• View in gallery
    Figure 1—

    Results of flow cytometric analysis of cell cycle, cell proliferation phase distribution, and apoptosis peak of thymocytes from 40-day-old chickens that were fed a basal diet not supplemented with RES and received conventional vaccinations. G0 = Rest phase in cell division. G1 = Gap that precedes DNA synthesis. S = DNA synthesis phase. G2 = Gap between DNA synthesis and mitosis. M = Mitotic phase.

  • 1. Johnson RW. Inhibition of growth by pro-inflammatory cytokines: an integrated view. J Anim Sci 1997; 75: 12441255.

  • 2. Wong SC, MacRae VEP & Grogan MC, et al. The role of pro-inflammatory cytokines in inflammatory bowel disease growth retardation. J Pediatr Gastroenterol Nutr 2006; 43: 144155.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 3. Christian LM, Iams JD & Porter K, et al. Inflammatory responses to trivalent influenza virus vaccine among pregnant women. Vaccine 2011; 29: 89828987.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 4. Christian LM, Porter K & Karlsson E, et al. Serum proinflammatory cytokine responses to influenza virus vaccine among women during pregnancy versus non-pregnancy. Am J Reprod Immunol 2013; 70: 4553.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 5. Ato M, Takahashi Y & Fujii H, et al. Influenza A whole virion vaccine induces a rapid reduction of peripheral blood leukocytes via interferon-α-dependent apoptosis. Vaccine 2013; 31: 21842190.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 6. Norbury CJ, Hickson ID. Cellular responses to DNA damage. Annu Rev Pharmacol Toxicol 2001; 41: 367401.

  • 7. Watanabe K, Jinnouchi K & Inai S, et al. Induction of apoptosis in the vestibule of guinea pigs after middle ear inoculation with lipopolysaccharide (LPS). Auris Nasus Larynx 2003; 30: 355361.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 8. Häcker G, Fischer SF. Bacterial anti-apoptotic activities. FEMS Microbiol Lett 2002; 211: 16.

  • 9. Hailemichael Y, Dai Z & Jaffarzad N, et al. Persistent antigen at vaccination sites induces tumor-specific CD8+ T cell sequestration, dysfunction and deletion. Nat Med 2013; 19: 465472.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 10. Apanius V. Stress and immune defense. Adv Study Behav 1998; 27: 133153.

  • 11. He X, Yang XJ, Guo YM. Effects of different dietary oil sources on immune function in cyclophosphamide immunosuppressed chickens. Anim Feed Sci Technol 2007; 139: 186200.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 12. Tayade C, Jaiswal TN & Mishra SC, et al. l-arginine stimulates immune response in chickens immunized with intermediate plus strain of infectious bursal disease vaccine. Vaccine 2006; 24: 552560.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 13. Tsai SH, Lin-Shiau SY, Lin JK. Suppression of nitric oxide synthase and the down-regulation of the activity of NF-κB in macrophages by resveratrol. Br J Pharmacol 1999; 126: 673680.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 14. Kumar A, Sharma SS. NF-κB inhibitory action of resveratrol: a probable mechanism of neuroprotection in experimental diabetic neuropathy. Biochem Biophys Res Commun 2010; 394: 360365.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 15. Gao X, Xu YX & Janakiraman N, et al. Immunomodulatory activity of resveratrol: Suppression of lymphocyte proliferation, development of cell-mediated cytotoxicity, and cytokine production. Biochem Pharmacol 2001; 62: 12991308.

    • Search Google Scholar
    • Export Citation
  • 16. Hsieh T, Halicka D & Lu XH, et al. Effects of resveratrol on the G0–G1 transition and cell cycle progression of mitogenically stimulated human lymphocytes. Biochem Biophys Res Commun 2002; 297: 13111317.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 17. Zunino SJ, Storms DH. Resveratrol alters proliferative responses and apoptosis in human activated B lymphocytes in vitro. J Nutr 2009; 139: 16031608.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 18. Feng YH, Zhou WL & Wu QL, et al. Low dose of resveratrol enhanced immune response of mice. Acta Pharmacol Sin 2002; 23: 893897.

  • 19. Sahin K, Akdemir F & Orhan C, et al. Effects of dietary resveratrol supplementation on egg production and antioxidant status. Poult Sci 2010; 89: 11901198.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 20. Sahin K, Orhan C & Akdemir F, et al. Resveratrol protects quail hepatocytes against heat stress: modulation of the Nrf2 transcription factor and heat shock proteins. J Anim Physiol Anim Nutr (Berl) 2012; 96: 6674.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 21. Ma ZH, Guo DY & Wang YL, et al. Effects of sulfated polysaccharides and their prescriptions on immune response of ND vaccine in chicken. Carbohydr Polym 2010; 82: 913.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 22. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2-ΔΔCT method. Methods 2001; 25: 402408.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 23. Ormerod MG. Analysis of DNA—general methods. In: Ormerod MG, ed. Flow cytometry: a practical approach. 3rd ed. Oxford, England: Oxford University Press, 2000;8398.

    • Search Google Scholar
    • Export Citation
  • 24. Dalgaard TS, Norup LR & Pedersen AR, et al. Flow cytometric assessment of chicken T cell-mediated immune responses after Newcastle disease virus vaccination and challenge. Vaccine 2010; 28: 45064514.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 25. Wu CC, Dorairajan T, Lin TL. Effect of ascorbic acid supplementation on the immune response of chickens vaccinated and challenged with infectious bursal disease virus. Vet Immunol Immunopathol 2000; 74: 145152.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 26. Lawrence T, Bebien M, Liu GY. IKKα limits macrophage NF-κB activation and contributes to the resolution of inflammation. Nature 2005; 434: 11381143.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 27. Pikarsky E, Porat RM & Ilan S, et al. NF-κB functions as a tumour promoter in inflammation-associated cancer. Nature 2004; 431: 461466.

