The immune system of birds consists of primary and secondary organs. Primary immune organs include the thymus and bursa of Fabricius, and secondary immune organs include the spleen, Harder's gland, bone marrow, and lymphoid tissue such as mucosa-associated lymphoid tissue and GALT.1 Development of the avian immune system begins early during embryogenesis. A growing embryo has passive immunity that is provided by IgY that is transferred from the dam's blood to the egg yolk.2 Between days 8 and 14 of embryonic development, prebursal stem cells are synthesized in the yolk sac, bone marrow, and embryonic liver, then migrate to the bursa of Fabricius, where they replicate to a population of 20,000 to 30,000 cells.3 B cells begin multiplication on day 12 of embryonic development and then undergo differentiation and maturation in the bursa of Fabricius.4 B cells produce IgM, IgY, and IgA during a process called somatic gene conversion.5 Between day 18 of embryonic development and 2 to 4 weeks of age (after hatching), most B cells migrate from the bursa of Fabricius to the thymus and secondary lymphatic organs. In the spleen, B cells undergo somatic hypermutation, which generates the antibody diversity of adult birds.6 Conversely, precursor T cells are generated in the bone marrow during embryonic development and migrate to the thymus, where they undergo differentiation. Migration of differentiated T cells from the thymus to the peripheral tissues continues for several weeks after hatching.7 In chickens, the form that GALT takes in the gastrointestinal tract is dependent on its location and varies from aggregations of lymphoid cells or organized structures such as lymphoid follicles or tonsils.1 The GALT of chickens is responsible for eliciting mucosal immune responses and maintaining intestinal homeostasis. Its functionality is ensured by contact with the normal microbiota, which activates both innate defense mechanisms and adaptive immune responses.8
The microbiota of chickens can be stimulated by bioactive substances such as prebiotics, probiotics, or synbiotics,9–11 which can influence the immune system by cross communication between the luminal and mucosal microflora and the intestinal immune system.12–14 The characteristics of prebiotics, probiotics, and synbiotics differ. Prebiotics are nondigestible food ingredients that selectively stimulate the growth of endogenous bacteria such as lactobacilli and bifidobacteria that benefit the host.14,15 Probiotics are bioactive substances that contain living cells or metabolites of stabilized autochthonous microorganisms that optimize the colonization and composition of the gastrointestinal microbiota in both animals and humans. Probiotics have a stimulatory effect on digestive processes and the immunity of the macroorganism.16 Synbiotics are a combination of prebiotics and probiotics.
Although prebiotics function in the large intestine and probiotics function in the small intestine, both compounds have beneficial effects on the host organism.15 Prebiotics directly modulate immunity by interacting with immune cell receptors and stimulating endocytosis, phagocytosis, respiratory burst, and the production of numerous cytokines and chemokines.17 Prebiotics inhibit bacterial and viral infections by modulating host defense responses and altering interactions between pathogenic and beneficial bacteria.16 Probiotics cross the intestinal barrier through intestinal epithelial cells and are processed and presented to the immune system and modulate both the innate and adaptive responses.18
The purpose of external probiotic supplementation in birds is to mimic the natural situation, in which a newly hatched bird is inoculated with beneficial bacteria from its dam's fecal droppings.19 In birds, because of the specificity of in ovo embryo development, growing embryos can be directly stimulated at a very early embryonic stage. In ovo technology has developed, and a bioactive substance suspended in a solution can be injected directly into an incubating egg. Prebiotics20 and synbiotics21,22 have been administered in ovo in chicken eggs. Results of a study21 conducted by our laboratory group indicate that in ovo administration of synbiotics in chickens significantly modified the development of the bursa of Fabricius and spleen and the cellular structure of the thymus.
The effects of in ovo–administered synbiotics might be caused by modulation of the production of cytokines and chemokines, which regulate innate and adaptive immune responses. In another study22 conducted by our laboratory group, in ovo administration of synbiotics resulted in downregulation of cytokine expression in the intestinal immune system (eg, cecal tonsils), which indicated an increase in oral tolerance, and upregulation of IL-4 and IL-6 expression in the peripheral immune system (eg, spleen) of adult dual-purpose chickens (ie, chickens raised for meat and egg-laying purposes). There are substantial differences between meat-type (broilers) and egg-type (layers) chickens caused by intensive genetic selection, and their immune responses also differ. The cell-mediated immune response of layers is greater than that of broilers.23 Broilers have a strong short-term humoral response, whereas layers have a strong long-term humoral response in conjunction with their strong cell-mediated response.23 The purpose of the study reported here was to determine the effects of in ovo administration of a prebiotic (inulin) and synbiotic (combination of inulin and Lactococcus lactis) on immune-related gene expression during the life span of fast-growing broilers.
