Exercise-induced pulmonary hemorrhage is common in racehorses after intense exercise; EIPH is detected in up to 75% of such horses via endoscopic evaluation of respiratory tracts.1,2 Horses with no or very mild EIPH are 4 times as likely to win a race as horses with moderate or severe EIPH,3 suggesting this condition has negative effects on racehorse performance.
The predominant location of EIPH lesions in horses is the caudodorsal regions of lungs.4–6 A distinctive histopathologic lesion of EIPH is remodeling of small-diameter pulmonary veins (venous remodeling).5 Venous remodeling is characterized by collagen deposition in walls and smooth muscle hypertrophy of veins resulting in thickening of walls and narrowing of lumens.7 Other lesions of EIPH include pulmonary interstitial and septal fibrosis, hemosiderin accumulation in lung tissue, and bronchial circulation neovascularization.7,8
Pulmonary venous remodeling has potentially important physiologic effects on vascular pressures in lungs. During exercise, horses have a substantial increase in pulmonary intravascular pressures.9,10 Estimated pulmonary capillary pressures in horses are between 17.8 mm Hg11 and 25 mm Hg9 at rest and between 72.5 mm Hg10 and 83.3 mm Hg9 during exercise. Such transmural pulmonary capillary pressures can cause blood vessel rupture and EIPH.12 A decrease in the lumen size of pulmonary veins would further increase pulmonary capillary pressures. Complete pulmonary venous occlusion would cause capillary pressures equal to pulmonary arterial pressures, which can be ≥ 96.5 mm Hg.9,10 Remodeling of systemic (in rabbits, rodents, and pigs)13–18 and pulmonary (in humans and sheep)19,20 veins can develop when such blood vessels are exposed to high intravascular pressures.
Results of studies of vasculature in humans,21–23 pigs,17,24 and rodents25,26 indicate venous remodeling is preceded by alterations in mRNA expression of proteins that are important in the remodeling process. These proteins include MMPs, TIMPs,17,25 collagen,26 tenascin-C,21 and various growth factors that are produced by fibroblasts in vein walls and monocytes and macrophages.22–24,26,27 The objective of the study reported here was to determine mRNA expression of MMP-2, MMP-9, TIMP-1, TIMP-2, collagen type I, tenascin-C, endothelin-1, PDGF, TGF-β, and VEGF and protein expression of tenascin-C, TGF-β, and VEGF in pulmonary veins obtained from caudodorsal and cranioventral regions of lungs of horses before and after 2 weeks of intense exercise. Because the amount of collagen in lung parenchyma of horses with EIPH is greater than that for horses without EIPH (primarily in the caudodorsal regions of lungs7), we also compared collagen content in parenchyma of caudodorsal and cranioventral regions of lungs of horses before and after 2 weeks of intense exercise. The hypothesis was that 2 weeks of intense exercise would alter mRNA and protein expression of the evaluated factors in pulmonary veins of caudodorsal but not cranioventral regions of lungs of horses in a manner expected to favor vascular remodeling. In addition, we hypothesized that exercise of horses would cause an increase in the collagen content of caudodorsal but not cranioventral regions of lungs.
Materials and Methods
Animals—Seven horses (6 geldings and 1 sexually intact female; age range, 2 to 4 years; body weight range, 350 to 473 kg) of non–racing breeds were purchased for use in this study. These horses had not been previously trained for any purpose and were selected for inclusion in the study because it was unlikely that they had prior EIPH episodes. Horses were not vigorously exercised for at least 2 months before the study. The horses were determined to be healthy on the basis of results of physical examinations and tracheobronchoendoscopy. One horse was excluded from the study because of lameness. Therefore, the study was completed and data were analyzed for 6 horses. The Michigan State University Institutional Animal Care and Use Committee approved this study.
