Effect of intramammary administration of prednisolone on the blood-milk barrier during the immune response of the mammary gland to lipopolysaccharide

Olga Wellnitz Department of Veterinary Physiology, Vetsuisse Faculty, University of Bern, 3001 Bern, Switzerland.

Search for other papers by Olga Wellnitz in
Current site
Google Scholar
PubMed
Close
 Dr med vet
,
Samantha K. Wall Department of Veterinary Physiology, Vetsuisse Faculty, University of Bern, 3001 Bern, Switzerland.

Search for other papers by Samantha K. Wall in
Current site
Google Scholar
PubMed
Close
 MS
,
Makhabbat Saudenova Department of Veterinary Physiology, Vetsuisse Faculty, University of Bern, 3001 Bern, Switzerland.

Search for other papers by Makhabbat Saudenova in
Current site
Google Scholar
PubMed
Close
 MS
, and
Rupert M. Bruckmaier Department of Veterinary Physiology, Vetsuisse Faculty, University of Bern, 3001 Bern, Switzerland.

Search for other papers by Rupert M. Bruckmaier in
Current site
Google Scholar
PubMed
Close
 PhD

Click on author name to view affiliation information

Abstract

Objective—To investigate effects of intramammary administration of prednisolone on the immune response of mammary glands in cows.

Animals—5 lactating Red Holsteins.

Procedures—Cows received a different intramammary infusion in each mammary gland (10 mg of prednisolone, 100 μg of lipopolysaccharide [LPS], 100 μg of LPS and 10 mg of prednisolone, or saline [0.9% NaCl] solution). Milk samples were collected before (time 0) and 3, 6, 9, 12, 24, and 36 hours after treatment. Somatic cell count (SCC), lactate dehydrogenase (LDH) activity, and concentrations of serum albumin (SA) and tumor necrosis factor (TNF)-α in milk and mRNA expression of TNF-α, interleukin (IL)-8, and IL-1β in milk somatic cells were analyzed.

Results—Saline solution or prednisolone did not change SCC, LDH activity, and SA and TNF-α concentrations in milk and mRNA expression of TNF-α, IL-1β, and IL-8 in milk somatic cells. The SCC and TNF-α concentration in milk increased similarly in glands infused with LPS, independent of prednisolone administration. However, the increase of LDH activity and SA concentration in milk after LPS infusion was diminished by prednisolone administration. The mRNA expression of TNF-α, IL-8, and IL-1β in milk somatic cells increased after LPS infusion and was unaffected by prednisolone.

Conclusions and Clinical Relevance—Intramammary administration of prednisolone did not induce an immune response and did not change mRNA expression of TNF-α, IL-8, and L-1β during the response to intramammary administration of LPS. However, prednisolone reduced disruption of the blood-milk barrier. This could influence the severity and cure rate of mastitis.

Abstract

Objective—To investigate effects of intramammary administration of prednisolone on the immune response of mammary glands in cows.

Animals—5 lactating Red Holsteins.

Procedures—Cows received a different intramammary infusion in each mammary gland (10 mg of prednisolone, 100 μg of lipopolysaccharide [LPS], 100 μg of LPS and 10 mg of prednisolone, or saline [0.9% NaCl] solution). Milk samples were collected before (time 0) and 3, 6, 9, 12, 24, and 36 hours after treatment. Somatic cell count (SCC), lactate dehydrogenase (LDH) activity, and concentrations of serum albumin (SA) and tumor necrosis factor (TNF)-α in milk and mRNA expression of TNF-α, interleukin (IL)-8, and IL-1β in milk somatic cells were analyzed.

Results—Saline solution or prednisolone did not change SCC, LDH activity, and SA and TNF-α concentrations in milk and mRNA expression of TNF-α, IL-1β, and IL-8 in milk somatic cells. The SCC and TNF-α concentration in milk increased similarly in glands infused with LPS, independent of prednisolone administration. However, the increase of LDH activity and SA concentration in milk after LPS infusion was diminished by prednisolone administration. The mRNA expression of TNF-α, IL-8, and IL-1β in milk somatic cells increased after LPS infusion and was unaffected by prednisolone.

Conclusions and Clinical Relevance—Intramammary administration of prednisolone did not induce an immune response and did not change mRNA expression of TNF-α, IL-8, and L-1β during the response to intramammary administration of LPS. However, prednisolone reduced disruption of the blood-milk barrier. This could influence the severity and cure rate of mastitis.

