Synbiotics refer to nutritional components that combine prebiotics and probiotics in a single viable product. For this reason, the concept of synbiotics encompasses the mechanisms of both compounds, which, because they target different parts of the gastrointestinal tract, do not coexist symbiotically. Prebiotics are active in the large intestine, whereas probiotics are active in the small intestines.1 By definition, a prebiotic is a selectively fermented ingredient that allows specific changes in the composition or activity of the gastrointestinal tract microflora that confer benefits on the host's health and well-being. The mode of action for prebiotics includes competitive exclusion that allows for growth of beneficial intestinal microflora (mainly Bifidobacteria spp) in the large intestine and limits pathogens and their toxins.2,3 On the other hand, probiotics are defined as live microorganisms that, when administered in adequate amounts, confer a health benefit to the host. Most probiotic microorganisms are gram-positive lactic acid bacteria, such as Lactobacillus spp, Bifidobacteria spp, and Lactococcus spp, which modulate the intestinal microflora through colonization of the gastrointestinal tract and inhibition of the growth of pathogenic bacteria.4
By combining the beneficial effects of prebiotics and probiotics, synbiotics elicit a synergistic reaction in the intestines of the host. One of their established properties in mammalian and avian species is immunomodulation.5–7 Briefly, prebiotics stimulate both nonspecific and specific (macrophages and B and T lymphocytes) components of the immune response.8 This results in improved defense against viral, bacterial, fungal, and parasitic infections.9–14 In turn, probiotics act to prevent growth of pathogenic bacteria by binding to or penetrating mucosal surfaces, producing organic acids, acidifying the colon through nutrient fermentation, aiding in secretion of bacteriocin, enhancing barrier function of epithelia, and altering immunoregulation (decreasing proinflammatory effects and promoting protective molecules).15 These interactions may lead to enhancement of natural and antigen-specific antibodies,16,17 activation or suppression of T cells,18 and changes in cytokine expression profiles.19–22 Specific probiotic bacteria can modulate mucosal and systemic immune activity, as indicated by their efficacy in the treatment of specific health conditions.23
The avian immune system consists of primary and secondary immune organs. Primary immune organs include the thymus and bursa of Fabricius, and secondary immune organs include the spleen, Harder's gland, bone marrow, and lymphoid tissue (eg, mucosa-associated lymphoid tissue and GALT). Mucosa-associated lymphoid tissue comprises various organized lymphoid structures (eg, Peyer's patches and cecal tonsils) responsible for mucosal immunity, surveillance of colonizing microbes, and interaction with ingested food pathogens.24
Development of the immune system of birds begins early during embryogenesis. Growing embryos are supplied only with IgY, which is transferred from the dam's blood to the egg yolk and accounts for passive immunity.25 Between days 8 and 14 of embryonic development, prebursal stem cells are synthesized in the yolk sac, bone marrow, and embryonic liver and subsequently inhabit the bursa of Fabricius, where they clone to form 20,000 to 30,000 cells.26 The process of B-cell multiplication starts on day 12 of embryonic development and is followed by differentiation and maturation of B cells in the bursa of Fabricius.27 The B cells generate IgM, IgY, and IgA in a process called somatic gene conversion.28 Between day 18 of embryonic development and 2 to 4 weeks after hatching, most of the B cells migrate from the bursa toward the thymus gland and secondary lymphatic organs, such as the spleen. In the spleen, B cells undergo somatic hypermutation, which generates the antibody diversity of adult birds.29 In turn, the thymus gland is colonized by precursor cells generated in the bone marrow during embryonic development; this process is responsible for T-cell differentiation.30
In ovo technology that provides an early mode of avian microbiome reprogramming31 can be used to evaluate the immunostimulatory properties of synbiotics on the development of chicken embryos and the avian immune system. The impact of an in ovo injection of synbiotics on the immune system of neonatal birds is indirect and is mediated through stimulation of development of the microbiome and activation of the common mucosal system by the antigen-presenting cells in the gastrointestinal tract to provide protection and regulate immune responses.32 The GALT of neonates contains functionally immature T and B lymphocytes, and their function is attained up to 2 weeks after hatching.33 Thus, early activation of the innate immune responses by immunomodulatory probiotics administered in ovo is considered crucial for further survival and fitness of chickens.
Immunomodulatory effects of synbiotics administered in ovo may be mediated by the modulation of cytokine and chemokine production, which regulates innate and adaptive immune responses.34,35 Therefore, the purpose of the study reported here was to determine in adult chickens the immunomodulatory effects of synbiotics administered during embryonic development by means of in ovo technology. Cytokine and chemokine gene expression was used to evaluate functional modulation of the immune system.