  • 28. Berthiaume F, Aparicio CL & Eungdamrong J, et al. Age- and disease-related decline in immune function: an opportunity for ‘thymus-boosting’ therapies. Tissue Eng 1999; 5: 499514.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 29. Pariante CM, Carpiniello B & Orru MG, et al. Chronic caregiving stress alters peripheral blood immune parameters: the role of age and severity of stress. Psychother Psychosom 1997; 66: 199207.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 30. Zorrilla EP, Luborsky L & McKay JR, et al. The relationship of depression and stressors to immunological assays: a meta-analytic review. Brain Behav Immun 2001; 15: 199226.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 31. Rodrigues VS, Vidotto MC & Felipe I, et al. Apoptosis of murine peritoneal macrophages induced by an avian pathogenic strain of Escherichia coli. FEMS Microbiol Lett 1999; 179: 7378.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 32. Guichon A, Zychlinsky A. Clinical isolates of Shigella species induce apoptosis in macrophages. J Infect Dis 1997; 175: 470473.

  • 33. Finlay BB, Cossart P. Exploitation of mammalian host cell functions by bacterial pathogens. Science 1997; 276: 718725.

  • 34. Shao JZ, Liu J, Xiang LX. Aeromonas hydrophila induces apoptosis in Carassius auratus lymphocytes in vitro. Aquaculture 2004; 229: 1113.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 35. Yin D, Mufson RA & Wang R, et al. Fas-mediated cell death promoted by opioids. Nature 1999; 397: 218.

  • 36. Yin D, David TR & Allan M, et al. Chronic restraint stress promotes lymphocyte apoptosis by modulating Cd95 expression. J Exp Med 2000; 191: 14231428.

    • Crossref
    • Search Google Scholar
    • Export Citation

Advertisement

Modulation of growth and immunity by dietary supplementation with resveratrol in young chickens receiving conventional vaccinations

CaiYun ZhangCollege of Livestock Husbandry and Veterinary Engineering, Henan Agricultural University, Henan Research Center of Breeding Resources for Poultry, Zhengzhou 450002, People's Republic of China.
College of Biology Engineering, Henan University of Technology, Zhengzhou 450001, People's Republic of China.

Search for other papers by CaiYun Zhang in
Current site
Google Scholar
PubMed
Close
 MS
,
YaDong TianCollege of Livestock Husbandry and Veterinary Engineering, Henan Agricultural University, Henan Research Center of Breeding Resources for Poultry, Zhengzhou 450002, People's Republic of China.

Search for other papers by YaDong Tian in
Current site
Google Scholar
PubMed
Close
 PhD
,
FengBin YanCollege of Livestock Husbandry and Veterinary Engineering, Henan Agricultural University, Henan Research Center of Breeding Resources for Poultry, Zhengzhou 450002, People's Republic of China.

Search for other papers by FengBin Yan in
Current site
Google Scholar
PubMed
Close
 PhD
,
XiangTao KangCollege of Livestock Husbandry and Veterinary Engineering, Henan Agricultural University, Henan Research Center of Breeding Resources for Poultry, Zhengzhou 450002, People's Republic of China.

Search for other papers by XiangTao Kang in
Current site
Google Scholar
PubMed
Close
 PhD
,
RuiLi HanCollege of Livestock Husbandry and Veterinary Engineering, Henan Agricultural University, Henan Research Center of Breeding Resources for Poultry, Zhengzhou 450002, People's Republic of China.

Search for other papers by RuiLi Han in
Current site
Google Scholar
PubMed
Close
 PhD
,
GuiRong SunCollege of Livestock Husbandry and Veterinary Engineering, Henan Agricultural University, Henan Research Center of Breeding Resources for Poultry, Zhengzhou 450002, People's Republic of China.

Search for other papers by GuiRong Sun in
Current site
Google Scholar
PubMed
Close
 PhD
, and
HuiRu ZhangCollege of Biology Engineering, Henan University of Technology, Zhengzhou 450001, People's Republic of China.

Search for other papers by HuiRu Zhang in
Current site
Google Scholar
PubMed
Close
 PhD

Abstract

Objective—To determine the effects of resveratrol (RES) on growth and immune status in chickens receiving conventional vaccinations.

Animals—Two hundred forty 1-day-old layer chickens.

Procedures—Chickens received conventional vaccinations throughout the study and were randomly assigned to 1 of 4 treatments in 6 replicate pens/treatment. Treatments included 1 control group (basal diet) and 3 experimental groups fed the basal diet plus 200, 400, and 800 mg of RES/kg of diet. At 40 days of age, 1 bird/pen was randomly selected to have blood and tissues collected to determine serum immunity indices; mRNA relative expression of proinflammatory cytokines in splenocytes; mRNA relative expression of nuclear transcription factor-κB, growth hormone receptor, and insulin-like growth factor-1 in hepatocytes; cell proliferation; and apoptosis.

Results—Average daily gain, antibody titers against Newcastle disease virus and avian influenza viruses H5 and H9, and insulin-like growth factor-1 expression were quadratically increased with increasing RES concentration. In hepatocytes, growth hormone receptor gene mRNA relative expression was quadratically increased and nuclear transcription factor-κB gene mRNA relative expression was linearly decreased with increasing RES concentration. In splenocytes, nterleukin-1β and tumor necrosis factor-α mRNA relative expression was linearly decreased with increasing RES concentration. Resveratrol supplementation delayed cell proliferation and reduced apoptosis in immunocytes. With increasing RES concentration, proliferation index and relative weight of the thymus, ratio of CD4+ to CD8+ cells, and CD4+ cell count were quadratically increased, and IgM concentration was linearly increased.

Conclusions and Clinical Relevance—Dietary resveratrol supplementation improved growth, protected immunocytes against antigen-induced apoptosis, and upregulated immune response in chickens that received conventional vaccinations.

Abstract

Objective—To determine the effects of resveratrol (RES) on growth and immune status in chickens receiving conventional vaccinations.

Animals—Two hundred forty 1-day-old layer chickens.

Procedures—Chickens received conventional vaccinations throughout the study and were randomly assigned to 1 of 4 treatments in 6 replicate pens/treatment. Treatments included 1 control group (basal diet) and 3 experimental groups fed the basal diet plus 200, 400, and 800 mg of RES/kg of diet. At 40 days of age, 1 bird/pen was randomly selected to have blood and tissues collected to determine serum immunity indices; mRNA relative expression of proinflammatory cytokines in splenocytes; mRNA relative expression of nuclear transcription factor-κB, growth hormone receptor, and insulin-like growth factor-1 in hepatocytes; cell proliferation; and apoptosis.