Materials and Methods
Animals
All animal protocols were approved by the Poland Local Ethical Committee (No 22/2012. 21.06.2012) and were performed in accordance with the animal welfare recommendations of the European Union directive 86/609/EEC. Eggsa with similar weight (approx 60 g) were obtained from a 32-week-old breeder flock of broilers. The eggs were incubated in an automated incubator at 37.8°C with a relative humidity of 61% to 63% at a commercial hatchery. On day 12 of embryonic development (ie, 12 days after the eggs were laid), the eggs were candled to identify and eliminate those that were unfertilized or contained dead embryos. The 360 eggs that contained viable embryos were allocated by use of a randomization procedure (for each set of 3 eggs on a tray, the first was allocated to one treatment group, the second was allotted to the next treatment group, and so on; n = 120 eggs/group) to 3 treatment groups (prebiotic, synbiotic, or control), injected with the assigned treatment, and incubated until hatched. Within 24 hours after hatching, the sex of each chick was determined, and 30 males with a mean initial body weight of 42.0 g were selected from each group for further study. The selected chicks were raised in 3 separate pens (1 treatment group/pen) on a commercial farm in accordance with the producer's standard rearing protocol for 35 days. Briefly, straw was used as litter, and the chicks in all 3 groups underwent the same 3-phase feeding program. A starter ration was fed on days 1 through 14, a grower ration was fed on days 15 through 30, and a finisher ration was fed on days 31 through 35. Feed and water were provided ad libitum.
Study design
In ovo administration of the assigned treatment on day 12 of embryonic development involved injection of 0.2 mL of an aqueous solution into the air cell of the egg followed by sealing of the hole in the egg shell and continued incubation. The in ovo administration procedure was performed by use of a dedicated automatic system that allowed simultaneous injection of 100 eggs.20 Eggs assigned to the prebiotic group were injected with 0.2 mL of a solution that contained 1.76 mg of inulinb extracted from dahlia tubers. Eggs assigned to the synbiotic group were injected with 0.2 mL of a solution that contained 1.76 mg of inulinb enriched with 1,000 CFUs of L lactis. Eggs in the control group were injected with 0.2 mL of saline (0.9% NaCl) solution.
On days 1, 14, and 35 after hatching, 5 birds from each treatment group were randomly selected and euthanized by cervical dislocation. The spleen and cecal tonsils were harvested from each bird immediately after euthanasia, snap frozen in liquid nitrogen, and stored at −80°C until analyzed for expression of immune chemokine and cytokines. The remaining birds in each group were processed in accordance with the standard protocol for the commercial farm on which they were housed.
Synbiotic preparation
Fresh liquid cultures of L lactis subsp lactis 2955c in M17 medium were obtained from the provider by overnight shipment. The bacterial concentration in those cultures was estimated to be 3 × 108 viable CFUs of L lactis/mL. Just prior to in ovo injection, the bacterial cultures were diluted in an inulin solution to obtain a bacterial suspension of 1,000 CFUs of L lactis/20 μL. Thus, the synbiotic suspension injected in ovo was comprised of 180 μL of the inulin solution and 20 μL of the bacterial suspension.
RT-qPCR protocol
Prior to RNA isolation, frozen tissue specimens (spleen and cecal tonsils) were homogenized with a rotor-stator homogenizerd in the presence of guanidinium thiocyanate and phenol.e Homogenized and lysed tissue specimens were purified with a spin-column–based nucleic acid purification kitf in accordance with the manufacturer's instructions, and the genomic DNA residues were removed. Total RNA was evaluated by means of agarose gel electrophoresis and use of a spectrophotometer,g and the RNA samples were stored in 40-μL aliquots at −20°C for further analysis.
Each total RNA sample underwent reverse transcription by use of a 20-μL total reaction volume that included a Maloney murine leukemia virus reverse transcription enzyme and a mixtureh of oligo(dt) with random hexamers for reaction primers. The resulting cDNA was evaluated with a spectrophotometer, diluted to the working concentration of 70 ng/μL, and stored at −20°C. A real-time PCR instrumenti was used to perform an RT-qPCR assay to quantitate expression of IL-4, IL-6, IL-8, IL-18, IL-12p40, CD80, IFN-β, and IFN-γ. For each specimen, the reaction was prepared in a 96-well plate format with a 20-μL total volume that consisted of the quantitative PCR assay reaction mixturej (1× buffer, 2.5mM magnesium chloride, 200μM deoxynucleoside triphosphates, DNA-binding dye, and DNA polymerase), 1μM of each primer, and 280 ng of a cDNA template. Primer sequences (Appendix) were either extracted from the literature22,24–26 or designed in-house on the basis of the cDNA sequence for the gene of interest. Commercially available softwarek was used to design primers that spanned exon-exon boundaries. The thermal cycling protocol consisted of initial denaturation at 95°C for 15 minutes followed by 40 cycles of amplification, which consisted of denaturation at 95°C for 15 seconds, annealing at 58°C for 20 seconds (except for IL-12p40, which underwent annealing at 65°C for 20 seconds), and elongation at 72°C for 20 seconds. Fluorescence was measured at the end of each extension step. Following completion of the amplification reaction, a melting curve was generated by increasing the temperature in small increments up to 98°C and measuring fluorescence of the melting qPCR assay product.