Materials and Methods
Animals—The study initially involved the use of 300 fertilized eggs of Green-legged Partridgelike chickens (an indigenous, dual-purpose fowl). The eggs were incubated for 21 days in a commercial hatchery at 37.8°C and relative humidity of 61% to 63%. On incubation day 12, the eggs were tested (ie, candled) to determine viability, and unfertilized eggs were discarded. The remaining eggs with properly developing embryos received in ovo administration of a prebiotic, synbiotics, or saline (0.9% NaCl) solution, and incubation was continued until hatching. After hatching, 250 chicks (5 groups; 50 chicks/group) were transported to an experimental farm, where they were raised for 6 weeks. The chicks were housed in groups in cages. Each cage (2.5 × 1.5 × 1 m) housed 25 chicks; thus, each experimental group was housed in 2 cages. All chicks were fed the same diets in a 2-phase feeding program that included starter (days 1 to 21) and grower (days 22 to 42) diets. Feed and water were provided ad libitum. The chicks were provided adequate husbandry conditions with continuous monitoring of stocking density, litter, and ventilation. The study was performed with approval of the Polish Local Ethical Committee (No. 22/2009. 09.07.2009) and in accordance with the animal welfare recommendations of European Union directive 86/609/EEC. These same chicks were also used to evaluate in ovo administration of the prebiotic and synbiotics on structure and development of organs of the immune system in a concurrent study.31
Experimental design—On incubation day 12, viable eggs were allotted by use of a randomization procedure to 5 experimental groups (for sets of 5 eggs on a tray, the first was allotted to one experimental group, the second was allotted to the next experimental group, the third was allotted to the next experimental group, and so on). Each egg of each experimental group received an equal volume of an aqueous solution of a prebiotic, 1 of 3 synbiotics (S1, S2, and S3), or saline solution (control treatment), which was administered in ovo.
The prebiotic, S1, and S2 were prepared by our laboratory group. The prebiotic consisted of a solution that contained 1.9 mg of RFOs isolated and purified from seeds of lupin (Lupinus luteus L. cv. Lord), as described elsewhere.36 The RFO solution contained 6.1% sucrose, 9.4% raffinose, 65.2% stachyose, 18.0% verbascose, and 1.3% other saccharides (138 other saccharides).37 Synbiotic 1 consisted of 1.9 mg of RFOs plus Lactococcus lactis subsp lactis IBB SL1, whereas S2 consisted of 1.9 mg of RFOs plus L lactis subsp cremoris IBB SC1. Briefly, L lactis subsp lactis IBB SL1 and L lactis subsp cremoris IBB SC1 were cultured in GM17 liquid medium at 25° to 28°C under aerobic conditions for 18 hours. The number of bacteria was estimated at 3 × 108 living cells. Immediately before injection, the cultures of L lactis subsp lactis IBB SL1 and L lactis subsp cremoris IBB SC1 were diluted to obtain a bacterial suspension of 1,000 CFUs in 20 μL. Synbiotic 3 was a commercially available producta; each 100 g of S3 contained up to 1 g of lactose, 109 CFUs of Lactobacillus acidophilus, and 109 CFUs of Streptococcus faecium.
In ovo administration was performed with a syringe and 4-mm-long needle that enabled the injection of 0.2 mL of an aqueous solution into the air chamber of each egg. The S1 and S2 injections comprised 180 μL of the RFOs solution and 20 μL of bacterial suspension. Prior to the S3 injection, the lyophilized commercial product was resuspended in saline solution to provide 500 CFUs of each strain of the living cells/0.2 mL. The number of bacteria for S3 was estimated on the basis of the manufacturer's information and was validated in our laboratory by microbiological plate counts. After in ovo injection, the hole in the shell of each egg was sealed with adhesive tape to prevent loss of moisture and embryo contamination. Incubation then was continued until hatching.
Sample collection and storage—On day 42 after hatching, 30 chickens (6 chickens/experimental group) were selected by use of a randomization procedure (selected from various locations of the pen) and euthanized via decapitation. The remaining chickens continued to be raised on the farm. Samples of lymphatic organs (bursa of Fabricius, cecal tonsils, spleen, and thymus gland) were collected from the euthanized birds. Measurements (weight) of the organs were obtained. Furthermore, spleen samples were subjected to 2 analyses (histologic31 and gene expression). The portion of the spleen for histologic evaluation was preserved in formalin, and the portion for gene expression evaluation was snap-frozen. Liquid nitrogen was used to snap-freeze spleen and cecal tonsil samples. The samples were stored at −80°C until analyzed by use of an RT-qPCR assay.