Experimental protocol—Pulmonary wedge resections were performed via a thoracoscopic technique for standing horses. Before undergoing an intense exercise protocol, lung samples were obtained from cranioventral and caudodorsal regions of left or right lungs (determined via a randomization procedure) of each horse. Horses were then returned to pasture for at least 6 months. Subsequently, horses underwent conditioning and intense exercise during a 4-week period. After completion of the intense exercise protocol (first exercise period), pulmonary wedge resections were performed to obtain samples from cranioventral and caudodorsal regions of right or left lungs of horses (lung contralateral to the lung from which samples were obtained before exercise); the mRNA prepared from these lung samples was of poor quality and low quantity. Therefore, horses were rested for a further 6 months and the exercise protocol was repeated (second exercise period). Subsequently, tissue samples from the cranioventral and caudodorsal regions of the same lung (contralateral to the lung from which samples were obtained before the first exercise protocol) were collected during general anesthesia of horses. Lung samples were obtained from sites that had not previously undergone surgery. A long time (12 months) was allowed between pulmonary wedge resection procedures to minimize the effects of previous surgeries on gene expression.
Exercise protocol—Horses underwent a 2-week period of conditioning followed by a 2-week period of intense exercise intended to simulate race training. Horses were conditioned 5 d/wk for 2 weeks on a high-speed treadmill with a 0% incline. After 2 weeks of conditioning, the maximum heart rate of each horse was determined via a rapid incremental exercise test.28 Briefly, heart rates were determined by use of a telemetric system; the maximum heart rate was determined as that at which an increase in treadmill speed did not result in an increase in heart rate. The treadmill speed corresponding to 120% of maximum heart rate was determined via extrapolation.
After the 2-week conditioning period, horses were intensely exercised on 6 days (intense exercise days 1, 3, 5, 8, 10, and 12). Each exercise session included a 4-minute warmup period followed by exercise at a treadmill speed corresponding to 120% of maximum heart rate for 2 minutes or until the horse could no longer maintain its position on the treadmill. Within 45 to 90 minutes after the end of the final exercise session of the first exercise period, horses underwent endoscopic examination of the trachea. Endoscopic examination of horses was not repeated after the second exercise period because the intensity of exercise during the first period was determined to have been adequate to induce EIPH. An established grading system (grade 0 = no blood visible in trachea; grade 4 = > 90% of tracheal surface covered in blood)29 was used to determine EIPH severity in study horses.
Pulmonary wedge resection—During each pulmonary wedge resection procedure, 2 lung samples were obtained from each horse (1 sample each from the cranioventral and caudodorsal regions of the left or right lung).30 Briefly, each horse was restrained in stocks and sedated with a continuous IV infusion of detomidine hydrochloride (initial dose of 6 μg/kg followed by 0.8 μg/kg/min). Mepivacaine (20 to 30 mL of a 2% solution) was injected SC and in intercostal muscles at each surgery site. Intercostal nerves at surgery sites were blocked at the level of vertebral transverse processes with 0.75% bupivacaine (5 mL/site). Antimicrobial drugs (penicillin G potassium [22,000 U/kg, IV, q 6 h] and gentamicin sulfate [6.6 mg/kg, IV, q 24 h]) and an NSAID (flunixin meglumine [1.1 mg/kg, IV, q 12 h]) were administered during surgery after lung samples had been obtained (to avoid potential effects of drugs on gene expression). For thoracoscopy, a 30° rigid endoscope (10 mm × 58 cm),a video camera,b light cable, and 250-W xenon light sourcec were used. Pneumothorax was induced and lungs were deflated via insertion of a teat cannula into the pleural space. Six instrument portals were made in the thoracic wall (3 for each lung sample collection site [1 each for an endoscope, forceps, and stapler]). The caudodorsal lung sample collection site was accessed via intercostal spaces 12, 13, and 15; the cranioventral site was accessed via intercostal spaces 7 and 8. Endoscopic atraumatic forcepsd were used to manipulate lungs. An endoscopic staplere was used to perform pulmonary wedge resections. Lung samples (approx 4 cm long) were obtained from each site. Lungs were reinflated by withdrawing air from the thorax, and skin at portal sites was closed with sutures in a simple interrupted pattern. Antimicrobial and NSAID administration was continued for 7 days after surgery
Pulmonary wedge resections were performed within 24 hours after completion of the first exercise period to collect lung samples from the lung contralateral to the lung from which tissue samples had been obtained before exercise. Within 24 hours after completion of the second exercise period, each horse was anesthetized (xylazine hydrochloride [1.1 mg/kg, IV] followed by ketamine hydrochloride [2.2 mg/kg, IV]) and placed in left or right lateral recumbency. Lung samples were obtained via thoracotomy, and previous surgery sites were avoided. Immediately after lung samples were obtained, anesthetized horses were euthanized with pentobarbital sodium (90 mg/kg, IV).