Results—Average daily gain, antibody titers against Newcastle disease virus and avian influenza viruses H5 and H9, and insulin-like growth factor-1 expression were quadratically increased with increasing RES concentration. In hepatocytes, growth hormone receptor gene mRNA relative expression was quadratically increased and nuclear transcription factor-κB gene mRNA relative expression was linearly decreased with increasing RES concentration. In splenocytes, nterleukin-1β and tumor necrosis factor-α mRNA relative expression was linearly decreased with increasing RES concentration. Resveratrol supplementation delayed cell proliferation and reduced apoptosis in immunocytes. With increasing RES concentration, proliferation index and relative weight of the thymus, ratio of CD4+ to CD8+ cells, and CD4+ cell count were quadratically increased, and IgM concentration was linearly increased.

Conclusions and Clinical Relevance—Dietary resveratrol supplementation improved growth, protected immunocytes against antigen-induced apoptosis, and upregulated immune response in chickens that received conventional vaccinations.

Regular vaccinations are indispensable for combating infectious disease in commercial intensive poultry production by stimulating the innate immune response. However, growth inhibition can be induced because of greater proinflammatory cytokines resulting from the vaccinations.1–4 In addition, immunosuppressive effects of conventional vaccinations may be caused by apoptosis of blood leukocytes, decreased lymphocyte numbers in the secondary lymphoid organs, and immune cell apoptosis, which may result in unsuccessful vaccination.5 Apoptosis is a process of fundamental importance for regulation of the immune response as well as a defense mechanism, such as in immune reactions or when cells are damaged by pathogens or noxious agents.6–8 Persisting vaccine challenge can induce specific T-cell sequestration, dysfunction, and deletion at vaccination sites.9 Accordingly, conventional vaccinations in commercial poultry production may decrease performance and immune response and increase disease susceptibility and mortality rate.10–12 This can cause economic loss. As a result, investigating new and safe feed additives to modulate growth performance and immunity, especially in young chickens, which have an immature immune system, may provide new ways for improving health in poultry production.

As a natural product, RES (3,4′,5-trihydroxystilbene) is a phytoalexin produced by plant species in response to environmental stress or pathogenic attack. In the immune system of various animals, RES inhibits cytokine production,13 and the NF-κB inhibitory activity and anti-inflammatory activity of RES have been confirmed.14,15 In addition, the immunomodulatory effect of RES includes suppression of lymphocyte stimulation as well as its effect on apoptosis of stimulated lymphocytes.16 Activation-induced lymphocyte apoptosis was also reduced in the presence of RES. Resveratrol appears to protect activated human B lymphocytes from apoptosis by upregulating the antiapoptotic protein Bcl-2.17 Low-dose RES enhances the cell-mediated immune response of mice.18 Despite the apparent importance of RES effects on inflammatory response and immunomodulation, data concerning the relationships between RES and growth performance and immunologic function have not been reported in poultry. The objective of the study reported here was to examine the effects of RES supplementation on growth performance and immunity in chickens receiving conventional commercial vaccinations and to explore the potential mechanisms through which RES functions. Our hypothesis was that RES can improve growth by inhibiting cytokine production and upregulated immune response by protecting immunocytes against antigen-induced apoptosis in chickens that received conventional vaccinations.

Materials and Methods

Animal care and diets—Two hundred forty 1-day-old commercial crossbred (LuoDaoHong × White Lai-Hang) layer chickens with an initial body weight of 35.6 ± 0.6 g (mean ± SD) were used in this study. The experimental procedures and the animal use and care protocols were approved by the Committee on Ethical Use of Animals of the Department of Science and Technology of Henan Province. Chickens were wing banded, weighed, and randomly assigned to 1 of 4 dietary treatments. Chickens were placed in 6 replicate pens for each treatment with 10 birds/pen in wire-floored battery brooders in an environmentally controlled room with electrical heating. The room temperature was maintained at 30° to 35°C from days 0 to 3, then gradually reduced 2° to 3°C/wk until it reached 22°C. Chickens were exposed to a 23-hour light and 1-hour dark photoperiod. All experimental treatments used the same corn-soybean meal basal diet (Appendix 1) fed in mash form.

Experimental design—The 4 treatments included a control group fed the basal diet and 3 experimental groups fed the basal diet plus 200, 400, or 800 mg of RES/kg of diet (in powder form), respectively (high-performance liquid chromatography testing confirmed that 50% of the supplement was RES and 50% was inert carrier). The RES supplemental concentrations were chosen according to results of a preliminary experiment and previous studies.19,20 The RES was naturally derived from giant knotweed and was provided by a biotechnology company.a The RES was gradually mixed into the basal diet to guarantee uniform mixture. Diets were quantitatively fed to each chicken. Water and feed were provided ad libitum during the 40-day experimental period. At the end of 20 and 40 days, birds and residual feed were weighed. Weight gain and feed conversion for each phase were calculated.

Vaccination procedure—A conventional vaccination procedure was applied in this study, as follows: day 0, IM injection of Marek's disease virus vaccineb (in hatchery); day 7, intranasal and ocular administration of NDV (LaSota 4)c–e and infectious bronchitis virus (H120)c–e vaccines and SC administration of NDV oil emulsion vaccinec–e; day 14, oral administration of infectious bursal disease virus vaccinec–e; day 21, oral administration of infectious bursal disease virus vaccine; day 28, SC administration of avian influenza oil emulsion vaccinec–e; day 35, oral administration of NDV (LaSota 4) and infectious bronchitis virus (H120) vaccines.

Sample collection and preparation—At 40 days of age, 1 bird/pen was randomly selected, and 5 mL of blood was drawn from the heart (2 mL of blood without anticoagulant used for serum analysis; 3 mL blood with anticoagulant used for enumeration of CD4+ and CD8+ cells). Serum was prepared by centrifugation of clotted blood samples at 4,520 × g for 20 minutes. After bleeding, chickens were euthanized by administration of ether, and liver, spleen, bursa of Fabricius, and thymus were aseptically obtained. A portion of the thymus was preserved in neutral-buffered 10% formalin for immunohistochemical evaluation, and the remainder of the organs were immediately frozen in liquid nitrogen and stored at −80°C for assays of mRNA expression of genes and apoptosis.