Mastitis, an inflammation of the mammary gland, is a considerable problem in dairy cattle. These inflammations are predominantly caused by bacteria. The most effective and widely used treatment for intramammary bacterial infections in dairy cows is the administration of antimicrobials parenterally or directly into the mammary gland via the teat orifice. Antimicrobials can inhibit or destroy pathogenic bacteria, but they usually do not directly influence inflammatory reactions within the mammary gland. In European countries, glucocorticoids, such as prednisolone, frequently are added to intramammary infusions of antimicrobials to facilitate the cure of infected mammary glands, and combination products that contain antimicrobials and glucocorticoids are commercially available in many European countries, including Switzerland. In the United States, products that contain a combination of antimicrobials and glucocorticoids are not available for intramammary infusion.1 However, in some situations, glucocorticoids may be administered parenterally and used concurrently with antimicrobials in cattle with mastitis in the United States.1 Requirements exist for the extra-label use of drugs in cattle in the United States.2

Glucocorticoids have anti-inflammatory effects. They suppress the synthesis of proinflammatory cytokines that are important for the initiation of inflammation.3 Glucocorticoids also influence the function of immune cells. For example, dexamethasone extends the life span of bovine neutrophils through inhibition of apoptosis by downregulation of the surface death receptor Fas.4 In addition, glucocorticoids influence the function of leukocytes and the recruitment of cells to inflammatory sites through alterations in the production of cytokines and chemokines.5 These effects on leukocytes can be relevant during mastitis treatment because neutrophils are of high importance in the immune defense of mammary glands.6

Intramammary administration of prednisolone can reduce the development of fever in response to challenge exposure with LPS, provided the prednisolone is infused at a specific time of infection (ie, the concentration of prednisolone is high enough at the time that endogenous mediators are produced).7 Furthermore, investigators in 1 study8 found that prednisolone used in addition to antimicrobial treatment led to a quicker restoration of milk quality in Escherichia coli–induced mastitis, compared with restoration of milk quality after antimicrobial treatment only. In vitro, prednisolone suppresses chemotaxis of polymorphonuclear neutrophilic leukocytes and macrophages.9 In vivo, reductions in chemotaxis (ie, reduced recruitment of neutrophils into the milk) could negatively influence the immune competence of mammary glands. Nonetheless, details about the immunologic effect for intramammary administration of prednisolone are not known.

The intramammary administration of E coli LPS has been used to mimic and induce mammary gland inflammation similar to that of naturally developing mastitis. This provides a method for controlled evaluation of the inflammatory response in a mammary gland without the need to induce a bacterial infection.10–12 During an immune response, cells in milk and mammary gland tissue produce immunomodulating factors (eg, TNF-α and ILs) that enhance recruitment of phagocytes from the blood into milk, where they can combat and eliminate invading pathogens. Therefore, the measurement of SCC in milk is used as an indirect indicator of mammary gland inflammation.13

Activity of LDH also increases in milk during mastitis.14 It is a ubiquitous enzyme in the cytoplasm of cells and is released into the extracellular fluid during cell damage and cell death.15 In addition, LDH originates from the blood and can enter milk as a result of increasing permeability during the mammary gland immune response.16,17

During mammary gland inflammation, integrity of the blood-milk barrier (formed by tight junctions between mammary gland epithelial cells) changes, and molecules can cross the barrier from blood into milk (or vice versa).17,18 The concentration of SA (a blood constituent) increases in milk during mastitis because of loss of integrity of the blood-milk barrier. Therefore, SA concentrations in milk can be used as an indicator of permeability of the blood-milk barrier.19 Other blood components (eg, immunoglobulins) that pass through the blood-milk barrier can support immune function of mammary glands. Therefore, integrity of the blood-milk barrier can play a role in the development of mastitis.

Intramammary challenge exposure with E coli LPS reduces the mRNA content of the tight junction proteins zona occludens-1 and -2 in the bovine mammary gland.11 These scaffolding proteins form a junction between transmembrane proteins and the actin cytoskeleton and are involved in forming a tight connection between epithelial cells that represents the blood-milk barrier. Glucocorticoids can influence rearrangement of tight junctions in mammary gland epithelial cells of mice20 and mammary glands of lactating cattle.21 Consequently, glucocorticoids could have an influence on integrity of the blood-milk barrier.

The objective of the study reported here was to investigate the effects of intramammary administration of the glucocorticoid prednisolone on the mammary gland immune response and the influence of prednisolone on the LPS-induced immune response of the mammary gland in dairy cows. Our hypothesis was that prednisolone would limit the damage to the blood-milk barrier that occurs during the mammary gland immune response. Stimulation of the immune system was not anticipated.