Harvesting of pulmonary veins—Immediately after collection, lung samples were divided into 2 approximately equal pieces; one was placed in a storage solutionf and kept at 4°C for 24 hours, and then stored until use at −20°C. The other piece of each lung sample was fixed in neutral-buffered 10% formalin and embedded in paraffin for histologic examination and morphometric and immunohistochemical analyses; 6-μm-thick sections of lung tissue were placed on glass slides and stained with H&E, picrosirius red, and Verhoeff-Van Gieson stains.
For lung samples in storage solution,f intralobular pulmonary veins (length, 0.5 to 3 mm) were collected by use of a dissecting microscope.g During preliminary studies, accurate identification and dissection of pulmonary veins from peripheral lung tissue had been validated via histologic techniques. For each horse, all veins harvested for each lung collection site and time were pooled for mRNA extraction.
mRNA extraction—Pulmonary vein samples were removed from storage solutionf and placed in 400 μL of lysis bufferh (containing β-mercaptoethanol). Pulmonary vein samples were processed with a tissue grinder.i Total RNA was extracted with a kitj and a homogenizerk; DNase digestionl was used in conjunction with RNA extractionj in an attempt to remove genomic DNA. The purity and concentration of RNA in each sample were determined with a spectrophotometer.m In addition, RNA integrity number31 was determined by use of a bioanalzyer system.n To ensure adequate purity and concentration of mRNA, only samples with 260 nm-to-280 nm absorbance ratios between 1.9 and 2.2 were used. In addition, only mRNA samples with an RNA integrity number ≥ 5 were used.32 As a result of these criteria, all samples obtained after the first exercise period and samples obtained from 2 horses after the second period were not assayed. Therefore, mRNA samples for 4 horses prepared from lung samples obtained after the second exercise period were assayed. Both horses with EIPH (endoscopic diagnosis) were included in the final analysis. Then, cDNA was synthesizedo and amplifiedp (because of low cDNA concentrations).
qRT-PCR assays—The qRT-PCR assays were performed with a PCR amplification systemq operating in standard mode with custom-designed probes (Appendix).r The primer design variables for each gene were tested extensively, resulting in 100% PCR amplification efficiency of a 6-log dilution range for mRNA samples free of PCR inhibitors. The qRT-PCR assays were performed in triplicate with a 20-μL reaction mixture for each reaction well; reaction mixtures contained 10 μL of a DNA polymerase and deoxyribonucleotide triphosphate mixture,s 1 μL of a mixture of forward and reverse primers and custom-designed probes, t 5 μL of amplified cDNA, and 4 μL of nuclease-free water. Expression of MMP-2, MMP-9, TIMP-1, TIMP-2, collagen type I, tenascin-C, endothelin-1, PDGF, TGF-β, and VEGF was determined via qRT-PCR assays. The qRT-PCR assays were performed at 50°C for 2 minutes, 95°C for 10 minutes, and 40 cycles of 95°C for 15 seconds and 60°C for 1 minute. The endogenous control values for the qRT-PCR assay were mean values of β-actin, β-microglobulin, and elongation factor-1α expression. Fold changes in gene expression were calculated via the comparative Ct (2−ΔΔCT) method.33 Statistical analyses were performed on the basis of ΔCt; for each mRNA sample and gene of interest, ΔCt was defined as the mean Ct of the gene in a sample minus the mean Ct of the control genes in that same sample.
Immunohistochemistry—The 6-μm-thick lung tissue sections were deparaffinized in xylene and rehydrated in a graded series of concentrations of ethanol. Lung sections were incubated overnight at 4°C with antibodies against tenascin-C (1:100),u TGF-β (1:100),v or VEGF (1:100).w To ensure antibody binding specificity, a peptide blockingv,w step was used for antibodies against TGF-β and VEGF, and nonspecific rabbit IgG was used for antibodies against tenascin-C. For each antibody, an appropriate positive control tissue was analyzed. Following incubation with primary antibodies, lung sections were incubated with rabbit (TGF-β and VEGF) or mouse (tenascin-C) biotinylated secondary antibody. Then, slides were incubated with avidin-biotin conjugated horseradish peroxidasex and antibodies were detected with a peroxidase substrate.y A board-certified veterinary pathologist (KJW) who was unaware of the exercise status of horses and sample locations of lung tissue sections evaluated all slides via bright-field microscopy. Pulmonary vein protein expression was scored as 0 (no evidence of protein expression), 1 (mild protein expression in a small number of veins), or 2 (strong protein expression in most [≥ 50%] veins).