RNA isolation and RT-qPCR assay—Frozen samples of spleen and cecal tonsils were homogenized in liquid nitrogen with a mortar and pestle. Total RNA was isolated by means of acid guanidinium thiocyanate-phenol-chloroform extraction,38 in accordance with the manufacturer's protocol.b The RNA samples were assessed for quantity and integrity of rRNA bands on the basis of spectrophotometric measurementsc and results of agarose gel electrophoresis. Samples were treated with DNAse I,d which was followed by reverse transcription with an M-MuLV (Moloney murine leukemia virus) reverse transcription enzyme and a mixture of oligo(dT)18 and random hexamers as the primers.e Samples of cDNA were diluted to a working concentration of 70 ng/μL. The RT-qPCR assay was performed for immune-related genes; primer sequences were derived from published studies39–41 or designed in-house on the basis of exon sequences from the ENSEMBL database and spanning exon-exon boundaries (Appendix). Primer design was facilitated by the use of commercially available software.f The ubiquitin C gene was used as a reference gene, and the Ct for the control group that received saline solution was used as a calibrator.
The RT-qPCR assays were performed in triplicate. Total assay volume was 20 μL, which consisted of quantitative PCR assay master mixg (1× buffer, 2.5mM MgCl2, 200μM deoxynucleoside triphophosphates, DNA-binding dye, and DNA polymerase), 1μM of each primer, and 280 ng of a cDNA template. Thermal cycling was performed in a real-time PCR instrument,h as follows: 95°C for 15 minutes of initial denaturation; then 40 cycles of denaturation at 95°C for 15 seconds, primer annealing at 58° to 65°C for 20 seconds, and elongation at 72°C for 20 seconds. Fluorescence was measured at the end of each extension step. After completion of the amplification reaction, a melting curve was generated by increasing the temperature in small increments up to 98°C and measuring fluorescence of the melting PCR assay product.
Statistical analysis—The ΔΔCt algorithm42 was used to determine relative gene expression for the RT-qPCR assay data, and the amount of the target gene was calculated as 2−ΔCt. The ΔCt values were calculated as Ct of the target gene – Ct of the reference gene and used for statistical evaluation with a Student t test. Values of P ≤ 0.05 were considered significant.
Results
A panel of 6 cytokines (IL-4, IL-6, IL-12p40, IL-18, IFN-β, and IFN-γ) and 1 chemokine (IL-8) was used to evaluate gene expression of the immune responses in peripheral immune organs (ie, spleen and cecal tonsils) of adult chickens. Relative gene expression of the cytokines and chemokine in the spleen and cecal tonsils was plotted (Figure 1). Briefly, there was significant upregulation of IL-4, IL-6, IFN-β, and IL-18 in the splenic tissue of the S2 group, compared with the response for the control group. Expression was significantly increased for IL-6, IFN-β, and IL-4 in the S3 group. On the other hand, IL-12p40 expression was significantly downregulated in the S2 group, and IFN-γ expression was significantly downregulated in the S3 group. Expression of IL-8 was unchanged in chickens treated with synbiotics in ovo, compared with results for the control group. Furthermore, gene expression determined in cecal tonsils indicated a clear pattern toward downregulation of all cytokines, except for IL-18, which was significantly upregulated in the S1 group. Expression was significantly downregulated for IL-6 (P ≤ 0.05) and IL-8 (P = 0.01) in the S1 group, whereas IL-8 and IL-12p40 were significantly downregulated in the S2 group.
Relative gene expression (mean ± SEM fold induction) of cytokines and a chemokine in the spleen (A) and cecal tonsils (B) of adult chickens stimulated by in ovo administration (day 12 of incubation) of a prebiotic that contained 1.9 mg of RFOs (black bars), synbiotic 1 that consisted of 1.9 mg of RFOs plus Lactococcus lactis subsp lactis IBB SL1 (dark gray bars), synbiotic 2 that consisted of 1.9 mg of RFOs plus L lactis subsp cremoris IBB SC1 (light gray bars), synbiotic 3 that was a commercially available product that contained lactose, Lactobacillus acidophilus, and Streptococcus faecium (white bars), or saline (0.9% NaCl) solution (control group; n = 6 chickens/group). Results for the control group were assigned a value of 1. Analysis was performed with an RT-qPCR assay by means of the ΔΔCt method to determine fold induction. Notice that the scale on the y-axis differs between panels.*Differs significantly (*P ≤ 0.05; Student t test) from the value for the control group.