Materials and Methods

Animals—Five lactating Red Holstein cows with a daily milk yield of > 18 L/d were selected for use in the study. All cows had a milk SCC < 120 × 103 cells/mL in all 4 mammary glands during the 3 days before the experiment and had no clinical signs of mastitis. Cows were at 100 to 400 days of lactation and were in their first to fourth lactation. They were housed in a tie stall barn from the evening before the experiment until the end of the experiment. Cows were fed on the basis of milk production. Water was available ad libitum. The use of animals in this study was approved and permitted by the Committee of Animal Experiments, Canton Fribourg, Switzerland. All procedures involving animals adhered to Swiss law on animal protection.22

Treatment and sample collection—On the day before the experiment began, milk samples were collected aseptically from all 4 mammary glands of each cow. Milk samples were cultured overnight at 37°C on blood agar plates, and negative results were used to ensure that all mammary glands were free of bacterial infection.

On the first day of the experiment, each mammary gland of each cow was infused via the teat orifice immediately after the morning milking. All infusions were performed by cleaning each teat end with 70% alcohol, which was followed by insertion of a sterile teat canula. Time of infusions was designated as time 0.

One mammary gland was infused with 10 mg of prednisolone.a Prednisolone was dissolved in 0.5 mL of 95% ethanol, and sterile saline (0.9% NaCl) solution was added to achieve a final infusion volume of 10 mL The second mammary gland was infused with 100 μg of E coli LPSb diluted in 10 mL of saline solution. The third mammary gland was infused with 100 μg of E coli LPS diluted in 5 mL of saline solution, which was subsequently followed by infusion of 10 mg of prednisolone (dissolved in 0.5 mL of 95% ethanol) diluted in sterile saline solution to achieve an infusion volume of 5 mL. The LPS and prednisolone were in separate syringes but administered through the same teat canula. The fourth mammary gland was infused with 10 mL of saline solution (control treatment). Infusions were followed by a short massage (approx 30 seconds) to induce movement of the solutions to the parenchymal tissue. The amount of prednisolone infused into a mammary gland corresponded to the amount contained in infusions commonly used for mastitis treatment in Switzerland.

Rectal temperature of the cows was measured at 0, 3, 6, 9, 12, 24, and 36 hours. Milk samples (approx 10 mL) were collected from all mammary glands at 0, 3, 6, 9, 12, 24, and 36 hours. Samples were collected within 40 seconds after first contact with the udder to ensure that spontaneous milk ejection did not occur.23 Samples were immediately analyzed to determine SCC. The SCC was measured in all milk samples with a cell counterc used in accordance with the manufacturer's protocol. If SCC were > 3 × 106 cells/mL, samples were diluted 1:10 in PBS solution because the detection limit for the cell counter was between 3 × 106 cells/mL and 4 × 106 cells/mL; SCC was then determined in the diluted samples. After SCC measurement, the remainder of each milk sample was stored frozen at −20°C until subsequent measurement of LDH activity and SA and TNF-α concentrations.

Cows were milked with a special milking device for separation of milk from each mammary gland at 0, 12, 24, and 36 hours. One liter of milk from each mammary gland was centrifuged (2,000 × g at 4°C for 20 minutes) in 500-mL flasks. Each pellet was resuspended in 200 mL of ice-cold PBS solution and centrifuged again (2,000 × g at 4°C for 10 minutes). Each pellet from the second centrifugation was resuspended in 1 mL of phenol and guanidine isothiocyanate solution,d transferred into 1.5-mL tubes, and stored frozen at −80°C until RNA extraction.

Analytic procedures—Total RNA extraction of milk somatic cells was performed with a kite used in accordance with the manufacturer's protocol. For quantitative analysis of mRNA expression of TNF-α, IL-1β, and IL-8, mRNA was transcribed to cDNA by use of hexamer random primers. Quantitative real-time PCR assays were performed with a green fluorescent dyef in a real-time thermocycler.g The procedure included denaturation (95°C for 2 minutes) and a cycling program (95°C for 5 seconds, 60°C for 10 seconds, and 68°C for 2 seconds); products were analyzed via melting curve analysis. The Ct values were acquired by use of the real-time thermocycler software.g For the relative quantification of mRNA, Ct values of the target genes were normalized against results for the housekeeping gene GAPDH, which was expressed consistently among samples. The difference in Ct values (ie, ΔCt) was calculated by use of the following equation: ΔCt = arithmetic mean Ct for GAPDH – Ct for the target gene. Primer sequences adopted from another study24 were used for amplification of GAPDH (forward: GTCTTCACTACCATGGAGAAGG; reverse: TCATGGATGACCTTGGCCAG), TNF-α (forward: CCACGTTGTAGCCGACATC; reverse: CCCTGAAGAGGACCTGTGAG), IL-1β (forward: AGTGCCTACGCACATGTCTTC; reverse: TGCGTCACACAGAAACTCGTC), and IL-8 (forward: ACACATTCCACACCTTTCCAC; reverse: ACCTTCTGCACCCACTTTTC).