Statistical analysis
Data for each gene were expressed as the ΔCt, which was calculated as the Ct of the target gene minus the Ct of the reference gene. Relative gene expression for the RT-qPCR assay data was determined by the ΔΔCt algorithm as described,27 and the amount of the target gene was calculated as 2−ΔΔCt. The effects of treatment group (prebiotic, synbiotic, and control), the tissue collection time (1, 14, or 35 days after hatching), and the interaction between treatment group and tissue collection time on relative gene expression were assessed with the least squares means method. Pairwise comparisons of the least squares means among the treatment groups were performed with the Tukey-Kramer honestly significant difference test, and values of P < 0.05 were considered significant. All analyses were performed with statistical software.l For the prebiotic and synbiotic groups, data were graphically represented as the fold induction (ie, change) in the expression of each gene relative to the expression of that gene for the control group. Expression of each immune-related gene in the control group was assigned a value of 1. Therefore, for the prebiotic and synbiotic groups, genes with a fold induction > 1 were upregulated, and genes with a fold induction < 1 were downregulated.
Results
Tissue collection time significantly affected expression of all genes evaluated in both the cecal tonsils and spleen. In the cecal tonsils, expressions of IL-4, IL-12p40, IL-18, and IFN-β were also significantly affected by treatment group and the interaction between treatment group and tissue collection time; expressions of IL-8 and CD80 were significantly affected by treatment group; expression of IL-6 was significantly affected by the interaction between treatment group and tissue collection time, but was not significantly affected by treatment group; and expression of IFN-γ was significantly affected by tissue collection time only. In the spleen, treatment group and the interaction between treatment group and tissue collection time had insignificant effects on the expression of all the genes evaluated.
For the prebiotic and synbiotic groups, the relative expression for each immune-related gene, compared with the expression of that gene in the control group in the cecal tonsils (Figure 1) and spleen (Figure 2), was summarized. In the cecal tonsils, the most pronounced treatment effects observed for chickens in the prebiotic group were the downregulation of IL-4, IL-12p40, IL-18, CD80, and IFN-β at 35 days after hatching, whereas the most pronounced treatment effects observed for the chickens in the synbiotic group were the downregulation of IL-4 and CD80 at 35 days after hatching. In the spleen, expressions of immune-related genes for the chickens in the prebiotic and synbiotic groups tended to be downregulated, compared with those for chickens in the control group, and the magnitude of that downregulation generally increased as the number of days after hatching increased. For the prebiotic and synbiotic groups, all the genes evaluated except IFN-γ in the prebiotic group were significantly downregulated at 35 days after hatching, compared with the corresponding genes for the control group. Furthermore, the magnitude of downregulation of IL-12p40 in the spleen of chickens in the prebiotic group was significantly greater than that for chickens in the synbiotic group. The quantity of immune-related gene mRNA isolated from the spleens of chickens in the prebiotic and synbiotic groups was at least 2-fold less than that isolated from the spleens of chickens in the control group, but that difference was not significant.
Relative expression (mean ± SEM fold induction) of IL-4 (A), IL-6 (B), IL-8 (C), IL-12p40 (D), IL-18 (E), CD80 (F), IFN-β (G), and IFN-γ (H) in the cecal tonsils at 1, 14, and 35 days after hatching for chickens following in ovo administration of 0.2 mL of a solution that contained 1.76 mg of inulin (prebiotic group; gray bars; n = 5) or 0.2 mL of a solution that contained 1.76 mg of inulin enriched with 1,000 CFUs of Lactococcus lactis subsp lactis 2955 (synbiotic group; black bars; 5) on day 12 of embryonic development. For each gene, expression was represented as the fold induction (ie, change) relative to the expression of that gene for chickens (n = 5) in a control group following in ovo administration of 0.2 mL of saline (0.9% NaCl) solution on day 12 of embryonic development. For the control group, expression of each gene was assigned a value of 1. Therefore, for the prebiotic and synbiotic groups, genes with a fold induction > 1 were upregulated and genes with a fold induction < 1 were downregulated. *Within a tissue collection time (days after hatching), value differs significantly (P < 0.05) from the corresponding value for the control group. a–cValues with different lowercase letters differ significantly (P < 0.05) among the 3 tissue collection times.