Citation: American Journal of Veterinary Research 75, 11; 10.2460/ajvr.75.11.997
Relative gene expression (mean ± SEM fold induction) of cytokines and a chemokine in the spleen (A) and cecal tonsils (B) of adult chickens stimulated by in ovo administration (day 12 of incubation) of a prebiotic that contained 1.9 mg of RFOs (black bars), synbiotic 1 that consisted of 1.9 mg of RFOs plus Lactococcus lactis subsp lactis IBB SL1 (dark gray bars), synbiotic 2 that consisted of 1.9 mg of RFOs plus L lactis subsp cremoris IBB SC1 (light gray bars), synbiotic 3 that was a commercially available product that contained lactose, Lactobacillus acidophilus, and Streptococcus faecium (white bars), or saline (0.9% NaCl) solution (control group; n = 6 chickens/group). Results for the control group were assigned a value of 1. Analysis was performed with an RT-qPCR assay by means of the ΔΔCt method to determine fold induction. Notice that the scale on the y-axis differs between panels.*Differs significantly (*P ≤ 0.05; Student t test) from the value for the control group.
Citation: American Journal of Veterinary Research 75, 11; 10.2460/ajvr.75.11.997
Relative gene expression (mean ± SEM fold induction) of cytokines and a chemokine in the spleen (A) and cecal tonsils (B) of adult chickens stimulated by in ovo administration (day 12 of incubation) of a prebiotic that contained 1.9 mg of RFOs (black bars), synbiotic 1 that consisted of 1.9 mg of RFOs plus Lactococcus lactis subsp lactis IBB SL1 (dark gray bars), synbiotic 2 that consisted of 1.9 mg of RFOs plus L lactis subsp cremoris IBB SC1 (light gray bars), synbiotic 3 that was a commercially available product that contained lactose, Lactobacillus acidophilus, and Streptococcus faecium (white bars), or saline (0.9% NaCl) solution (control group; n = 6 chickens/group). Results for the control group were assigned a value of 1. Analysis was performed with an RT-qPCR assay by means of the ΔΔCt method to determine fold induction. Notice that the scale on the y-axis differs between panels.*Differs significantly (*P ≤ 0.05; Student t test) from the value for the control group.
Citation: American Journal of Veterinary Research 75, 11; 10.2460/ajvr.75.11.997
Discussion
It is an established paradigm that cross communication between intestinal microflora and a eukaryotic host elicits innate and adaptive immune responses.43 Manipulation of the microbial composition in the gastrointestinal tract by administration of certain bioactive compounds, such as prebiotics, probiotics, and synbiotics, can lead to activation of the common mucosal system through stimulation of antigen-presenting cells. Bacterial strains that can promote health and modulate mucosal immune mechanisms are called immunobiotics, in contrast to probiotics, which affect only the gastrointestinal tract.32 The modulation of certain aspects of the immune system by synbiotics is based on the pivotal interaction between intestinal microbiota and the host immune system. Results of studies44,45 on germ-free and gnotobiotic animals (deprived of any intestinal microbiota) clearly indicate that microbiota are essential for the optimal structural and functional development of the immune system. The interactive coexistence of the immune system and microbiota is especially apparent in the intestinal tract, where the GALT has evolved to provide optimal defense against intestinal pathogens while at the same time tolerating dietary and self-antigens as well as large populations of commensal nonpathogenic microbes.45,46 Gastrointestinal tract microbiota have profound effects on host gene expression, including genes involved in immunity and metabolism, in the enterohepatic system. The regulated gene expression in the host is also a source of proinflammatory molecules that recruit immune cells (eg, macrophages) of the host by signaling via the innate immune system through the use of toll-like receptors.47 Toll-like receptors in the gastrointestinal tract may alter the microbial composition and may have crucial effects on host metabolism. Accordingly, early reprogramming of the gastrointestinal tract microbiota or function of those microbiota may have subsequent beneficial effects on host metabolism.48
In the present study, the immunomodulatory effects of in ovo stimulation of the chicken microbiome by the use of prebiotics and synbiotics was evaluated. For that purpose, we determined the immune-related gene expression by use of a gene panel comprising the Th-1 (IFN-β, IFN-γ, and IL-18), Th-2 (IL-4), and proinflammatory (IL-6 and IL-12p40) cytokines and a chemokine (IL-8). The in ovo administration of prebiotics and synbiotics during embryonic development in chickens activated different patterns of gene regulation, depending on the immune organ and the synbiotic composition. Basically, there were differences in the mode of immune-related gene expression with respect to the intestinal (cecal tonsils) and peripheral (spleen) immune responses.