Serum assays—Serum concentrations of IL-1β, IL-6, TNF-α, growth hormone, and IGF-1 were analyzed with commercially available chicken ELISA kits,c–g according to the manufacturer's instructions. Serum concentrations of antibodies against NDV, H5, and H9 were measured with a hemagglutination-inhibition assay21 at the Institute of Poultry Disease, Henan Agricultural University, China.

mRNA relative expression of proinflammatory cytokines NF-κB, GHR, and IGF-1—The mRNA relative expression of proinflammatory cytokines (IL-1β, IL-6, and TNF-α) in splenocytes and NF-κB, GHR, and IGF-1 in hepatocytes was determined by means of RT-qPCR assay. Total RNA was isolated from spleen and liver tissue with a reagent according to the manufacturer's instructions.h Integrity of the RNA was verified electrophoretically by ethidium bromide staining and quantified. Purity of the RNA was determined with UV-clear microplates at an optical density of 260 nm. The optical density 260 to optical density 280 ratios of all samples were from 1.8 to 2.0.

Total RNA was reverse transcribed. Briefly, 2 μL of RNA isolated from each cell sample was added to a 40-μL reaction mix containing 1.0 μL of oligo-dT18,i 1.0 μL of dNTPs,j 1.0 μL of RNasin inhibitor,i 2.0 μL of M-MLV transcriptase,i 8.0 μL of M-MLV reverse transcriptase reaction buffer,i and 25 μL of RNase-free water. Primers were designed (span exon-exon boundaries) on the basis of sequences of IL-1β (GenBank accession No. DQ393267), IL-6 (GenBank accession No. NM-204628), TNF-α (GenBank accession No. AY765397), NF-κB (GenBank accession No. D13721), GHR (GenBank accession No. NC-006127), IGF-1 (GenBank accession No. NM-001004384), and GAPDH (GenBank accession No. NM-204305) of chickens. Primers were used for PCR amplification of cDNA and quantification by use of RT-qPCR assay. The primer sequences used were tabulated (Appendix 2).

The mRNA expression levels of the target genes (IL-1 β, IL-6, TNF-α, GHR, IGF-1, and NF-κB) and the housekeeping gene GAPDH were determined with RT-qPCR assay. The assay was performed by means of an RT-qPCR kit.k The reaction system consisted of a 25-μL final volume including 2 μL of cDNA, 12.5 μL of DNA polymerase,k 0.5 μL of a reference dye,k 1 μL of 20pM primer mix of each gene, and 9 μL of double-distilled water. The reaction conditions for the RT-qPCR machine,l were 1 cycle of enzyme inactivation for 3 minutes at 95°C followed by 40 cycles of amplification, including initial denaturation at 95°C for 15 seconds, annealing at 60°C for 40 seconds, and elongation at 95°C for 15 seconds.

A melting curve with 1 peak was obtained to determine the possibility of nonspecific amplification or primerdimer formation. On the basis of the cycle threshold (CT), the relative content of mRNA was calculated and normalized as the mRNA relative expression of IL-1β, IL-6, TNF-α, GHR, IGF-1, and NF-κB. The relative expression of the target gene was calculated by the 2–ΔΔCT method22:

article image

Relative expression of target gene = 2–ΔΔCT Where the housekeeping gene was GAPDH.

Cell proliferation and apoptosis—The spleen, bursa of Fabricius, and thymus were thawed and placed in ice-cold Hank balanced salt solution containing 140mM NaCl, 5mM KCl, 2.5mM CaCl2, 1.1mM MgCl2, 5.6mM glucose, and 10mM HEPES, at a pH of 7.4. The tissues were cut into small pieces and homogenized with a tissue grinder. The cell suspensions were washed in Hank balanced salt solution.

The cell cycle, cell proliferation index, and apoptosis ratio were detected with a propidium iodide staining assay by use of flow cytometry.m The specific method has been discussed by Ormerod.23 Samples were analyzed by collection of 10,000 events; forward light scatter (forward scatter), right angle light scatter (side scatter), and 2-color fluorescence were analyzed. The light scatter and the fluorescence signals were set in a logarithmic gain and were stored in list-mode data files. The obtained data were further analyzed with a software program.n Cell cycle was detected. Flow cytometry was used to detect the P-glycoprotein on the surface of the cells, the intracellular concentration of daunomycin, and the immune type of the cells. Proliferation index, which indicates cell proliferation activity, was determined:

article image

where G0 is the rest phase in cell division. G1 is the gap that precedes DNA synthesis. S is the DNA synthesis phase, G2 is the gap between DNA synthesis and mitosis, and Mis the mitotic phase.

Apoptosis in the thymus—Expressions of Bcl-2, Fas, FasL, and caspase-3 apoptosis were determined with a streptavidin-peroxidase immunostaining kit according to the manufacturer's instructions. Analysis of all samples was conducted by calculating the ratio of labeled cells to total cells in 10 fields of view by light microscopy at 400× magnification. To qualitatively assess the number of labeled cells, slides were subjectively scored as ++++ when a high number of cells were labeled and ++ when a moderate number of cells were labeled.

CD4+ and CD8+ cells—Absolute counts of CD4+ cells, CD8+ cells, and their ratios in peripheral blood mononuclear cell samples were determined by flow cytometry.m Isolation of the mononuclear cells was conducted according to the method of Dalgaard et al.24 Monoclonal antibodies used were specific for chicken cell surface markers.o

IgA, IgM, and IgG in serum—Serum concentrations of immunoglobulins (IgA, IgM, and IgG) were analyzed by use of commercially available chicken ELISA quantitation kits according to the manufacturer's instructions.p

Statistical analysis—Data were analyzed with a statistical analysis packageq and expressed as mean ± SEM. Analysis evaluated the effect of RES on each group independently by use of ANOVA with linear and quadratic contrasts. For all comparisons, a value of P < 0.05 was considered significant.