Citation: American Journal of Veterinary Research 76, 11; 10.2460/ajvr.76.11.975
Relative expression of IL-4 (A), IL-6 (B), IL-8 (C), IL-12p40 (D), IL-18 (E), CD80 (F), IFN-β (G), and IFN-γ (H) in the spleen at 1, 14, and 35 days after hatching for the chickens of Figure 1. For chickens in both the prebiotic and synbiotic groups, the mean relative expression of all genes at 35 days after hatching was significantly decreased, compared with that for the control chickens. *Within a tissue collection time, value differs significantly (P < 0.05) between the prebiotic and synbiotic groups. See Figure 1 for remainder of key.
Citation: American Journal of Veterinary Research 76, 11; 10.2460/ajvr.76.11.975
Discussion
Results of the present study indicated that in ovo administration of inulin (a prebiotic) or inulin supplemented with L lactis subsp lactis 2955 (a synbiotic) on day 12 of embryonic development resulted in downregulation of immune-related genes in the peripheral immune organs (cecal tonsils and spleen) of broilers during the first 35 days after hatching. The prebiotic and synbiotic administered in this study were selected on the basis of results of an in vitro study28 that involved stimulation of a chicken DT40 cell line with various combinations of bioactive compounds. In that study,28 treatment of the DT40 cell line with inulin in combination with L lactis subsp lactis 2955 appeared to have the greatest ability to stimulate immune-related gene expression in B lymphocytes and resulted in upregulation of CD80, IFN-β, IL-4, IL-6, mitogen-activated protein kinase 3, and toll-like receptor 2.
The immune-related genes analyzed in the present study consisted of T helper–1 genes (IFN-β, IFN-γ, and IL-18), a T helper–2 gene (IL-4), proinflammatory cytokines (IL-6 and IL-12p40), a chemokine (IL-8), and a costimulatory molecule (CD80). Results of this study indicated that those genes underwent downregulation in the peripheral immune organs of broilers after hatching and that the magnitude of that downregulation tended to increase during the first 35 days after hatching. In ovo administration of a prebiotic or synbiotic further modulated immune-related gene expression in the peripheral immune organs, particularly the cecal tonsils. The different patterns and magnitudes of modulation for immune-related gene expression between the cecal tonsils and spleen were likely caused by varying levels of exposure to luminal antigens. The cecal tonsils are part of the GALT; therefore, they are in closer proximity to the intestinal microflora than is the spleen and are constantly exposed to microbe-associated molecular patterns. Results of an in vitro study8 indicate that chicken cecal tonsillar cells react more rapidly to stimulation with lactic acid bacteria than do chicken splenic cells; however, the duration of that stimulation lasted longer in the splenic cells than in the cecal tonsillar cells.
Feeding of prebiotics, probiotics, and synbiotics is a common practice in the poultry industry that is intended to provide birds with beneficial nutritional supplementation especially during the period immediately after hatching. The effect of those bioactive compounds on the immune response of birds is dependent on their composition and the time of administration and the bird genotype and tissues analyzed.29–34 For example, administration of direct-fed microbials (probiotics) to Ross broilers for the first 22 days after hatching resulted in downregulation of toll-like receptor 2, IL-4, and IL-6.35 Results of another study36 indicate that probiotic administration to chickens provides protection against Salmonella infection, which the investigators associated with downregulation of IFN-γ and IL-12 in the cecal tonsils. Similarly, Chen et al37 reported that the proinflammatory genes IL-1β, IL-6, and IFN-γ were downregulated and the antiinflammatory gene IL-10 was upregulated in the cecal tonsils of broiler chicks that were fed a probiotic that contained 4 strains of lactic acid bacteria for 3 days and then experimentally inoculated with Salmonella Typhimurium.
Lactococcus lactis subsp lactis is a commonly used lactic acid bacterial strain that has both probiotic and immunobiotic properties. It stimulates oxidative burst in chicken heterophils38 and activates IFN production in human dendritic cells39 and murine macrophages40 in vitro. In vivo feeding of various strains of L lactis causes a reduction in fecal coliform counts in weaned piglets41 and enhances the nonspecific immune response of fish.42 Strains of L lactis used in probiotics must be resistant to the acidic environment and bile salts present in the gastrointestinal tract43 and be able to adhere to the intestinal mucosa to provide protection against pathogenic bacteria (eg, Campylobacter spp) by competitive inhibition.44 The model of lactic acid–evoked immunostimulation proposed by Galdeano et al45 assumes that, once ingested, probiotics interact with various types of cells located along the intestinal tract such as epithelial cells, M cells in the Peyer patches, and other gut-associated immune cells. This interaction results in the release of cytokines, which subsequently causes upregulation or downregulation of various immune responses.
