israeli M, et al. Effect of parathyroid hormone on human T cell activation. Kidney Int 1990; 37: 1543–1551.
37. Lewin E, Ladefoged J, Brandi L, et al. Parathyroid hormone dependent T cell proliferation in uremic rats. Kidney Int 1993; 44: 379–384.
38. Lemire JM, Adams JS, Sakai R, et al. 1α, 25-dihydroxyvitamin D3 suppresses proliferation and immunoglobulin production by normal human peripheral blood mononuclear cells. J Clin Invest 1984; 74: 657–661.
39. Tsoukas CD, Provvedini DM. 1,25-dihydroxyvitamin D3: a novel immunoregulatory hormone. Science 1984; 224: 1438–1440.
40. Hideshima T, Podar K, Chauhan D, et al. Cytokines and signal transduction. Best Pract Res Clin Haematol 2005; 18: 509–524.
41. Kogut MH, Rothwell L, Kaiser P. IFN-gamma priming of chicken heterophils upregulates the expression of proinflammatory and Th1 cytokine mRNA following receptor-mediated phagocytosis of Salmonella enterica serovar Enteritidis. J Interferon Cytokine Res 2005; 25: 73–81.
42. Kano R, Konnai S, Onuma M, et al. Cytokines profiles in chickens infected with virulent and avirulent Marek's disease viruses: interferon-gamma is a key factor in the protection of Marek's disease by vaccination. Microbiol Immunol 2009; 53: 224–232.
43. Schroder K, Hertzog PJ, Ravasi T, et al. Interferon-gamma: an overview of signals, mechanisms and functions. J Leukoc Biol 2004; 75: 163–189.
44. Lee SM, Suen Y, Qian J, et al. The regulation and biological activity of interleukin 12. Leuk Lymphoma 1998; 29: 427–438.
45. Nakanishi K, Yoshimoto T, Tsutsui H, et al. Interleukin-18 regulates both Th1 and Th2 responses. Annu Rev Immunol 2001; 19: 423–474.
46. Belardelli F. Role of interferons and other cytokines in the regulation of the immune response. APMIS 1995; 103: 161–179.
47. Gordon S. Alternative activation of macrophages. Nat Rev Immunol 2003; 3: 23–35.
48. O'Garra A, Vieira PT. (H)1 cells control themselves by producing interleukin-10. Nat Rev Immunol 2007; 7: 425–428.
49. Penha Filho RA, Moura BS, de Almeida AM, et al. Humoral and cellular immune response generated by different vaccine programs before and after Salmonella Enteritidis challenge in chickens. Vaccine 2012; 30: 7637–7643.
50. Haghighi HR, Abdul-Careem MF, Dara RA, et al. Cytokine gene expression in chicken cecal tonsils following treatment with probiotics and Salmonella infection. Vet Microbiol 2008; 126: 225–233.
51. Cheeseman JH, Kaiser MG, Ciraci C, et al. Breed effect on early cytokine mRNA expression in spleen and cecum of chickens with and without Salmonella Enteritidis infection. Dev Comp Immunol 2007; 31: 52–60.
52. Boonstra A, Barrat FJ, Crain C, et al. 1alpha, 25-dihydroxyvitamin D3 has a direct effect on naive CD4(1) T cells to enhance the development of Th2 cells. J Immunol 2001; 167: 4974–4980.
53. Overbergh L, Decallonne B, Waer M, et al. 1alpha, 25-dihydroxyvitamin D3 induces an autoantigen-specific T-helper 1/T-helper 2 immune shift in NOD mice immunized with GAD65 (p524–543). Diabetes 2000; 49: 1301–1307.
54. Jiang Y, Yoshida A, Ishioka C, et al. Parathyroid hormone inhibits immunoglobulin production without affecting cell growth in human B cells. Clin Immunol Immunopathol 1992; 65: 286–293.
Appendix 1
Composition and nutrient concentrations of control (NPP content, 0.22%) and high-P (NPP content, 0.42%) diets fed to laying hens.
| Items | Control diet | High-P diet |
|---|---|---|
| Ingredients | ||
| Corn | 59.48 | 59.48 |
| Soybean meal | 27.59 | 27.59 |
| Soybean oil | 1.50 | 1.50 |
| dl-methionine | 0.09 | 0.09 |
| Sodium chloride | 0.40 | 0.40 |
| Choline chloride | 0.10 | 0.10 |
| Premix* | 0.53 | 0.53 |
| Mono-dicalcium phosphate | 0.47 | 1.42 |
| Limestone | 8.28 | 7.90 |
| Bentonite | 1.56 | 0.99 |
| Calculated nutrient concentrations | ||
| Metabolizable energy (kcal/kg) | 2,688 | 2,688 |
| Crude protein | 16.50 | 16.50 |
| Calcium | 3.48 | 3.48 |
| Methionine and cystine | 0.61 | 0.61 |
| Methionine | 0.34 | 0.34 |
| NPP† | 0.22 | 0.42 |
Values represent the percentage of the diet on an air-dried basis unless otherwise indicated.
Supplied the following per kilogram of complete feed: iron, 60 mg; copper, 8 mg; manganese, 100 mg; zinc, 100 mg; selenium, 0.3 mg; iodine, 0.35 mg; vitamin A (retinyl palmitate), 8,000 U; cholecalciferol 1,600 U; vitamin E (dl-tocopheryl acetate), 5 U; thiamine, 0.8 mg; riboflavin, 2.5 mg; pyridoxine, 1.5 mg; vitamin B12, 0.004 mg; pantothenic acid, 2.2 mg; folic acid, 0.25 mg; nicotinic acid, 20 mg; and biotin, 0.1 mg.
Determined by triplicate analyses.
Appendix 2
Primers used for quantitative real-time PCR assays to determine cytokine mRNA expression in the cecal tonsils and spleen of laying hens.
| Gene | Primers sequence (5'–3') | Annealing temperature (°C) | Amplification size (bp) | GenBank accession No. |
|---|---|---|---|---|
| IL-1β | F: TGGGCATCAAGGGCTACA R: TCGGGTTGGTTGGTGATG | 60 | 244 | Y15006 |
| IL-6 | F: CAAGGTGACGGAGGAGGAC R: TGGCGAGGAGGGATTTCT | 58 | 254 | AJ309540 |
| IL-8 | F: GCTTGCTAGGGGAAATGAAG R: GGAATTACCAGTTTGCTGCTG | 60 | 136 | AJ009800 |
| IFN-γ | F: AGCTGACGGTGGACCTATTATT R: GGCTTTGCGCTGGATTC | 57 | 259 | Y07922 |
| IL-4 | F: ACCCAGGGCATCCAGAAG R: CAGTGCCGGCAAGAACTT | 61 | 258 | AJ621735 |
| IL-10 | F: CGGGAGCTGAGGGTGAA R: TGAAGAAGCGGTGACAGC | 60 | 272 | AJ621614 |
| IL-12 | F: AGACTCCAATGGGCAAATGA R: CTCTTCGGCAAATGGACAGT | 55 | 274 | NM_213571 |
| IL-18 | F: GGAATGCGATGCCTTTTG R: ATTTTCCCATGCTCTTTCTCA | 54 | 264 | AJ277865 |
| β-actin | F: GAGAAATTGTGCGTGACATCA R: CCTGAACCTCTCATTGCCA | 60 | 152 | L08165 |