The concentration of TNF-α in milk was measured with a radioimmunoassay as described in another study.25 Activity of LDH in milk was measured with an automatic analyzer and a commercial kith used in accordance with the manufacturer's recommendations. Concentrations of SA in milk were measured with a commercial ELISA kiti used in accordance with the manufacturer's instructions. Samples were diluted 1:48,000 in wash buffer (50mM Tris, 0.14M NaCl, and 0.05% Tween 20, adjusted to a pH of 8.0) to ensure the samples were in the range of the standards. Absorbance measurements were obtained at 450 nm on a plate reader.j Interassay and intra-assay coefficients of variation were 3% and 5.5%, respectively

Statistical analysis—Each cow served as its own control animal because of the mammary gland infused with saline solution (control treatment). In addition, values at time 0 (before treatment) were used to detect changes over time.

Data were reported as mean ± SEM. For statistical analysis, SCC were logarithmically transformed (log10) to ensure a normal distribution. Differences in SCC, LDH activity, and TNF-α and SA concentrations in milk and mRNA expression of immunomodulators among treatments (control treatment, LPS, prednisolone, and LPS plus prednisolone) were tested with an ANOVA by use of a mixed procedure in a commercial software program.k The model included treatment, time, and the treatment-by-time interaction as fixed effects and cow as a repeated factor in the following equation:

article image

where yijk = the observation for treatment i on cow j at time k; μ = the overall mean; τi = the effect of treatment i; δij = the effect of cow as a repeated factor; tk = the effect of time k; (τ•t)ik = the effect of the interaction between treatment i and time k; and εijk = the random error with mean 0 and variance σ2 (ie, the variance between measurements within cows). Differences between means were considered significant at P < 0.05.

Results

The rectal temperature increased significantly, compared with values at time 0. Rectal temperature was increased at 6 hours, remained elevated at 9 and 12 hours, and returned to basal values at 24 hours. Mean ± SEM rectal temperature was 37.8 ± 0.2, 38.2 ± 0.3, 40.4 ± 0.2, 38.9 ± 0.2, 38.6 ± 0.2, 37.7 ± 0.1, and 38.0 ± 0.2°C at 0, 3, 6, 9, 12, 24, and 36 hours, respectively.

The SCC increased in a similar manner in all LPS-treated mammary glands (with and without prednisolone), compared with the SCC at time 0. The SCC increased at 6 hours and remained elevated until the end of the experiment at 36 hours (Figure 1). The SCC did not change over time in mammary glands infused with the control treatment or prednisolone alone.

Figure 1—
Figure 1—

Mean ± SEM SCC in milk of mammary glands infused with saline (0.9% NaCl) solution (control treatment; diamonds), LPS (circles), prednisolone (squares), and LPS plus prednisolone (triangles). Each gland of 5 lactating Red Holsteins was infused intramammarily with a different treatment; time of infusion was designated as time 0. a,bWithin a time point, means with different letters differ significantly (P < 0.05).

Citation: American Journal of Veterinary Research 75, 6; 10.2460/ajvr.75.6.595

The LDH activity in milk did not change, compared with the LDH activity at time 0, within 3 hours after treatment in all mammary glands (Figure 2). At 6 hours, LDH activity was significantly increased in mammary glands treated with LPS alone (ie, no additional prednisolone administration) and remained elevated until the end of the experiment. In mammary glands infused with a combination of LPS and prednisolone, LDH activity remained at basal values until 9 hours and then was significantly increased from 12 hours until the end of the experiment. From 6 hours until the end of the experiment at 36 hours, the LDH activity of mammary glands infused with LPS alone was significantly greater than that in mammary glands infused with a combination of LPS and prednisolone. The LDH activity did not change over time in mammary glands infused with the control treatment or prednisolone alone.

Figure 2—
Figure 2—

Mean ± SEM LDH activity in milk of mammary glands infused with saline solution (control treatment), LPS, prednisolone, and LPS plus prednisolone. a–cWithin a time point, means with different letters differ significantly (P < 0.05). See Figure 1 for remainder of key.