Collagen content analysis—Picrosirius red staining and polarized microscopy of tissue samples is commonly used for detection and quantification of collagen.7,34 For the quantification of collagen in lung tissue samples in the present study, picrosirius red–stained slides were scanned and digitalized at a magnification of 20× with a virtual slide system.z Polarization filters were used to enhance the appearance of the picrosirius red stain in images of lung tissue samples. Automated random sub-sampling was performed on each of the digitalized slides with stereology softwareaa (magnification, 20×), and 50 images/slide were analyzed. Some lung sample slides had pleural tissue; such regions were excluded from analysis. Morphological determination of the percentage of collagen in lung tissue samples was performed with software.35,bb Briefly, a point grid with a density of 7 × 7 points/98,157 μm2 was superimposed over images and all points that contacted noncollagenous lung tissue and those that contacted collagenous tissue were counted. The percentage of collagen in lung tissue samples was estimated by dividing the number of points that contacted collagen by the total number of points counted.
Statistical analysis—The values of ΔCt were evaluated for normality and transformed as needed for statistical analysis. The resulting data were analyzed with the following modelcc to determine effect of exercise on the expression of each gene:
where Yijkl is the normalized gene expression of a gene of interest for horsei in samplej that corresponds to lung sitek (caudodorsal or cranioventral) and statusl (before or after exercise), μ is the mean value for the population, and eij is the residual. Horse effects were assumed to be random to account for within-horse measurement correlations; residuals within each horse were heteroskedastic for lung samples obtained before and after exercise, indicating there were different variances for those groups. This model is practically equivalent to use of a joint mixed model analysis of test and control genes.36
For immunohistochemistry data, the Wilcoxon signed rank testdd for nonparametric data was used for analyses. The pre- and postexercise scores were compared for each lung sample collection site.
For collagen content data, a 3-factor (2-factor repeated-measures) ANOVAcc was used for analyses with site (caudodorsal or cranioventral) and time (before or after exercise) as fixed factors and horse as the random factor. Bonferroni correction for multiple comparisons was used. A normal distribution of errors was determined via the Shapiro-Wilk test. Collagen content data were reported as least squares mean ± SEM. Values of P < 0.05 were considered significant.
Results
Two of 6 horses that finished the study had tracheobronchoscopic evidence of pulmonary hemorrhage within 90 minutes after the end of the final high-intensity exercise session during the first exercise period; therefore, 33.3% of horses had EIPH at that time. The EIPH severity grade for both of those horses was 1 of 4.29
The mRNA prepared from pulmonary vein samples were of insufficient quality for analysis for all horses after the first exercise period and for 2 horses after the second exercise period; therefore, mRNA samples for 4 horses obtained after the second exercise period were analyzed via PCR assay for determination of gene expression. Results of initial analysis indicated exercise of horses had an effect on gene expression in pulmonary vein samples, but the pulmonary wedge resection site (caudodorsal vs cranioventral) × exercise interaction variable was not significant. Therefore, mean values for gene expression in pulmonary vein samples obtained from the caudodorsal regions of lungs and for those obtained from the cranioventral regions of lungs were used for analysis. Exercise of horses significantly decreased expression of 5 of the 10 genes evaluated (MMP-2 [P = 0.017], MMP-9 [P = 0.035], TIMP-2 [P = 0.039], TGF-β [P = 0.003], and VEGF [P = 0.007]; Figure 1). Gene expression did not significantly change after exercise for TIMP-1 (P = 0.270), collagen type I (P = 0.130), tenascin-C (P = 0.659), endothelin-1 (P = 0.077), and PDGF (P = 0.119).
Mean ± SEM fold changes in mRNA expression of 10 genes in pulmonary vein samples of 4 horses after a 2-week period of intense exercise versus expression before exercise. *Expression is significantly (P < 0.05) different between pulmonary vein samples collected before and after exercise.