Results

Growth performance—The effects of the different treatments were determined (Table 1). The ADG increased quadratically (P < 0.05) with increasing RES during days 1 to 20 and 1 to 40 of the trial. The group fed 400 mg of RES/kg had the highest ADG.

Table 1—

Growth performance variables (mean values) associated with supplemental feeding of RES in chickens that received conventional vaccinations.

 RES concentration (mg/kg of feed)P value
Variable0200400800SEMLinearQuadratic
1–20 days*
 ADFI (g)15.5515.0615.5114.970.440.320.87
 ADG (g)6.597.217.407.230.250.040.02
 F:G2.302.052.072.050.130.120.16
21–40 days*
 ADFI (g)29.4229.5230.6231.121.470.200.91
 ADG (g)12.3812.2412.4513.260.360.010.17
 F:G2.802.812.872.670.070.070.06
1–40 days*
 ADFI (g)22.4822.2923.0523.070.790.340.90
 ADG (g)9.499.7310.259.920.250.100.05
 F:G2.362.292.262.320.090.690.23

Feeding period (age of chickens).

ADFI = Average daily feed intake. F:G = Feed-to-gain ratio.

Serum assays—Anti-NDV, anti-H5, and anti-H9 antibody titers of chickens in the 4 groups were determined (Table 2). At 40 days of age, these antibody titers were increased quadratically with increasing RES (P < 0.05). The group fed 400 mg of RES/kg had the highest antibody titers.

Table 2—

Antiviral antibody titers (mean values) associated with supplemental feeding of RES in chickens that received conventional vaccinations.

 RES concentration (mg/kg of feed)P value
Virus0200400800SEMLinearQuadratic
NDV5.006.837.505.500.560.790.01
H51.503.503.502.830.430.780.02
H91.502.833.002.000.490.730.01

The concentration of IGF-1 in serum was increased quadratically (P < 0.05) with increasing RES (Table 3). The highest IGF-1 concentration was observed in the group fed 400 mg of RES/kg.

Table 3—

Hormone and cytokine variables (mean values [nmol/L]) associated with supplemental feeding of RES in chickens that received conventional vaccinations.

 RES concentration (mg/kg of feed)P value
Variable0200400800SEMLinearQuadratic
GH0.931.010.990.970.060.760.28
IGF-117.3517.8118.6718.560.420.160.02
IL-1β29.9817.9317.1018.615.690.110.77
IL-625.3124.2722.8723.671.160.160.14
TNF-α50.2847.6543.0543.422.470.080.13

GH = Growth hormone.

mRNA relative expression of proinflammatory cytokines NF-κB, GHR, and IGF-1—Gene mRNA relative expression levels associated with the different treatments were determined (Table 4). In hepatocytes, GHR mRNA relative expression was increased quadratically and NF-κB mRNA relative expression was decreased linearly with increasing RES (P < 0.05), and the group fed 400 mg of RES/kg had the highest GHR mRNA expression. In splenocytes, IL-1β and TNF-α mRNA relative expression was decreased linearly with increasing RES (P < 0.05).

Table 4—

Gene mRNA expression levels (mean values) in hepatocytes (GHR, IGF-1, and NF-κB) and splenocytes (IL-1β, IL-6, and TNF-α) associated with supplemental feeding of RES in chickens that received conventional vaccinations.

 RES concentration (mg/kg of feed)P value
Gene0200400800SEMLinearQuadratic
Hepatocytes
 GHR1.001.211.711.340.080.060.00
 IGF-11.001.371.591.510.210.080.14
 NF-κB1.000.950.930.920.150.020.06
Splenocytes
 IL-1β1.000.880.640.630.150.010.20
 IL-61.000.920.860.880.100.070.17
 TNF-α1.000.850.780.750.140.010.07

Cell proliferation and apoptosis—The effects of the different treatments on cell cycle, cell proliferation index, and apoptosis in splenocytes, bursa of Fabricius, and thymocytes were determined (Tables 5–7). A large proportion of cells were in the G0 or G1 phases of the cell cycle (Figure 1). The splenocyte proliferation-to-apoptosis ratio was decreased linearly (P < 0.05) with increasing RES. In the bursa of Fabricius, the percentage of S-phase cells was linearly increased (P < 0.05) and the apoptosis ratio was linearly decreased (P < 0.05) with increasing RES. The percentage of cells in G0 or G1 was linearly decreased (P < 0.05) and the percentage of S-phase cells was linearly increased (P < 0.05) with increasing RES. In the thymocytes, the proliferation index and relative weight of thymus were quadratically increased (P < 0.05) with increasing RES.

Figure 1—
Figure 1—

Results of flow cytometric analysis of cell cycle, cell proliferation phase distribution, and apoptosis peak of thymocytes from 40-day-old chickens that were fed a basal diet not supplemented with RES and received conventional vaccinations. G0 = Rest phase in cell division. G1 = Gap that precedes DNA synthesis. S = DNA synthesis phase. G2 = Gap between DNA synthesis and mitosis. M = Mitotic phase.

Citation: American Journal of Veterinary Research 75, 8; 10.2460/ajvr.75.8.752

Table 5—

Splenocyte proliferation variables, splenocyte apoptosis, and spleen weight-to-body weight ratios (mean values) associated with supplemental feeding of RES in chickens that received conventional vaccinations.

 RES concentration (mg/kg of feed)P value
Variable0200400800SEMLinearQuadratic
G0:G1 (%)79.7576.7076.1277.612.080.380.10
G2:M (%)17.4020.8321.2419.951.580.550.09
S (%)2.852.472.642.440.520.080.15
Proliferation index20.3223.3623.9322.351.080.480.06
Apoptosis ratio (%)0.280.260.220.220.020.040.82
Spleen weight-to-body weight ratio1.881.802.142.230.200.060.23

G0 = Rest phase in cell division. G1 = Gap that precedes DNA synthesis. S = DNA synthesis phase. G2 = Gap between DNA synthesis and mitosis. M = Mitotic phase.