Inulin is a naturally occurring prebiotic often referred to as bifidogenic because it stimulates growth of Bifidobacterium spp in the large intestine.46 Inulin acts a barrier against pathogens in the intestinal tract, which might help explain the downregulation of the inflammatory response in the cecal tonsils and overall repression of mRNA that encodes for secretory proteins in the spleen observed in the chickens of the present study that were administered inulin in ovo (prebiotic and synbiotic groups), compared with those for chickens in the control group.
In the present study, the magnitude of gene modulation elicited by the prebiotic and synbiotic treatments was greatest at 35 days after hatching (ie, the end of the observation period). In chickens, the luminal and mucosal microflora of the gastrointestinal tract generally does not begin to develop until after hatching because chicks are protected from environmental microbes during embryonic development inside the egg. Under natural conditions, hens incubate the eggs until hatching and contribute to the microbiota for newly hatched chicks; however, in most commercial production systems, eggs are removed from the hens and incubated at a hatchery; thus, the microbiota for newly hatched chicks is provided solely by the environment.47 The rationale for in ovo administration of prebiotics, probiotics, and synbiotics is to stimulate the development of beneficial intestinal microbiota in birds during embryonic development so that chicks have a healthy microbiota at hatching that can provide some protection against environmental pathogens. Results of 16S rRNA fingerprinting, a commonly used method for evaluating microbiota, indicate that the predominant phyla in the gastrointestinal microbiota of chickens are Firmicutes (eg, Clostridium spp [18%], Ruminococcus spp [14%], Lactobacillus spp [8%]), Bacteroidetes (eg, Bacteroides spp [8%]), and Proteobacteria (eg, Bifidobacterium spp [1%]).46 In healthy animals, the microbiota of the gastrointestinal tract is fairly stable but can shift with age, intestinal insult (eg, coccidiosis), change in diet, or supplementation with nutritional additives.48 Nutritional additives such as prebiotics, probiotics, and synbiotics stabilize the gastrointestinal microbiota.49 Therefore, we believe that the significant modulation in the expression of immune-related genes of broilers in the prebiotic and synbiotic groups at 35 days after hatching was the result of both direct and indirect effects of the in ovo treatment on the microbiota.
Results of a previous study22 conducted by our laboratory group that involved Green-Legged Partridge-like chickens (a dual-purpose breed native to Poland) indicate that in ovo administration of prebiotics and synbiotics results in an increase in the expression of IL-4, IL-6, IFN-β, and IL-18 in the spleen and a concurrent decrease in the expression of IL-12 and IFN-γ in the cecal tonsils. The general pattern for prebiotic- and synbiotic-induced gene modulation in the dual-purpose chickens of that study22 was characterized by cytokine mRNA that was upregulated in the spleen and downregulated in the cecal tonsils. In the broilers of the present study, in ovo administration of a pre-biotic or synbiotic resulted in the downregulation of immune-related cytokines in both the spleen and cecal tonsils. The difference in gene modulation between our previous study22 and the present study was most likely associated with differences in the genotypes of the study birds. Commercial broilers, like those used for the present study, are fast-growing meat-type chickens that have undergone intensive genetic selection for rapid growth and efficient conversion of nutrients into body weight and protein-rich meat. Genetic selection for certain production traits often results in a trade-off between growth and immune function.50 Compared with layers, meat-type (broiler) chickens have a lower cytokine response.51 The underlying mechanism for that finding might be simplified as broilers having an unbalanced allocation of nutrients to body weight at the expense of the immune system. The expression of proinflammatory cytokines might reduce nutrient allocation to growth; therefore, proinflammatory cytokine expression is a trait that has been selected against by the broiler industry.52
In the present study, in ovo administration of inulin or inulin supplemented with L lactis subsp lactis 2955 on day 12 of embryonic development resulted in a general downregulation of immune-related genes in the spleen and cecal tonsils of broilers during the 35 days after hatching. Gene repression was more pronounced in the cecal tonsils than it was in the spleen, and its magnitude appeared to increase with age, which might have been a reflection of the proliferation and stabilization of the gastrointestinal microbiota during the initial weeks after hatching. The effect of in ovo prebiotic or synbiotic administration on immune-related gene expression in broilers differed from that in dual-purpose chickens, which suggested that genotype may affect an individual's responsiveness to prebiotic- or synbiotic-induced stimulation of immune-related genes.
Acknowledgments
Supported by the National Science Centre in Cracow, Poland, and the European Regional Development Fund within the Regional Operational Program for Kujawsko-Pomorskie Voivodeship for the years 2007 to 2013.