Citation: American Journal of Veterinary Research 74, 9; 10.2460/ajvr.74.9.1231
The only gene with differential expression between pulmonary vein samples obtained from caudodorsal regions of lungs and those obtained from cranioventral regions of lungs was tenascin-C. The mRNA expression of tenascin-C was approximately 4 times as great in pulmonary vein samples obtained from cranioventral regions of lungs as it was in samples obtained from caudodorsal regions of lungs; these gene expression values were significantly (P = 0.033) different. However, tenascin-C expression in each of those lung regions did not significantly change after exercise.
Protein expression in lung samples was determined via immunohistochemical methods for all 6 horses that completed the study; results indicated exercise had no effect on protein expression of tenascin-C, TGF-β, or VEGF in tissue samples obtained from caudodorsal or cranioventral regions of lungs. The percentage of collagen in tissue samples obtained from caudodorsal regions of lungs was significantly (P < 0.05) higher than that in tissue samples obtained from cranioventral regions of lungs, although the percentage of collagen was not significantly different in lung samples obtained before and after exercise (Figure 2).
Least squares mean ± SEM percentage of collagen in samples from the cranioventral (CV) and caudodorsal (CD) regions of the lungs of 6 horses before (black bars) and after (gray bars) a 2-week period of intense exercise. Bars indicate no significant (P < 0.05) differences between lung samples obtained before and after exercise within a region. *Mean values for pre- and postexercise tissue samples obtained from the caudodorsal regions of the lungs are significantly (P < 0.05) higher than those obtained from the cranioventral regions of the lungs.
Citation: American Journal of Veterinary Research 74, 9; 10.2460/ajvr.74.9.1231
Discussion
Venous remodeling is important in the pathogenesis of EIPH. Alterations in mRNA expression are expected to precede structural changes in vasculature. Therefore, the purpose of this study was to determine whether 2 weeks of intense exercise would affect mRNA and protein expression of mediators of pulmonary intralobular vein remodeling in a manner expected to favor vascular remodeling in caudodorsal but not cranioventral regions of lungs of horses.
The thoracoscopic technique used to obtain lung samples from standing horses in this study was previously reported30 and validated by personnel in our laboratory. No intraoperative complications were detected, and horses had no substantial problems attributable to the surgery. The endoscopic deviceg used to obtain lung samples resulted in collection of an adequate amount of tissue for harvest of veins and preparation of mRNA. To reduce the effects of surrounding tissues on results for pulmonary veins, a microdissection technique was used to ensure that only the cells of interest (intralobular venous wall cells) were isolated and assayed.
The markers of venous remodeling evaluated in the present study were selected on the basis of studies conducted with animals of other species because such information was not available for horses, to the authors’ knowledge. The activities of MMP-2 and MMP-9, which have predominantly proteolytic actions, are regulated by TIMP-1 and TIMP-237; these factors regulate the protein content of extracellular matrix. In general, hypertension results in increased expression of MMP-2 and MMP-9 mRNA or protein25,38 and decreased16,17 or no change39 in TIMP expression.
Results of other studies indicate collagen content is increased in severely affected regions of lungs of horses with EIPH7 and in walls of remodeled veins in humans19 and rabbits.16 Tenascin-C (an extracellular matrix protein) expression is upregulated by MMPs40 and PDGF41 and is expressed during venous remodeling.18,21 Endothelin-1 causes vasoconstriction in vivo42 and has been implicated in pulmonary43 and systemic24 venous remodeling. Platelet-derived growth factor is a potent mitogen of connective tissue cells44 and is associated with venous remodeling in pigs.45 The cytokine TGF-β is important in various developmental and pathological processes46 and has been implicated in vein graft remodeling.47 Vascular endothelial growth factor is also a mitogen that is produced by vascular endothelial cells48; that cytokine has a role in formation of neointima in remodeled blood vessels.49,50
We expected that expression of the genes evaluated in this study (except TIMPs) would increase in pulmonary veins of caudodorsal regions of lungs after exercise of horses. Results of this study indicated that mean expression values of all genes evaluated decreased in pulmonary veins after exercise; these findings were significant for MMP-2, MMP-9, TIMP-2, TGF-β, and VEGF. Because the collection site × treatment interaction was not significant, decreases in expression were attributed to causes other than lung region. Although expression of tenascin-C mRNA was not increased after exercise, tenascin-C mRNA expression was higher in pulmonary veins in cranioventral regions of lungs versus those in caudodorsal regions of lungs.