Citation: American Journal of Veterinary Research 75, 6; 10.2460/ajvr.75.6.595

The SA concentration in milk increased significantly, compared with the concentration at time 0 (Figure 3). The concentration increased significantly from 3 hours until 12 hours in mammary glands treated with LPS alone. In contrast, the SA concentration in mammary glands treated with a combination of LPS and prednisolone was significantly increased only at 3 and 6 hours. The SA concentration in mammary glands infused with LPS alone was greater at 3 and 6 hours than the SA concentration in mammary glands infused with a combination of LPS and prednisolone. The SA concentration in milk did not change over time in mammary glands infused with the control treatment or prednisolone alone.

Figure 3—
Figure 3—

Mean ± SEM concentration of SA in milk of mammary glands infused with saline solution (control treatment), LPS, prednisolone, and LPS plus prednisolone. See Figures 1 and 2 for remainder of key.

Citation: American Journal of Veterinary Research 75, 6; 10.2460/ajvr.75.6.595

The TNF-α concentration in milk was significantly increased in both mammary glands infused with LPS (with and without prednisolone), compared with the concentration at time 0 (Figure 4). The TNF-α concentration was significantly increased from 3 to 12 hours in mammary glands infused with LPS alone or a combination of LPS and prednisolone. The TNF-α concentration in milk did not change over time in mammary glands infused with the control treatment or prednisolone alone.

Figure 4—
Figure 4—

Mean ± SEM concentration of TNF-α in milk of mammary glands infused with saline solution (control treatment), LPS, prednisolone, and LPS plus prednisolone. See Figure 1 for remainder of key.

Citation: American Journal of Veterinary Research 75, 6; 10.2460/ajvr.75.6.595

The mRNA expression of TNF-α, IL-1β, and IL-8 in milk somatic cells was significantly increased at 12 hours, compared with expression at time 0, in all mammary glands infused with LPS (with and without prednisolone). The mRNA expression of TNF-α, IL-1β, and IL-8 did not change over time in mammary glands infused with the control treatment or prednisolone alone (Figure 5).

Figure 5—
Figure 5—

Mean ± SEM relative mRNA expression of TNF-α (A), IL-1β (B), and IL-8 (C) in milk somatic cells from mammary glands infused with saline solution (control treatment), LPS, prednisolone, and LPS plus prednisolone. Relative mRNA expression is reported as the difference in Ct values (ie, ΔCt) between results for the housekeeping gene GAPDH and each target gene by use of the following equation: ΔCt = arithmetic mean Ct for GAPDH – Ct for the target gene. See Figures 1 and 2 for remainder of key.

Citation: American Journal of Veterinary Research 75, 6; 10.2460/ajvr.75.6.595

Discussion

Glucocorticoids are widely used in human and veterinary medicine to treat a variety of inflammatory conditions. In the present study, the immunologic effects of intramammary administration of prednisolone were investigated because prednisolone frequently is added to antimicrobial infusions used for treatment of mastitis in dairy cows in many European countries, including Switzerland. Prednisolone purportedly reduces inflammatory reactions within the udder, but detailed effects are not known. In the study reported here, the effects of 10 mg of prednisolone/mammary gland were evaluated because that is the dose commonly infused in affected mammary glands by veterinarians in many European countries.

Analysis of the results of the present study indicated that intramammary administration of 10 mg of prednisolone/mammary gland did not appear to influence cell recruitment from the blood into milk. The SCC did not change in mammary glands infused with prednisolone alone. In addition, the increase in SCC in response to intramammary challenge exposure with LPS was not influenced by prednisolone. It also appeared that chemotaxis of leukocytes was not influenced by the administration of prednisolone. Infusion of 100 μg of LPS/mammary gland induced an increase in SCC to > 20,000 × 103 cells/mL; therefore, it is likely this was such a strong stimulus for cell recruitment that minor influences on chemotaxis could not be detected. However, comparable results were described in another study26 in which there was no change in the increase in SCC as a result of intramammary treatment with prednisolone (10 mg/mammary gland) in cattle with experimentally induced Streptococcus agalactiae infection.

The increase in rectal temperature after intramammary infusion of LPS was expected as a systemic effect because intramammary administration of high doses of LPS increases rectal temperature.27 Intramammary administration of prednisolone also leads to systemic effects after drug absorption.26 However, systemic effects of prednisolone could not be investigated in the present study because each cow served as its own control animal.