Table 6—

Bursal cell proliferation variables, bursal cell apoptosis, and bursa of Fabricius weight-to-body weight ratios (mean values) associated with supplemental feeding of RES in chickens that received conventional vaccinations.

 RES concentration (mg/kg)P value
Variable0200400800SEMLinearQuadratic
G0:G1 (%)74.8173.6070.4372.653.180.230.08
G2:M (%)9.895.708.075.701.150.120.18
S (%)15.3020.7021.5021.651.860.030.20
Proliferation index25.1726.4229.5926.422.890.100.08
Apoptosis ratio (%)0.880.860.750.760.060.040.28
Bursa of Fabricius weight-to-body weight ratio1.301.351.321.400.040.160.35

See Table 5 for key.

Table 7—

Thymocyte proliferation variables, thymocyte apoptosis, and thymus weight-to-body weight ratios (mean values) associated with supplemental feeding of RES in chickens that received conventional vaccinations.

 RES concentration (mg/kg)P value
Variable0200400800SEMLinearQuadratic
G0:G1 (%)76.5273.7067.4067.801.580.040.15
G2:M (%)9.877.9011.357.432.050.180.10
S (%)13.6118.4021.2524.771.880.020.08
Proliferation index23.7827.3434.6032.201.300.120.04
Apoptosis ratio (%)4.594.323.953.720.600.060.20
Thymus weight-to-body weight ratio3.233.584.163.890.340.280.02

See Table 5 for key.

Apoptosis in the thymus—Results of apoptosis-related protein expression in the thymus were determined (Table 8). The expression of FasL and caspase-3 was decreased linearly (P < 0.05) with increasing RES. Bcl-2 and Fas apoptins did not differ significantly.

Table 8—

Apoptosis-related protein expression (mean values) associated with supplemental feeding of RES in chickens that received conventional vaccinations.

 RES concentration (mg/kg of feed)P value
Variable0200400800SEMLinearQuadratic
Bcl-26.175.676.176.330.270.340.12
Fas3.502.671.832.500.280.200.06
FasL7.176.005.335.170.410.030.10
Caspase-33.503.332.802.500.390.040.32

Bcl-2 = B-cell lymphoma-2.

Immune cells—The CD4+ to CD8+ ratio and the concentration of CD4+ T cell were increased quadratically (P < 0.05). The concentration of IgM was increased linearly (P < 0.05) with increasing RES concentration (Table 9).

Table 9—

Immunity indices (mean values) associated with supplemental feeding of RES in chickens that received conventional vaccinations.

 RES concentration (mg/kg of feed)P value
Variable0200400800SEMLinearQuadratic
CD4 (%)17.6818.2620.5319.181.030.110.04
CD8 (%)28.2926.1523.4625.373.150.130.06
CD4/CD80.620.700.830.720.080.220.03
IgA (g/L)0.400.380.420.450.060.100.12
IgG (g/L)0.650.680.660.700.120.220.16
IgM (g/L)0.240.280.320.350.050.040.08

Discussion

Chickens reared in commercial-intensive facilities are usually conventionally vaccinated to protect them against a variety of diseases. Although vaccinations against viruses are typically effective, management measures also may be undertaken to help chickens cope with the subsequent vaccination-induced stress.25 Persistent antigenic stimuli in the rearing environment have negative effects on the growth of livestock because they cause production of potent proinflammatory cytokines (IL-1β, IL-6, and TNF-α).1 This restricts anabolic growth factors and thus suppresses growth to ensure that adequate energy and nutrients are available for high-priority immunologic and homeostatic pathways. A quiescent immune system is desirable to obtain maximum growth performance. In the present study RES supplementation may have improved ADG. This indicated that RES supplementation may be an effective way to improve growth in chickens that receive conventional vaccinations.

The mechanism by which RES may improve growth may be associated with reduced NF-κB activation and inflammatory response. Nuclear transcription factors-play a pivotal role in inflammation, and inhibitor of κB kinase mediates NF-κB activation in response to proinflammatory cytokines and microbial products.26,27 Resveratrol can inhibit the NF-κB pathway, resulting in suppression of transcription of proinflammatory cytokines (IL-1β and TNF-α). In addition, GHR and IGF-1 mRNA expression levels are improved in a state of low inflammatory response. Thus, dietary RES may reduce the growth-suppressive effects induced by the inflammatory response resulting from conventional vaccinations. Wong et al2 found that proinflammatory cytokines may affect child growth through systemic mechanisms that reduce concentrations of IGF-1 and cause an abnormal GH response.2 In the present study, RES supplementation improved GHR and IGF-1 expression.

Conventional vaccinations can induce chronic inflammation, immunocyte apoptosis, and immune dysfunction2,3 resulting in the suppression of the immune response and unsuccessful vaccination. Various studies have found that induced immunosuppression is at least in part attributable to a reduction in the number of immunocytes.28–30 Reductions in these cells may reflect changes in the dynamics of immunocyte migration and recirculation or absolute decrease in total cell numbers because of cell apoptosis. Apoptosis is a tightly regulated program of cell death involved in various physiologic and pathological processes, such as the maintenance of immune homeostasis. The induction of apoptosis by various factors may play an important role in pathogenesis because apoptosis of immunocytes might favor bacterial invasion.31–34 Enhanced immunocyte apoptosis can cause immunodeficiency through cell loss. Resveratrol protects against activation-induced lymphocyte apoptosis in vitro.16 The present study revealed that RES may delay cell proliferation of splenocytes, bursa of Fabricius cells, and thymocytes and reduce apoptosis in chickens exposed to conventional vaccination conditions. The mechanism of the antiapoptotic activity may be that RES affects protein expression of apoptotic regulators (FasL and caspase-3) that results in initiation of the immunocyte apoptosis program. Resveratrol supplementation may decrease the relative expression of FasL and caspase-3 in chickens that receive conventional commercial vaccinations.

The Fas-FasL system plays an integral role in maintaining cellular homeostasis of the immune system. The stress of chronic restraint induces lymphocyte reduction through endogenous opioid-mediated Fas expression, which in turn induces apoptosis.35,36 Results of the present study revealed that RES may have improved NDV, H5, and H9 antibody titers; the ratio of CD4+ to CD8+; and IgM concentration. This indicated that RES supplementation may be an effective way to increase immune function in chickens that receive conventional commercial vaccinations. Further studies are needed to evaluate the effects of RES and determine suitable concentrations of RES for feed supplementation.