The main advantage of qRT-PCR assays for determination of gene expression in pulmonary veins is that the technique has high sensitivity; therefore, mRNA expression can be determined for small amounts of tissue. Furthermore, expression of multiple genes can be evaluated for a tissue sample via that technique. Data regarding expression of mRNA are commonly used to infer other information about molecular pathways in cells, including information regarding protein expression. However, because of translational and posttranslational control mechanisms, such inferences may not be correct.51 For example, results of another study52 indicate differential mRNA and protein expression of MMP-2, MMP-9, and TIMP-1. Because of this possibility, we determined vascular expression of TGF-β, VEGF, and tenascin-C via immunohistochemical methods. Unlike the results for gene expression, no significant decrease in protein expression was detected by use of that semiquantitative method in the present study. Immunohistochemistry was used rather than quantitative techniques (such as Western blot analysis) because an insufficient amount of protein would have been obtained from the microdissected veins for performance of such assays.
Analysis was performed for determination of the effects of exercise on collagen content of lung samples in this study because results of another study7 indicate the amount of collagen in EIPH-affected lung tissue is higher than that in unaffected lung tissue. Results of the present study indicated that exercise did not have a significant effect on collagen content of lung samples. However, collagen content was significantly different in tissue samples obtained from caudodorsal and cranioventral regions of lungs. Although areas of slides with pleural tissue were excluded from analysis, that finding was likely attributable to anatomic differences between caudodorsal and cranioventral regions of lungs. Also, expression of collagen type I mRNA was not affected by exercise of horses. Similar morphometric analysis for the proteins evaluated via immunohistochemical methods (TGF-β, VEGF, and tenascin-C) was not performed because differences in expression of those proteins were not detected via routine microscopy.
Interactions among mediators of venous remodeling are complex and affected by the type and severity of a stimulus and the timing of tissue sample collection. For example, during development of TGF-β–mediated intimal hyperplasia in vein grafts in rabbits, activities of MMP-2 and MMP-9 concurrently decrease.47 Results of another study53 indicate there is a temporal pattern of MMP-2 and MMP-9 expression during venous remodeling, with an initial increase in expression followed by a decrease in expression to undetectable levels. The significant decrease in expression of MMP-2 and MMP-9 mRNA detected in the present study after exercise of horses may have been attributable to a period of blood vessel remodeling during which those substances had low expression.
A limitation of the present study was the fact that lung samples were evaluated at only 1 time after exercise of horses. Results of another study54 in which gene expression in autologous vein grafts was evaluated via high-throughput microarray analysis indicate expression of TIMP-1 and VEGF mRNA is increased only on day 1 after graft implantation and not on days 7, 14, or 30 after graft implantation; results of that study also indicate collagen expression is decreased on days 1 and 7 and increased on days 14 and 30 after graft implantation. Because data have not been published regarding gene expression in equine pulmonary veins, to the authors’ knowledge, the timing of lung sample collection and the duration of exercise of horses in this study were selected on the basis of other information. Continuous hypertension causes substantial structural alterations in the tunica media and adventitia of pulmonary veins in sheep after only 4 days20; therefore, we predicted that alterations in gene expression (which should precede structural alterations) in vein walls of horses in the present study would be detectable 2 weeks after the end of a 6-session intense exercise period. Because results of this study indicated mRNA expression of various MMPs and growth factors was significantly different after exercise versus gene expression before exercise, that duration and intensity of exercise for horses seemed to be adequate to cause changes in gene expression.
The high-intensity exercise protocol used in the present study was intended to simulate race training (after horses underwent 2 weeks of low-intensity conditioning exercise). The intensity of exercise was expected to be an adequate stimulus for evaluation of changes in gene expression in lungs of horses. Each horse exercised at a speed corresponding to a heart rate of 120% of the maximum heart rate. The maximum heart rate is a reproducible measurement for exercising horses,55 and horses require maximum effort to maintain a position on a treadmill at a speed corresponding to 120% of maximum heart rate. Furthermore, 33.3% of horses in this study had EIPH (as diagnosed via respiratory tract endoscopy); this finding suggested that the exercise was of adequate intensity.