The authors thank Jacek Bardowski and Joanna Zylińska for providing the bacterial strains used.
ABBREVIATIONS
| CD80 | Cluster of differentiation 80 |
| Ct | Threshold cycle |
| GALT | Gut-associated lymphatic tissue |
| IFN | Interferon |
| IL | Interleukin |
| RT-qPCR | Reverse transcription quantitative PCR |
Footnotes
Ross 308 broilers, Aviangen Inc, Huntsville, Ala.
Sigma-Aldrich GmbH, Schnelldorf, Germany.
Provided by Jacek Bardowski and Joanna Zylińska, Institute of Biochemistry and Biophysics, Polish Academy of Sciences, Warsaw, Poland.
TissueRuptor rotor-stator homogenizer, Qiagen GmbH, Hilden, Germany.
Trizol reagent, Invitrogen, Carlsbad, Calif.
Universal RNA purification kit, EURx, Gdańsk, Poland.
NanoDrop 2000, Thermo Scientific Nanodrop Products, Wilmington, Del.
Maxima First Strand cDNA Synthesis Kit for RT-qPCR, Thermo Scientific Fermentas, Vilnius, Lithuania.
LightCycler 480 System, Roche-Diagnostics, Basel, Switzerland.
1× HOT FIREPol EvaGreen qPCR Mix Plus, Solis BioDyne, Tartu, Estonia.
PrimerExpress, version 3.0, Applied Biosystems, Foster City, Calif.
JMP Pro, version 10.0.2, SAS Institute Inc, Cary, NC.
References
1. Casteleyn C, Doom M, Lambrechts E, et al. Locations of gut-associated lymphoid tissue in the 3-month-old chicken: a review. Avian Pathol 2010;39:143–150.
2. Kovacs-Nolan J, Mine Y. Egg yolk antibodies for passive immunity. Annu Rev Food Sci Technol 2012;3:163–182.
3. Weill JC, Reynaud CA. The chicken B compartment. Science 1987;238:1094–1098.
4. Barton RW, Goldschneider I. Nucleotide-metabolizing enzymes and lymphocyte differentiation. Mol Cell Biochem 1979;28:135–147.
5. Ratcliffe MJ. Antibodies, immunoglobulin genes and the bursa of Fabricius in chicken B cell development. Dev Comp Immunol 2006;30:101–118.
6. McCormack WT, Tjoelker LW, Thompson CB. Avian B-cell development: generation of an immunoglobulin repertoire by gene conversion. Annu Rev Immunol 1991;9:219–241.
7. Rumińska E, Koncicki A, Stenzel T. The structure and functions of the immune system in birds [in Polish]. Med Welt 2008;64:265–268.
8. Brisbin JT, Gong J, Sharif S. Interactions between commensal bacteria and the gut-associated immune system of the chicken. Anim Health Res Rev 2008;9:101–110.
9. Cisek AA, Binek M. Chicken intestinal microbiota function with a special emphasis on the role of probiotic bacteria. Pol J Vet Sci 2014;17:385–394.
10. Patterson JA, Burkholder KM. Application of prebiotics and probiotics in poultry production. Poult Sci 2003;82:627–631.
11. de Vrese M, Schrezenmeir J. Probiotics, prebiotics, and synbiotics. Adv Biochem Eng Biotechnol 2008;111:1–66.
12. Nava GM, Bielke LR, Callaway TR, et al. Probiotic alternatives to reduce gastrointestinal infections: the poultry experience. Anim Health Res Rev 2005;6:105–118.
13. Maldonado Galdeano C, Novotny Nuñez I, Carmuega E, et al. Role of probiotics and functional foods in health: gut immune stimulation by two probiotic strains and a potential probiotic yoghurt. Endocr Metab Immune Disord Drug Targets 2015;15:37–45.
14. Edens F, Pierce J. Nutrigenomics: implications for prebiotics and intestinal health, in Proceedings. Alltech Technical Symposium, Arkansas Nutrition Conference 2010. Available at: www.thepoultryfederation.com/public/userfiles/files/1-4%20Tue%20-%20Frank%20Edens%20-%20Nutrigenomics%20%20&%20Prebiotics.pdf. Accessed Jun 11, 2015.
15. Gibson GR, Roberfroid MB. Dietary modulation of the human colonic microbiota: introducing the concept of prebiotics. J Nutr 1995;125:1401–1412.
16. Di Bartolomeo F, Startek JB, Van den Ende W. Prebiotics to fight diseases: reality or fiction? Phytother Res 2013;27:1457–1473.
17. Schley PD, Field CJ. The immune-enhancing effects of dietary fibres and prebiotics. Br J Nutr 2002;87:S221–S230.
18. Galdeano CM, Perdigón G. Role of viability of probiotic strains in their persistence in the gut and in mucosal immune stimulation. J Appl Microbiol 2004;97:673–681.