ABBREVIATIONS

ADG

Average daily gain

FasL

Fas ligand

GAPDH

Glyceraldehyde phosphate dehydrogenase

GHR

Growth hormone receptor

H5

Avian influenza virus H5

H9

Avian influenza virus H9

IGF-1

Insulin-like growth factor

IL

Interleukin

NDV

Newcastle disease virus

NF-κB

Nuclear transcription factor-κB

RES

Resveratrol

RT-qPCR

Real-time quantitative PCR

TNF-α

Tumor necrosis factor-α

a.

Zhengzhou LiNuo Biotech Co Ltd, Zhengzhou, China.

b.

Qilu Animal Health Products Co Ltd, Jinan, China.

c.

IL-1β kit, R&D Systems Inc, Minneapolis, Minn.

d.

IL-6 kit, R&D Systems Inc, Minneapolis, Minn.

e.

TNF-α kit, R&D Systems Inc, Minneapolis, Minn.

f.

GH kit, JiangLai Biological Science and Technology Ltd Co, Shanghai, China.

g.

IGF-1 kit, JiangLai Biological Science and Technology Ltd Co, Shanghai, China.

h.

TRIzol, Promega Biotech Co Ltd, Beijing, China.

i.

Promega Biotech Co Ltd, Beijing, China.

j.

Sigma-Aldrich Biotech Co Ltd, Beijing, China.

k.

Takara Biotech Co Ltd, Dalian, China.

l.

7300 Real-Time PCR System, Applied Biosystems Inc, Foster City, Calif.

m.

EPICS XL-MCL Flow Cytometer, Beckman Coulter, Brea, Calif.

n.

WinMDI, version 2.8, Joe Trotter, Scripps Research Institute, La Jolla, Calif.

o.

BD Co, Franklin Lakes, NJ.

p.

ZhongShanJinQiao Co Ltd, Beijing, China.

q.

SPSS Statistics, version 17.0, SPSS Inc, Beijing, China.

References

  • 1. Johnson RW. Inhibition of growth by pro-inflammatory cytokines: an integrated view. J Anim Sci 1997; 75: 12441255.

  • 2. Wong SC, MacRae VEP & Grogan MC, et al. The role of pro-inflammatory cytokines in inflammatory bowel disease growth retardation. J Pediatr Gastroenterol Nutr 2006; 43: 144155.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 3. Christian LM, Iams JD & Porter K, et al. Inflammatory responses to trivalent influenza virus vaccine among pregnant women. Vaccine 2011; 29: 89828987.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 4. Christian LM, Porter K & Karlsson E, et al. Serum proinflammatory cytokine responses to influenza virus vaccine among women during pregnancy versus non-pregnancy. Am J Reprod Immunol 2013; 70: 4553.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 5. Ato M, Takahashi Y & Fujii H, et al. Influenza A whole virion vaccine induces a rapid reduction of peripheral blood leukocytes via interferon-α-dependent apoptosis. Vaccine 2013; 31: 21842190.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 6. Norbury CJ, Hickson ID. Cellular responses to DNA damage. Annu Rev Pharmacol Toxicol 2001; 41: 367401.

  • 7. Watanabe K, Jinnouchi K & Inai S, et al. Induction of apoptosis in the vestibule of guinea pigs after middle ear inoculation with lipopolysaccharide (LPS). Auris Nasus Larynx 2003; 30: 355361.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 8. Häcker G, Fischer SF. Bacterial anti-apoptotic activities. FEMS Microbiol Lett 2002; 211: 16.

  • 9. Hailemichael Y, Dai Z & Jaffarzad N, et al. Persistent antigen at vaccination sites induces tumor-specific CD8+ T cell sequestration, dysfunction and deletion. Nat Med 2013; 19: 465472.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 10. Apanius V. Stress and immune defense. Adv Study Behav 1998; 27: 133153.

  • 11. He X, Yang XJ, Guo YM. Effects of different dietary oil sources on immune function in cyclophosphamide immunosuppressed chickens. Anim Feed Sci Technol 2007; 139: 186200.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 12. Tayade C, Jaiswal TN & Mishra SC, et al. l-arginine stimulates immune response in chickens immunized with intermediate plus strain of infectious bursal disease vaccine. Vaccine 2006; 24: 552560.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 13. Tsai SH, Lin-Shiau SY, Lin JK. Suppression of nitric oxide synthase and the down-regulation of the activity of NF-κB in macrophages by resveratrol. Br J Pharmacol 1999; 126: 673680.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 14. Kumar A, Sharma SS. NF-κB inhibitory action of resveratrol: a probable mechanism of neuroprotection in experimental diabetic neuropathy. Biochem Biophys Res Commun 2010; 394: 360365.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 15. Gao X, Xu YX & Janakiraman N, et al. Immunomodulatory activity of resveratrol: Suppression of lymphocyte proliferation, development of cell-mediated cytotoxicity, and cytokine production. Biochem Pharmacol 2001; 62: 12991308.

    • Search Google Scholar
    • Export Citation
  • 16. Hsieh T, Halicka D & Lu XH, et al. Effects of resveratrol on the G0–G1 transition and cell cycle progression of mitogenically stimulated human lymphocytes. Biochem Biophys Res Commun 2002; 297: 13111317.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 17. Zunino SJ, Storms DH. Resveratrol alters proliferative responses and apoptosis in human activated B lymphocytes in vitro. J Nutr 2009; 139: 16031608.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 18. Feng YH, Zhou WL & Wu QL, et al. Low dose of resveratrol enhanced immune response of mice. Acta Pharmacol Sin 2002; 23: 893897.