The LDH activity in milk in the present study increased as expected after intramammary infusion of LPS.14 The administration of prednisolone modulated LDH activity, compared with results for mammary glands treated with LPS but not infused with prednisolone. Milk somatic cells and the parenchyma have been described as the origin of LDH activity in milk during mastitis.28 In addition, LDH activity originates from the blood and may be an indicator of increased mammary gland permeability.16 In a recent study17 conducted by our laboratory group, we suggested that the origin of the increase in LDH activity in milk during mastitis is attributable to soluble LDH from the blood as well as LDH from disrupted leukocytes. Therefore, the increase of LDH activity in milk in the present study also indicated a breakdown in integrity of the blood-milk barrier. This increase of LDH activity in milk was modulated by the coadministration of prednisolone, compared with results for infusion of LPS alone, which indicated less disruption of the blood-milk barrier. However, there was a slower increase of LDH activity than of SA concentration (peak activity ≥ 24 hours after LPS infusion vs peak concentration 3 hours after infusion). Because an increase in the SA concentration in milk is evidence of disruption of the blood-milk barrier,19 this slower time until the peak of LDH activity could indicate that LDH is released from cells in addition to being transferred from the blood.

Another clear example that prednisolone diminished the disruption of the blood-milk barrier was the reduction of SA concentration in milk in mammary glands infused with a combination of LPS and prednisolone, compared with the concentration for those infused with LPS alone. Because glucocorticoids enhance expression of the tight junction proteins zona occludens-1 and occludin at the site of cell-cell contact in epithelial cells,29 the intramammary administration of prednisolone in combination with LPS most likely reduced the permeability of tight junctions that resulted from LPS administration.

It is possible that reduced permeability of tight junctions had no influence on the increase in SCC. This is in agreement with results of a study30 in which the increase in LDH activity in milk differed during mastitis induced by endotoxins from several bacteria but the SCC was similarly increased for all of the bacteria. This indicates that integrity of the blood-milk barrier can be selective for different blood components (eg, LDH or SA), although there is similar transfer of leukocytes from the blood into milk.

The cytokine TNF-α serves as a rapidly responding central mediator of inflammatory functions31 that is important during the initiation of an immune response. It plays an important role in mastitis, and its concentration in milk increases after LPS challenge exposure.32 An increase in TNF-α mRNA expression in milk somatic cells was not detectable after LPS infusion; this was most likely attributable to the time of measurement (12 hours after LPS infusion). In a recent study30 conducted by our laboratory group, we found that intramammary administration of LPS increased the mRNA expression of TNF-α in milk somatic cells by 6 hours after LPS infusion; however, this increase was already diminished by 12 hours after LPS infusion. The increased production of TNF-α resulted in an accumulation in milk and was therefore detectable. This increase was not influenced by prednisolone administration. The administration of prednisolone alone did not induce a detectable increase in TNF-α mRNA expression in milk somatic cells or TNF-α concentration in milk. Therefore, intramammary administration of prednisolone at the dose used in the present study did not appear to initiate an immune response of the mammary gland.

In addition to TNF-α, the cytokines IL-8 and IL-1β are involved in the immune response of the mammary gland and are produced by leukocytes.33 Interleukin-8 is produced by leukocytes and is a potent chemokine for neutrophils. It also is involved in the recruitment of immune cells from the blood into milk and, therefore, in the increase in SCC during mammary gland inflammation. Interleukin-1β plays a key role in eliciting the acute-phase response to bacteria that have invaded the udder. In human monocytes, LPS-induced production of IL-1β can be suppressed, and this is genetically influenced.34 The fact that there was no change in mRNA expression of IL-8 and IL-1β in milk somatic cells after prednisolone infusion may indicate that prednisolone is not an immunologic stimulus to milk somatic cells. In addition, the immunologic stimulation of milk somatic cells by LPS was not influenced by the administration of 10 mg of prednisolone/mammary gland in dairy cows.

In the present study, the intramammary administration of the glucocorticoid prednisolone did not appear to induce an immune response in infused mammary glands because mRNA expression of the immune factors TNF-α, IL-1β, and IL-8 in milk somatic cells and TNF-α and SA concentrations, LDH activity, and the SCC in milk were not influenced. Prednisolone also did not change the immune response to an intramammary infusion of LPS, as determined on the basis of the aforementioned factors. However, intramammary infusion of prednisolone may reduce cell damage. In addition, intramammary administration of prednisolone clearly reduced disruption of the blood-milk barrier induced by LPS challenge exposure, as indicated by a reduction of blood constituents in milk (ie, SA concentration or LDH activity). This effect may have an important influence on the severity and cure rate of mastitis.