19. Lutful Kabir SM. The role of probiotics in the poultry industry. Int J Mol Sci 2009;10:3531–3546.
20. Bednarczyk M, Urbanowski M, Gulewicz P, et al. Field and in vitro study on prebiotic effect of raffinose family oligosaccharides in chickens. Bull Vet Inst Pulawy 2011;55:465–469.
21. Sławińska A, Siwek M, Zylińska J, et al. Influence of synbiotics delivered in ovo on immune organs development and structure. Folia Biol (Krakow) 2014;62:277–285.
22. Sławińska A, Siwek MZ, Bednarczyk MF. Effects of synbiotics injected in ovo on regulation of immune-related gene expression in adult chickens. Am J Vet Res 2014;75:997–1003.
23. Koenen ME, Boonstra-Blom AG, Jeurissen SH. Immunological differences between layer and broiler-type chickens. Vet Immunol Immunopathol 2002;89:47–56.
24. Chiang HI, Berghman LR, Zhou H. Inhibition of NF-kB 1 (NF-kBp50) by RNA interference in chicken macrophage HD11 cell line challenged with Salmonella enteritidis. Genet Mol Biol 2009;32:507–515.
25. Brisbin JT, Gong J, Parvizi P, et al. Effects of lactobacilli on cytokine expression by chicken spleen and cecal tonsil cells. Clin Vaccine Immunol 2010;17:1337–1343.
26. De Boever S, Vangestel C, De Backer P, et al. Identification and validation of housekeeping genes as internal control for gene expression in an intravenous LPS inflammation model in chickens. Vet Immunol Immunopathol 2008;122:312–317.
27. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C[T]) Method. Methods 2001;25:402–408.
28. Sławińska A, Siwek M, Bednarczyk M. In vitro screening of immunomodulatory properties of the synbiotics in chicken DT40 cell line. Anim Sci Pap Rep 2015; in press.
29. Chichlowski M, Croom J, McBride BW, et al. Direct-fed microbial PrimaLac and salinomycin modulate whole-body and intestinal oxygen consumption and intestinal mucosal cytokine production in the broiler chick. Poult Sci 2007;86:1100–1106.
30. Brisbin JT, Gong J, Orouji S, et al. Oral treatment of chickens with lactobacilli influences elicitation of immune responses. Clin Vaccine Immunol 2011;18:1447–1455.
31. Deng W, Dong XF, Tong JM, et al. The probiotic Bacillus licheniformis ameliorates heat stress–induced impairment of egg production, gut morphology, and intestinal mucosal immunity in laying hens. Poult Sci 2012;91:575–582.
32. Qiu R, Croom J, Ali RA, et al. Direct fed microbial supplementation repartitions host energy to the immune system. J Anim Sci 2012;90:2639–2651.
33. Zhang JL, Xie QM, Ji J, et al. Different combinations of probiotics improve the production performance, egg quality, and immune response of layer hens. Poult Sci 2012;91:2755–2760.
34. Salim HM, Kang HK, Akter N, et al. Supplementation of direct-fed microbials as an alternative to antibiotic on growth performance, immune response, cecal microbial population, and ileal morphology of broiler chickens. Poult Sci 2013;92:2084–2090.
35. Waititu SM, Yitbarek A, Matini E, et al. Effect of supplementing direct-fed microbials on broiler performance, nutrient digestibilities, and immune responses. Poult Sci 2014;93:625–635.
36. Haghighi HR, Abdul-Careem MF, Dara RA, et al. Cytokine gene expression in chicken cecal tonsils following treatment with probiotics and Salmonella infection. Vet Microbiol 2008;126:225–233.
37. Chen CY, Tsen HY, Lin CL, et al. Oral administration of a combination of select lactic acid bacteria strains to reduce the Salmonella invasion and inflammation of broiler chicks. Poult Sci 2012;91:2139–2147.
38. Farnell MB, Donoghue AM, de Los Santos FS, et al. Upregulation of oxidative burst and degranulation in chicken heterophils stimulated with probiotic bacteria. Poult Sci 2006;85:1900–1906.
39. Sugimura T, Jounai K, Ohshio K, et al. Immunomodulatory effect of Lactococcus lactis JCM5805 on human plasmacytoid dendritic cells. Clin Immunol 2013;149:509–518.
40. Suzuki C, Kimoto-Nira H, Kobayashi M, et al. Immunomodulatory and cytotoxic effects of various Lactococcus strains on the murine macrophage cell line J774.1. Int J Food Microbiol 2008;123:159–165.