Analysis of regulation of gene expression in the intestinal tissues revealed a clear pattern for downregulation of the cytokines (IL-4, IL-6, IL-12p40, IFN-β, and IFN-γ) and chemokine (IL-8) in the cecal tonsils of prebiotic- and synbiotic-treated chickens. In chickens, cecal tonsils are the crucial components of GALT, which in combination with the spleen are the 2 major sites for generation of immune responses. Intestinal epithelia are continuously exposed to luminal microbiota, which leads to the development of innate and adaptive mechanisms. Thus, a healthy host develops tolerance toward self-pathogens and non–self-pathogens, which results in the recognition of commensal bacteria and activation of only transient, noninflammatory responses.49 Homeostasis of tolerance and immunity in the intestines protects a host from a systemic reaction in the largest area of antigen exposition in the entire organism (ie, the gastrointestinal tract). Interestingly, oral tolerance in chickens can be induced only until day 4 after hatching, which is the endpoint of GALT functional maturation.50 Therefore, in ovo administration of synbiotics ensures early contact between the developing GALT and commensal bacteria, which contributes to successful development of tolerance.
On the other hand, evaluation of the peripheral immune responses in synbiotic-treated chickens revealed significant upregulation of IL-4 (Th-2), IL-6 (proinflammatory), and IFN-β (Th-1) in the spleen of the S2 group and, to a lesser extent, the S3 group. The cytokines IL-4 and IL-6 reportedly increase IgA production by B lymphocytes.51 Noninflammatory IgA is an important mediator of humoral immunity in mucosal tissues, which establishes intestinal immunity exclusion and tolerance without activation of the systemic response.52 Mice given Lactobacillus casei had significantly increased numbers of IgA- and IL-6–producing cells in the lamina propria of the small bowel and, at the same time, did not have specific antibodies against L casei, which indicated the nonresponsiveness of their gastrointestinal tract immune system to beneficial bacteria.53 This is in agreement with the mechanism for immunomodulation induced by probiotic bacteria proposed in another study.54 According to that mechanism, internalization of probiotic antigens results in production of the cytokines IL-4 and IL-6 by antigen-presenting cells, which is followed by an increase in IgA production and a switch from the IgM to IgA isotype. On the basis of this proposed mechanism, a significant increase in expression of IgA-stimulating cytokines (IL-4 and IL-6) in the spleen after microbiome reprogramming by in ovo synbiotic administration in chickens may indicate that control of the gastrointestinal tract microflora is through IgA, in contrast to the mechanisms involved in pathogen recognition and systemic immune response.
The IL-4 and IL-6 upregulation in splenic tissue by S2 in the present study is in agreement with result of a previous study31 conducted by our research group in which we found that administration of the same bioactive compounds stimulated development of larger spleen indices, measured as a ratio of spleen weight to body weight in 3-week-old and 6-week-old chickens. Because chickens lack lymph nodes, the spleen is the main peripheral immune organ and has a pivotal role in innate and adaptive immune responses. Connection between the spleen and gastrointestinal tract is ensured by common mucosa-associated lymphoid tissue.24 Therefore, stimulation of the gastrointestinal tract microflora through in ovo administration of prebiotics and synbiotics had an impact on modulating the gene expression in the peripheral organ of the immune system (ie, the spleen). Mechanisms through which microbiome-host interactions modulate responses of the immune system are based on activation of the epithelial toll-like receptors by microbial-associated molecular components, such as lipoteichoic acid, which is a cell wall component of gram-positive bacteria that activates toll-like receptor 2. Microbial-associated molecular components reportedly enter the bloodstream through M cells in Peyer's patches in the intestinal wall, where they can initially be screened by lymphatic follicles in the gastrointestinal tract and transported to systemic lymphatic tissues, such as the spleen. Lactobacillus acidophilus, but not the other lactobacilli strains tested, reportedly induces basal proliferation of splenic lymphocytes as a response to lipopolysaccharides in mice.55 Similarly, in vivo screening of the enhancement of humoral immune responses in chickens fed lactic acid bacteria indicated a strain-dependent response, with expression of relevant IgG and IgM titers in chickens fed only 1 of the 5 probiotic strains tested.56 Immunomodulation by probiotics and synbiotics is strictly a strain-dependent phenomenon and connected to the various pathways of antigen internalization. In the present study, the synbiotic injected in ovo with the most evident effects in adult chickens was L lactis subsp cremoris SC1 with RFOs (S2). The same bioactive compounds were used in a field studyi of broiler chickens and contributed to a significant improvement in production traits, including body weight gain and nutrient digestibility. This indicates that in ovo administration of synbiotics has a fundamental impact on microbiome reprogramming of a host's gastrointestinal and immune system modulation.
In the present study, we determined the immunomodulatory characteristics of synbiotics injected in ovo during embryonic development in chickens by the use of immune-related gene expressions as indicators. This novel method of early synbiotic administration was an effective method of microbiome reprogramming in chickens, which also influenced the immune responses. The intestinal immune system (cecal tonsils) reacted with downregulated gene expression of the cytokines evaluated, whereas in the peripheral part of the immune system (ie, spleen), gene expression of IL-4 and IL-6 were upregulated. Therefore, we concluded that regulation of these cytokines can be a gene expression signature that indicates the immunobiotic properties of the synbiotics administered. However, these effects are connected with the strain of lactic acid bacteria used (in this study, only L lactis subsp cremoris SC1 elicited immunomodulation). Assessment of the pattern of immune-related gene expression may be a useful tool for screening of immunobiotics.