There was a 12-month period between collection of pre- and postexercise lung samples in this study. This period allowed healing of surgical sites after the first procedure. Ageing of animals is associated with remodeling of blood vessel walls56 (particularly arterial walls57); however, such findings have only been detected for very young and very old animals57 and humans.58,59 Therefore, it was unlikely that ageing during the 12-month period affected blood vessel wall characteristics in horses in the present study.
The role of venous remodeling in the pathogenesis of EIPH is not known, to the authors’ knowledge. However, the distribution of venous remodeling in lungs of horses with EIPH (lesions are colocalized with hemosiderin in caudodorsal regions of lungs of affected horses7) suggests that it is important in the pathogenesis of EIPH. Because high intravascular pressures induce remodeling in systemic13–18,60 and pulmonary19,20 veins, we propose that intermittent periods of high pressures in the pulmonary circulation during exercise cause remodeling of pulmonary veins in caudodorsal regions of lungs of horses. Such venous remodeling may result in high pulmonary capillary pressures in affected regions of lungs and an increased risk of capillary rupture and hemorrhage and development of EIPH.
Results of the present study did not support the hypothesis that 2 weeks of intense exercise would cause alterations in gene and protein expression in pulmonary veins in a manner expected to favor venous remodeling. However, few data regarding timing of expression of genes during vascular remodeling in horses have been published. Further studies are warranted to determine the mechanisms and timing of venous remodeling in horses with EIPH.
ABBREVIATIONS
| Ct | Cycle threshhold |
| EIPH | Exercise-induced pulmonary hemorrhage |
| MMP | Matrix metalloproteinase |
| PDGF | Platelet-derived growth factor |
| qRT-PCR | Quantitative real-time PCR |
| TGF | Transforming growth factor |
| TIMP | Tissue inhibitor of metalloproteinase |
| VEGF | Vascular endothelial growth factor |
Hopkins telescope, Karl Storz Veterinary Endoscopy, Goleta, Calif.
Vetcam, Karl Storz Veterinary Endoscopy, Goleta, Calif.
Stryker Quantum 3000, Stryker Endoscopy, Kalamazoo, Mich.
10-mm atraumatic Babcock forceps, Ethicon Endo-Surgery Inc, Cincinnati, Ohio.
ETS45 Endoscopic linear cutter, Ethicon Endo-Surgery Inc, Cincinnati, Ohio.
RNAlater, Ambion, Life Technologies Corp, Carlsbad, Calif.
Olympus SZX16, Olympus America Inc, Center Valley, Pa.
Buffer RLT, Qiagen Inc, Valencia, Calif.
Kontes Glass Co Duall 21, Fischer Scientific, Pittsburgh, Pa.
RNeasy Micro Kit, Qiagen Inc, Valencia, Calif.
QIAshredder, Qiagen Inc, Valencia, Calif.
RNase-Free DNase Set, Qiagen Inc, Valencia, Calif.
NanoDrop 1000 Spectrophotometer, NanoDrop Products, Wilimington, Del.
2100 Bioanalyzer with RNA Pico 6000 kit, Aligent Technologies, Santa Clara, Calif.
High Capacity cDNA Reverse Transcription Kit with RANse inhibitor, Applied Biosystems Inc, Life Technologies Corp, Carlsbad, Calif.
TaqMan PreAmp Master Mix, Applied Biosystems Inc, Life Technologies Corp, Carlsbad, Calif.
7500 Fast Real-Time PCR system, Applied Biosystems Inc, Life Technologies Corp, Carlsbad, Calif.
Informatics pipeline software, Applied Biosystems Inc, Life Technologies Corp, Carlsbad, Calif.
TaqMan Gene Expression Master Mix, Applied Biosystems Inc, Life Technologies Corp, Carlsbad, Calif.
Custom TaqMan Gene Expression Assay Mix, Applied Biosystems Inc, Life Technologies Corp, Carlsbad, Calif.
Tenascin-C (BC-24), sc-59884, SantaCruz Biotechnology, Santa Cruz, Calif.
TGF-β1 (V), sc-146, with blocking peptide, SantaCruz Biotechnology, Santa Cruz, Calif.
VEGF (147), sc-507, with blocking peptide, SantaCruz Biotechnology, Santa Cruz, Calif.
Vectastain Elite ABC System, Vector Laboratories Inc, Burlingame, Calif.