ABBREVIATIONS

Ct

Threshold cycle

GAPDH

Glyceraldehyde-3-phosphate dehydrogenase

IL

Interleukin

LDH

Lactate dehydrogenase

LPS

Lipopolysaccharide

SA

Serum albumin

SCC

Somatic cell count

TNF

Tumor necrosis factor

a.

Sigma Aldrich, Buchs, Switzerland.

b.

Escherichia coli LPS serotype O26:B6, Sigma Aldrich, Buchs, Switzerland.

c.

DeLaval cell counter, DeLaval International AB, Tumba, Sweden.

d.

TriFast, Peqlab Biotechnologie GmBH, Erlangen, Germany.

e.

RNeasy kit, Qiagen, Hilden, Germany.

f.

SYBR Green, Bioline USA Inc, Taunton, Mass.

g.

Rotor-gene 6000, Corbett Research, Sydney, Australia.

h.

COBAS MIRA, Roche Diagnostics, Basel, Switzerland.

i.

Bovine serum albumin ELISA kit, Bethyl Laboratories, Montgomery, Tex.

j.

Synergy Mx, Bio Tec Instruments, Winooski, Vt.

k.

SAS, version 9.2, SAS Institute Inc, Cary, NC.

References

  • 1. National Milk Producers Federation. Milk and dairy beef drug residue prevention manual. Available at: nmpf.org/publications/national-dairy-farm-program. Accessed Jan 15, 2014.

    • Search Google Scholar
    • Export Citation
  • 2. FDA. Animal medicinal drug use clarification act of 1994 (AMDUCA). Available at: www.fda.gov/AnimalVeterinary/GuidanceComplianceEnforcement/ActsRulesRegulations/ucm085377.htm. Accessed Jan 15, 2014.

    • Search Google Scholar
    • Export Citation
  • 3. Ito K, Chung KF, Adcock IM. Update on glucocorticoid action and resistance. J Allergy Clin Immunol 2006; 117: 522543.

  • 4. Chang L-C, Madsen SA, Toelboell T, et al. Effects of glucocorticoids on Fas gene expression in bovine blood neutrophils. J Endocrinol 2004; 183: 569583.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 5. Schwiebert LM, Beck LA, Stellato C, et al. Glucocorticosteroid inhibition of cytokine production relevance to anti-allergic actions. J Allergy Clin Immunol 1996; 97: 143152.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 6. Burton JL, Erksine RJ. Immunity and mastitis: some new ideas for an old disease. Vet Clin North Am Food Anim Pract 2003; 19: 145.

  • 7. Lohuis JACM, Van Leeuwen W, Verheijden JHM, et al. Effect of steroidal anti-inflammatory drugs on Escherichia coli endotoxin-induced mastitis in the cow. J Dairy Sci 1989; 72: 241249.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 8. Sipka A, Gurjar A, Klaessig S, et al. Prednisolone and cefapirin act synergistically in resolving experimental Escherichia coli mastitis. J Dairy Sci 2013; 96: 44064418.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 9. Ziege SU, Geerdes-Fenge HF, Rau M, et al. In vitro effects of interleukin-10, prednisolone, and GM-CSF on the non-specific immune function of human polymorphonuclear leukocytes and monocytes. Eur J Med Res 2000; 18: 369374.

    • Search Google Scholar
    • Export Citation
  • 10. Bruckmaier RM, Weiss D, Wiedemann M, et al. Changes of physicochemical indicators during mastitis and the effects of milk ejection on their sensitivity. J Dairy Res 2004; 71: 316321.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 11. Werner-Misof C, Macuhova J, Tancin V, et al. Dose dependent changes in inflammatory parameters in the milk of dairy cows after intramammary infusion of lipopolysaccharide. Vet Med-Czech 2007; 52: 95102.

    • Search Google Scholar
    • Export Citation
  • 12. Baumert A, Bruckmaier RM, Wellnitz O. Dose dependent SCC changes after intramammary lipopolysaccharide challenge. Milk Sci Int 2009; 64: 119121.

    • Search Google Scholar
    • Export Citation
  • 13. Brolund L. Cell counts in bovine milk. Causes of variation and applicability for diagnosis of subclinical mastitis. Acta Vet Scand Suppl 1985; 80: 1123.

    • Search Google Scholar
    • Export Citation
  • 14. Bogin E, Ziv G. Enzymes and minerals in normal and mastitic milk. Cornell Vet 1973; 63: 666676.