ABBREVIATIONS
| Ct | Cycle threshold |
| GALT | Gut-associated lymphoid tissue |
| IFN | Interferon |
| IL | Interleukin |
| RFO | Raffinose family oligosaccharide |
| RT-qPCR | Reverse transcription quantitative PCR |
| Th | T-helper |
Duolac, Biofaktor, Skierniewice, Poland.
TRIzol reagent, Invitrogen, Life Technologies, Carlsbad, Calif.
NanoDrop 2000, Thermo Scientific Nanodrop Products, Wilmington, Del.
Sigma Aldrich, St Louis, Mo.
Maxima First Strand cDNA synthesis kit for RT-qPCR, Thermo Scientific/Fermentas, Vilnius, Lithuania.
PrimerExpress 3.0, Applied Biosystems, Foster City, Calif.
1X HOT FIREPol EvaGreen qPCR Mix Plus, Solis BioDyne, Tartu, Estonia.
LightCycler 480 system, Roche-Diagnostics, Basel, Switzerland.
Slawinska A, Siwek M, Niesyn E, et al. Pre- and synbiotics injected in ovo stimulate performance traits and immune responses in adult chickens (abstr), in Proceedings. Epiconcept Workshop 2012;34.
References
1. Gibson GR, Roberfroid MB. Dietary modulation of the human colonic microbiota: introducing the concept of prebiotics. J Nutr 1995; 125:1401–1412.
2. Fooks LJ, Gibson GR. In vitro investigations of the effect of probiotics and prebiotics on selected human intestinal pathogens. FEMS Microbiol Ecol 2002; 39:67–75.
3. Gibson GR, Beatty ER, Wang X. Selective stimulation of bifidobacteria in the human colon by oligofructose and inulin. Gastroenterology 1995; 108:975–982.
4. Araya M, Gopal P & Lindgren SE, et al. Report of a joint FAO/WHO expert consultation on health and nutritional properties of probiotics in food including powder milk with live lactic acid bacteria. Cordoba, Argentina: World Health Organization, 2001.
5. Cummings JH, Antoine J-M & Azpiroz F, et al. PASSCLAIM—gut health and immunity. Eur J Nutr 2004; 43:II/118–II/173.
6. Delcenserie V, Martel D & Lamoureux M, et al. Immunomodulatory effects of probiotics in the intestinal tract. Curr Issues Mol Biol 2008; 10:37–54.
7. Erickson KL, Hubbard NE. Probiotic immunomodulation in health and disease. J Nutr 2000; 130:403S–409S.
8. Gibson GR. Dietary modulation of the human gut microflora using the prebiotics oligofructose and inulin. J Nutr 1999; 129:1438S–1441S.
9. Inchaisri C, Waller KP, Johannisson A. Studies on the modulation of leucocyte subpopulations and immunoglobulins following intramammary infusion of beta 1,3-glucan into the bovine udder during the dry period. J Vet Med B Infect Dis Vet Public Health 2000; 47:373–386.
10. Kim HM, Han SB & Oh GT, et al. Stimulation of humoral and cell mediated immunity by polysaccharide from mushroom Phellinus linteus. Int J Immunopharmacol 1996; 18:295–303.
11. Kirmaz C, Bayrak P & Yilmaz O, et al. Effects of glucan treatment on the Th1/Th2 balance in patients with allergic rhinitis: a double-blind placebo-controlled study. Eur Cytokine Netw 2005; 16:128–134.
12. Li J, Xing J & Li D, et al. Effects of beta-glucan extracted from Saccharomyces cerevisiae on humoral and cellular immunity in weaned piglets. Arch Anim Nutr 2005; 59:303–312.
13. Siwicki AK, Kazun K & Głabski E, et al. The effect of beta-1.3/1.6-glucan in diets on the effectiveness of anti-Yersinia ruckeri vaccine—an experimental study in rainbow trout (Oncorhynchus mykiss). Pol J Food Nutr Sci 2004; 54:59–61.
14. Yadomae T. Structure and biological activities of fungal beta 1,3-glucans [in Japanese]. Yakugaku Zasshi 2000; 120:413–431.
15. Hord N. How are dietary signals (probiotics and prebiotics) processed by GI cells to effect measurable changes in immune parameters systemically? J Nutr 2005; 135:2914S–2915S.
16. Haghighi HR, Gong J & Gyles CL, et al. Probiotics stimulate production of natural antibodies in chickens. Clin Vaccine Immunol 2006; 13:975–980.