41. Guerra NP, Bernárdez PF, Méndez J, et al. Production of four potentially probiotic lactic acid bacteria and their evaluation as feed additives for weaned piglets. Anim Feed Sci Technol 2007;134:89–107.
42. Heo WS, Kim YR, Kim EY, et al. Effects of dietary probiotic, Lactococcus lactis subsp. lactis I2, supplementation on the growth and immune response of olive flounder (Paralichthys olivaceus). Aquaculture 2013;376–379:20–24.
43. Elmarzugi N, El Enshasy H, Abd Malek R, et al. Optimization of cell mass production of the probiotic strain Lactococcus lactis in batch and fed-bach culture in pilot scale levels. In: Méndez-Vilas A, ed. Current research, technology and education topics in applied microbiology and microbial biotechnology. Badajoz, Spain: Formatex Research Center, 2010;873–879.
44. Ganan M, Martinez-Rodriguez AJ, Carrascosa AV, et al. Interaction of Campylobacter spp and human probiotics in chicken intestinal mucus. Zoonoses Public Health 2013;60:141–148.
45. Galdeano CM, de Moreno de LeBlanc A, Vinderola G, et al. Proposed model: mechanisms of immunomodulation induced by probiotic bacteria. Clin Vaccine Immunol 2007;14:485–492.
46. Videnska P, Faldynova M, Juricova H, et al. Chicken faecal microbiota and disturbances induced by single or repeated therapy with tetracycline and streptomycin. BMC Vet Res [serial online]. 2013;9:30. Available at: www.biomedcentral.com/1746-6148/9/30. Accessed October 7, 2015.
47. Wei S, Morrison M, Yu Z. Bacterial census of poultry intestinal microbiome. Poult Sci 2013;92:671–683.
48. Oviedo-Rondón EO, Hume ME. Equilibrium in the gut ecosystem for productive healthy birds, in Proceedings. Ark Nutr Conf 2013. Available at: www.thepoultryfederation.com/public/userfiles/files/Edgar%20Oviedo-Rondon%20Paper.pdf. Accessed Jun 11, 2015.
49. Kajander K, Myllyluoma E, Rajilic-Stojanovic M, et al. Clinical trial: multispecies probiotic supplementation alleviates the symptoms of irritable bowel syndrome and stabilizes intestinal microbiota. Aliment Pharmacol Ther 2008;27:48–57.
50. van der Most PJ, de Jong B, Parmentier HK, et al. Trade-off between growth and immune function: a meta-analysis of selection experiments. Funct Ecol 2011;25:74–80.
51. Leshchinsky TV, Klasing KC. Divergence of the inflammatory response in two types of chickens. Dev Comp Immunol 2001;25:629–638.
52. Friedman A. Oral tolerance in birds and mammals: digestive tract development determines the strategy. J Appl Poult Res 2008;17:168–173.
Appendix
RT-qPCR primer assays used for evaluation of the immune-related gene expression in the cecal tonsils and spleen of broilers.
| Gene | NCBI gene ID | Primer sequences (5′ to 3′) | Annealing temperature (°C) | Reference No. |
|---|---|---|---|---|
| IL-4 | 416330 | F: GCTCTCAGTGCCGCTGATG | 58 | 15 |
| R: GGAAACCTCTCCCTGGATGTC | ||||
| IL-6 | 395337 | F: AGGACGAGATGTGCAAGAAGTTC | 58 | 17 |
| R: TTGGGCAGGTTGAGGTTGTT | ||||
| IL-8 | 396495 | F: AAGGATGGAAGAGAGGTGTGCTT | 58 | 15 |
| R: GCTGAGCCTTGGCCATAAGT | ||||
| IL-12 | 404671 | F: TTGCCGAAGAGCACCAGCCG | 65 | 18 |
| R: CGGTGTGCTCCAGGTCTTGGG | ||||
| IL-18 | 395312 | F: GAAACGTCAATAGCCAGTTGC | 58 | 18 |
| R: TCCCATGCTCTTTCTCACAACA | ||||
| IFN-β | 554219 | F: ACCAGATCCAGCATTACATCCA | 58 | 15 |
| R: CGCGTGCCTTGGTTTACG | ||||
| IFN-γ | 396054 | F: ACACTGACAAGTCAAAGCCGC | 58 | 18 |
| R: AGTCGTTCATCGGGAGCTTG | ||||
| CD80 | 768950 | F: CCCAAGGCACGCCTGTT | 58 | NA |
| R: CACGTCGTCTTCTGCTGAAACT | ||||
| UB | 396425 | F: GGGATGCAGATCTTCGTGAAA | 58 | 19 |
F = Forward. NA = Not applicable; primer designed in-house. NCBI = National Center of Biotechnology Information. R = Reverse. UB = ubiquitin gene