  • 15. Glick JH. Serum lactate dehydrogenase isoenzyme and total lactate dehydrogenase values in health and disease, and clinical evaluation of these tests by means of discriminant analysis. Am J Clin Pathol 1969; 52: 320328.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 16. Symons DBA, Wright LJ. Changes in bovine mammary gland permeability after intramammary exotoxin infusion. J Comp Pathol 1974; 84: 917.

  • 17. Lehmann M, Wellnitz O, Bruckmaier RM. Concomitant LPS induced transfer of blood derived components including immunoglobulins into milk. J Dairy Sci 2013; 96: 889896.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 18. Nguyen DA, Neville MC. Tight junction regulation in the mammary gland. J Mammary Gland Biol Neoplasia 1998; 3: 233246.

  • 19. Stelwagen K, Politis I, White JH, et al. Effect of milking frequency and somatotropin on the activity of plasminogen activator, plasminogen, and plasma in bovine milk. J Dairy Sci 1994; 77: 35773583.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 20. Zettl KS, Sjaastad MD, Riskin PM, et al. Glucocorticoid-induced formation of tight junctions in mouse mammary epithelial cells in vitro. Proc Natl Acad Sci USA 1992; 89: 90699073.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 21. Stelwagen K, van Espen DC, Verkerk GA, et al. Elevated plasma cortisol reduces permeability of mammary tight junctions in the lactating bovine mammary epithelium. J Endocrinol 1998; 159: 173178.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 22. Bundesamt für Lebensmittelsicherheit und Veterinärwesen (BLV). Tierschutzgesetz. Available at: www.blv.admin.ch. Accessed Jan 16, 2014.

    • Search Google Scholar
    • Export Citation
  • 23. Bruckmaier RM, Hilger M. Milk ejection in dairy cows at different degrees of udder filling. J Dairy Res 2001; 68: 369376.

  • 24. Griesbeck-Zilch B, Meyer HHD, Kühn CH, et al. Staphylococcus aureus and Escherichia coli cause deviating expression profiles of cytokines and lactoferrin messenger ribonucleic acid in mammary epithelial cells. J Dairy Sci 2008; 91: 22152224.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 25. Blum JW, Dosogne H, Hoeben D, et al. Tumor necrosis factor-α and nitrite/nitrate responses during acute mastitis induced by Escherichia coli infection and endotoxin in dairy cows. Domest Anim Endocrinol 2000; 19: 223235.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 26. Geleta JN, Shimoda W, Mercer HD. Excretion of [3H]prednisolone in clinically normal and experimentally infected bovine udders. Am J Vet Res 1984; 45: 15761581.

    • Search Google Scholar
    • Export Citation
  • 27. Schmitz S, Pfaffl MW, Meyer HH, et al. Short-term changes of mRNA expression of various inflammatory factors and milk proteins in mammary tissue during LPS-induced mastitis. Domest Anim Endocrinol 2004; 26: 111126.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 28. Bogin E, Ziv G, Avidar J, et al. Distribution of lactate dehydrogenase isoenzymes in normal and inflamed bovine udders and milk. Res Vet Sci 1977; 22: 198200.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 29. Sekiyama A, Yasuhiro G, Terakado M, et al. Glucocorticoids enhance airway epithelial barrier integrity. Int Immunopharmacol 2012; 12: 350357.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 30. Wellnitz O, Arnold ET, Bruckmaier RM. Lipopolysaccharide and lipoteichoic acid induce different immune responses in the bovine mammary gland. J Dairy Sci 2011; 94: 54055412.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 31. Watanabe A, Yagi Y, Shiono H, et al. Effect of intramammary infusion of tumor necrosis factor-α on milk protein composition and induction of acute-phase protein in the lactating cow. J Vet Med B Infect Dis Vet Public Health 2000; 47: 653662.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 32. Paape MJ, Rautiainen PM, Lilius EM, et al. Development of anti-bovine TNF-alpha mAb and ELISA for quantitating TNF-alpha in milk after intramammary injection of endotoxin. J Dairy Sci 2002; 85: 765773.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 33. Riollet C, Rainard P, Poutrel B. Cells and cytokines in inflammatory secretions of bovine mammary glands. Adv Exp Med Biol 2000; 480: 247258.

    • Search Google Scholar
    • Export Citation
  • 34. Markova S, Nakamura T, Makimoto H, et al. IL-1β genotype-related effect of prednisolone on IL-1β production in human peripheral blood mononuclear cells under acute inflammation. Biol Pharm Bull 2007; 30: 14811487.

    • Crossref
    • Search Google Scholar
    • Export Citation
All Time Past Year Past 30 Days
Abstract Views 67 0 0
Full Text Views 752 476 54
PDF Downloads 301 132 12
Advertisement