17. Haghighi HR, Gong J & Gyles CL, et al. Modulation of antibody-mediated immune response by probiotics in chickens. Clin Diagn Lab Immunol 2005; 12:1387–1392.
18. Pessi T, Isolauri E & Sutas Y, et al. Suppression of T-cell activation by Lactobacillus rhamnosus GG-degraded bovine casein. Int Immunopharmacol 2001; 1:211–218.
19. Akbari MR, Haghighi HR & Chambers JR, et al. Expression of antimicrobial peptides in cecal tonsils of chickens treated with probiotics and infected with Salmonella enterica serovar Typhimurium. Clin Vaccine Immunol 2008; 15:1689–1693.
20. Haghighi HR, Abdul-Careem MF & Dara RA, et al. Cytokine gene expression in chicken cecal tonsils following treatment with probiotics and Salmonella infection. Vet Microbiol 2008; 126:225–233.
21. Kim YG, Ohta T & Takahashi T, et al. Probiotic Lactobacillus casei activates innate immunity via NF-kappaB and p38 MAP kinase signaling pathways. Microbes Infect 2006; 8:994–1005.
22. Vinderola CG, Medici M, Perdigon G. Relationship between interaction sites in the gut, hydrophobicity, mucosal immunomodulating capacities and cell wall protein profiles in indigenous and exogenous bacteria. J Appl Microbiol 2004; 96:230–243.
23. Fedorak RN, Madsen KL. Probiotics and prebiotics in gastrointestinal disorders. Curr Opin Gastroenterol 2004; 20:146–155.
24. Casteleyn C, Doom M & Lambrechts E, et al. Locations of gutassociated lymphoid tissue in the 3-month-old chicken: a review. Avian Pathol 2010; 39:143–150.
25. Kovacs-Nolan J, Mine Y. Egg yolk antibodies for passive immunity. Annu Rev Food Sci Technol 2012; 3:163–182.
26. Weill JC, Reynaud CA. The chicken B cell compartment. Science 1987; 238:1094–1098.
27. Barton RW, Goldschneider I. Nucleotide-metabolizing enzymes and lymphocyte differentiation. Mol Cell Biochem 1979; 28:135–147.
28. Ratcliffe MJH. Antibodies, immunoglobulin genes and the bursa of Fabricius in chicken B cell development. Dev Comp Immunol 2006; 30:101–118.
29. McCormack WT, Tjoelker LW, Thompson CB. Avian B-cell development: generation of an immunoglobulin repertoire by gene conversion. Annu Rev Immunol 1991; 9:219–241.
30. Ruminska E, Koncicki A, Stenzel T. The structure and functions of the immune system in birds [in Polish]. Med Welt 2008; 64:265–268.
31. Slawinska A, Siwek M & Zylinska J, et al. Influence of synbiotics delivered in ovo on immune organs’ development and structure. Folia Biol (Krakow) 2014; 62:277–285.
32. Clancy R. Immunobiotics and the probiotic evolution. FEMS Immunol Med Microbiol 2003; 38:9–12.
33. Miyazaki Y, Takahashi K, Akiba Y. Developmental changes in mRNA expression in immune associated cells of intestinal tract of broiler chickens after hatch and by dietary modification. Anim Sci J 2007; 78:527–534.
34. Giansanti F, Giardi MF, Botti D. Avian cytokines—an overview. Curr Pharm Des 2006; 12:3083–3099.
35. Wigley P, Kaiser P. Avian cytokines in health and disease. Braz J Poult Sci 2003; 5:1–14.
36. Gulewicz P, Ciesiołka D & Frias J, et al. Simple method of isolation and purification of γ-galactosides from legumes. J Agric Food Chem 2000; 48:3120–3123.
37. Bednarczyk M, Urbanowski M & Gulewicz K, et al. Field and in vitro study on prebiotic effect of raffinose family oligosaccharides. Biul Vet InstPulawy 2011; 55:465–469.
38. Chomczynski P, Sacchi N. Single-step method of RNA isolation by acid guanidiniumthiocyanate-phenol-chloroform extraction. Anal Biochem 1987; 162:156–159.
39. Chiang HI, Berghman LR, Zhou H. Inhibition of NF-kB 1 (NF-kBp50) by RNA interference in chicken macrophage HD11 cell line challenged with Salmonella enteritidis. Genet Mol Biol 2009; 32:507–515.
40. Brisbin JT, Gong J & Parvizi P, et al. Effects of lactobacilli on cytokine expression by chicken spleen and cecal tonsil cells. Clin Vaccine Immunol 2010; 17:1337–1343.