  • 19. Sahin K, Akdemir F & Orhan C, et al. Effects of dietary resveratrol supplementation on egg production and antioxidant status. Poult Sci 2010; 89: 11901198.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 20. Sahin K, Orhan C & Akdemir F, et al. Resveratrol protects quail hepatocytes against heat stress: modulation of the Nrf2 transcription factor and heat shock proteins. J Anim Physiol Anim Nutr (Berl) 2012; 96: 6674.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 21. Ma ZH, Guo DY & Wang YL, et al. Effects of sulfated polysaccharides and their prescriptions on immune response of ND vaccine in chicken. Carbohydr Polym 2010; 82: 913.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 22. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2-ΔΔCT method. Methods 2001; 25: 402408.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 23. Ormerod MG. Analysis of DNA—general methods. In: Ormerod MG, ed. Flow cytometry: a practical approach. 3rd ed. Oxford, England: Oxford University Press, 2000;8398.

    • Search Google Scholar
    • Export Citation
  • 24. Dalgaard TS, Norup LR & Pedersen AR, et al. Flow cytometric assessment of chicken T cell-mediated immune responses after Newcastle disease virus vaccination and challenge. Vaccine 2010; 28: 45064514.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 25. Wu CC, Dorairajan T, Lin TL. Effect of ascorbic acid supplementation on the immune response of chickens vaccinated and challenged with infectious bursal disease virus. Vet Immunol Immunopathol 2000; 74: 145152.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 26. Lawrence T, Bebien M, Liu GY. IKKα limits macrophage NF-κB activation and contributes to the resolution of inflammation. Nature 2005; 434: 11381143.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 27. Pikarsky E, Porat RM & Ilan S, et al. NF-κB functions as a tumour promoter in inflammation-associated cancer. Nature 2004; 431: 461466.

  • 28. Berthiaume F, Aparicio CL & Eungdamrong J, et al. Age- and disease-related decline in immune function: an opportunity for ‘thymus-boosting’ therapies. Tissue Eng 1999; 5: 499514.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 29. Pariante CM, Carpiniello B & Orru MG, et al. Chronic caregiving stress alters peripheral blood immune parameters: the role of age and severity of stress. Psychother Psychosom 1997; 66: 199207.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 30. Zorrilla EP, Luborsky L & McKay JR, et al. The relationship of depression and stressors to immunological assays: a meta-analytic review. Brain Behav Immun 2001; 15: 199226.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 31. Rodrigues VS, Vidotto MC & Felipe I, et al. Apoptosis of murine peritoneal macrophages induced by an avian pathogenic strain of Escherichia coli. FEMS Microbiol Lett 1999; 179: 7378.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 32. Guichon A, Zychlinsky A. Clinical isolates of Shigella species induce apoptosis in macrophages. J Infect Dis 1997; 175: 470473.

  • 33. Finlay BB, Cossart P. Exploitation of mammalian host cell functions by bacterial pathogens. Science 1997; 276: 718725.

  • 34. Shao JZ, Liu J, Xiang LX. Aeromonas hydrophila induces apoptosis in Carassius auratus lymphocytes in vitro. Aquaculture 2004; 229: 1113.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 35. Yin D, Mufson RA & Wang R, et al. Fas-mediated cell death promoted by opioids. Nature 1999; 397: 218.

  • 36. Yin D, David TR & Allan M, et al. Chronic restraint stress promotes lymphocyte apoptosis by modulating Cd95 expression. J Exp Med 2000; 191: 14231428.

    • Crossref
    • Search Google Scholar
    • Export Citation

Appendix 1

Ingredient composition and nutritional content of a basal diet fed to chickens.

VariableValue
Ingredients
 Corn (%)65.50
 Soybean meal (%)30.00
 Soybean oil (%)1.20
 Dicalcium phosphate (%)1.60
 Limestone (%)1.20
 NaCl (%)0.30
 l-lysine (%)0.20
 Vitamin and mineral premix (%)1.00
Nutrient content
 Metabolizable energy (Kcal/kg)3,150
 Crude protein (%)20.30
 Calcium (%)0.90
 Total phosphorus (%)0.60
 Lysine (%)1.15
 Methionine + cystine (%)0.85

Vitamin-mineral premix provided the following per kilogram of complete diet: vitamin A, 8,000 U; vitamin D3, 1,750 U; vitamin E, 15 U; vitamin B12, 10 μg; riboflavin, 5 mg; D-pantothenic acid, 10 mg; niacin, 20 mg; choline chloride, 400 mg; manganese, 70 mg; zinc, 70 mg; iron, 85 mg; copper, 8 mg; iodine, 0.5 mg; and selenium, 0.3 mg.

Appendix 2

Primers used for quantification of GAPDH, IL-1β, IL-6, TNF-α, NF-κB, GH, and IGF-1 mRNA gene expression in a study of dietary reservatrol supplementation in chickens.

GenePrimer sequencePCR product length
GAPDHF: 5′ATGGCATCCAAGGAGTGA3′141
 R: 5′GGGAGACAGAAGGGAACAG3′ 
IL-1βF: 5′ACAGTCCTTCGACATCTTCGAC3′202
 R: 5′GAGCTTGTAGCCCTTGATGC3′ 
IL-6F: 5′TGAAGTGGTCATCCCAGACTC3′213
 R: 5′CCTCACGGTCTTCTCCATAAAC3′ 
TNF-αF: 5′TGAGGCATTTGGAAGCAG3′198
 R: 5′TTGTGGGACAGGGTAGGG 3′ 
NF-κBF: 5′AGTGTGTGAAGAAACGGGAACT3′194
 R: 5′ATAGATGGGCTGGGAGAGGAC3′ 
GHRF: 5′GCGTGTTCAGGAGCAAAGCT 3′132
 R: 5′TGGGACAGGCATTTCCATACTT3′ 
IGF-1F: 5′TGTACTGTGCTCCAATAAAGC3′113
 R: 5′CTGTTTCCTGTGTTCCCTCTACTTG3′ 

F = Forward. R = Reverse.

Contributor Notes

This manuscript represents a portion of a thesis submitted by CaiYun Zhang to the Henan Agricultural University College of Livestock Husbandry and Veterinary Engineering as partial fulfillment of the requirements for a Doctor of Philosophy degree.

Supported by the Earmarked Fund for Modern Agro-industry Technology Research System.

Address correspondence to Dr. Kang (xtkang2001@263.net).