41. De Boever S, Vangestel C & Backer P, et al. Identification and validation of housekeeping genes as internal control for gene expression in an intravenous LPS inflammation model in chickens. Vet Immunol Immunopathol 2008; 122:312–317.
42. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(t)) method. Methods 2001; 25:402–408.
43. Cerf-Bensussan N, Gaboriau-Routhiau V. The immune system and the gut microbiota: friends or foes? Nat Rev Immunol 2010; 10:735–744.
44. Tlaskalová-Hogenová H, Stepánková R & Kozáková H, et al. The role of gut microbiota (commensal bacteria) and the mucosal barrier in the pathogenesis of inflammatory and autoimmune diseases and cancer: contribution of germ-free and gnotobiotic animal models of human diseases. Cell Mol Immunol 2011; 8:110–120.
45. Wagner RD. Effects of microbiota on GI health: gnotobiotic research. Adv Exp Med Biol 2008; 635:41–56.
46. Sekirov I, Russell SL & Antunes LC, et al. Gut microbiota in health and disease. Physiol Rev 2010; 90:859–904.
47. Rakoff-Nahoum S, Medzhitov R. Innate immune recognition of the indigenous microbial flora. Mucosal Immunol 2008; 1(suppl 1):S10–S14.
48. Bäckhed F. Programming of host metabolism by the gut microbiota. Ann Nutr Metab 2011; 58(suppl 2):44–52.
49. Galdeano CM, de Moreno de LeBlanc A & Vinderola G, et al. Proposed model: mechanisms of immunomodulation induced by probiotic bacteria. Clin Vaccine Immunol 2007; 14:485–492.
50. Sansonetti PJ, Di Santo JP. Debugging how bacteria manipulate the immune response. Immunity 2007; 26:149–161.
51. Cesta MF. Normal structure, function, and histology of mucosa-associated lymphoid tissue. Toxicol Pathol 2006; 34:599–608.
52. Fujihashi K, McGhee JR & Lue C, et al. Human appendix B cells naturally express receptors for and respond to interleukin 6 with selective IgA1 and IgA2 synthesis. J Clin Invest 1991; 88:248–252.
53. Isolauri E, Sütas Y & Kankaanpää P, et al. Probiotics: effects on immunity. Am J Clin Nutr 2001; 73:444S–450S.
54. Galdeano CM, Perdigon G. The probiotic bacterium Lactobacillus casei induces activation of the gut mucosal immune system through innate immunity. Clin Vaccine Immunol 2006; 13:219–226.
55. Kirjavainen PV, El-Nezami HS & Salminen SJ, et al. The effect of orally administered viable probiotic and dairy lactobacilli on mouse lymphocyte proliferation. FEMS Immunol Med Microbiol 1999; 26:131–135.
56. Koenen ME, van der Hulst R & Leering M, et al. Development and validation of a new in vitro assay for selection of probiotic bacteria that express immune-stimulating properties in chickens in vivo. FEMS Immunol Med Microbiol 2004; 40:119–127.
Appendix
Primer sequences of cytokines and a chemokine evaluated in the spleen and cecal tonsils of chickens by use of an RT-qPCR assay.
| Gene | NCBI gene ID | Primer sequences (5′→ 3′) | Annealing temperature (°C) | Reference |
|---|---|---|---|---|
| IL-4 | 416330 | F: GCTCTCAGTGCCGCTGATG | 58 | NA |
| R: GGAAACCTCTCCCTGGATGTC | ||||
| IL-6 | 395337 | F: AGGACGAGATGTGCAAGAAGTTC | 58 | 39 |
| R: TTGGGCAGGTTGAGGTTGTT | ||||
| IL-8 | 396495 | F: AAGGATGGAAGAGAGGTGTGCTT | 58 | NA |
| R: GCTGAGCCTTGGCCATAAGT | ||||
| IL-12p40 | 404671 | F: TTGCCGAAGAGCACCAGCCG | 65 | 40 |
| R: CGGTGTGCTCCAGGTCTTGGG | ||||
| IL-18 | 395312 | F: GAAACGTCAATAGCCAGTTGC | 58 | 40 |
| R: TCCCATGCTCTTTCTCACAACA | ||||
| IFN-β | 554219 | F: ACCAGATCCAGCATTACATCCA | 58 | NA |
| R: CGCGTGCCTTGGTTTACG | ||||
| IFN-γ | 396054 | F: ACACTGACAAGTCAAAGCCGC | 58 | 40 |
| R: AGTCGTTCATCGGGAGCTTG | ||||
| Ubiquitin C | 396425 | F: GGGATGCAGATCTTCGTGAAA | 58 | 41 |
| R: CTTGCCAGCAAAGATCAACCTT |
F = Forward. NA = Not applicable; designed in-house. NCBI = National Center for Biotechnology Information. R = Reverse.