NovaRED Peroxidase Substrate Kit, Vector Laboratories Inc, Burlingame, Calif.
VS120-SL, Olympus America Inc, Center Valley, Pa.
NewCAST whole slide stereology software, Visiopharm, Hoersholm, Denmark.
STEPanizer Sterology Tool, Universität Bern, Bern, Switzerland. Available at: www.stepanizer.com. Accessed Apr 18, 2013.
PROC MIXED, SAS, SAS Institute Inc, Cary, NC.
Number Cruncher Statistical System, NCSS Statistical Software, Kaysville. Utah.
References
1. Pascoe JR, Ferraro GL, Cannon JH, et al. Exercise-induced pulmonary hemorrhage in racing Thoroughbreds: a preliminary study. Am J Vet Res 1981; 42:703–707.
2. Raphel CF, Soma LR. Exercise-induced pulmonary hemorrhage in Thoroughbreds after racing and breezing. Am J Vet Res 1982; 43:1123–1127.
3. Hinchcliff KW, Jackson MA, Morley PS, et al. Association between exercise-induced pulmonary hemorrhage and performance in Thoroughbred racehorses. J Am Vet Med Assoc 2005; 227:768–774.
4. O'Callaghan MW, Pascoe JR, Tyler WS, et al. Exercise-induced pulmonary haemorrhage in the horse: results of a detailed clinical, post mortem and imaging study. II. Gross lung pathology. Equine Vet J 1987; 19:389–393.
5. Williams KJ, Derksen FJ, de Feijter-Rupp H, et al. Regional pulmonary veno-occlusion: a newly identified lesion of equine exercise-induced pulmonary hemorrhage. Vet Pathol 2008; 45:316–326.
6. Oikawa M. Exercise-induced haemorrhagic lesions in the dorsocaudal extremities of the caudal lobes of the lungs of young Thoroughbred horses. J Comp Pathol 1999; 121:339–347.
7. Derksen FJ, Williams KJ, Pannirselvam RR, et al. Regional distribution of collagen and haemosiderin in the lungs of horses with exercise-induced pulmonary haemorrhage. Equine Vet J 2009; 41:586–591.
8. O'Callaghan MW, Pascoe JR, Tyler WS, et al. Exercise-induced pulmonary haemorrhage in the horse: results of a detailed clinical, post mortem and imaging study. V. Microscopic observations. Equine Vet J 1987; 19:411–418.
9. Manohar M, Goetz TE. Pulmonary vascular pressures of exercising Thoroughbred horses with and without endoscopic evidence of EIPH. J Appl Physiol 1996; 81:1589–1593.
10. Langsetmo I, Meyer MR, Erickson HH. Relationship of pulmonary arterial pressure to pulmonary haemorrhage in exercising horses. Equine Vet J 2000; 32:379–384.
11. Sinha AK, Gleed RD, Hakim TS, et al. Pulmonary capillary pressure during exercise in horses. J Appl Physiol 1996; 80:1792–1798.
12. Birks EK, Mathieu-Costello O, Fu Z, et al. Very high pressures are required to cause stress failure of pulmonary capillaries in Thoroughbred racehorses. J Appl Physiol 1997; 82:1584–1592.
13. Hayashi K, Mori K, Miyazaki H. Biomechanical response of femoral vein to chronic elevation of blood pressure in rabbits. Am J Physiol Heart Circ Physiol 2003; 284: H511–H518.
14. Liu SQ, Fung YC. Changes in the organization of the smooth muscle cells in rat vein grafts. Ann Biomed Eng 1998; 26:86–95.
15. Choy JS, Dang Q, Molloi S, et al. Nonuniformity of axial and circumferential remodeling of large coronary veins in response to ligation. Am J Physiol Heart Circ Physiol 2006; 290: H1558–H1565.
16. Wong AP, Nili N, Jackson ZS, et al. Expansive remodeling in venous bypass grafts: novel implications for vein graft disease. Atherosclerosis 2008; 196:580–589.
17. Chung AW, Rauniyar P, Luo H, et al. Pressure distention compared with pharmacologic relaxation in vein grafting upregulates matrix metalloproteinase-2 and −9. J Vasc Surg 2005; 42:747–756.
18. Abeles D, Kwei S, Stavrakis G, et al. Gene expression changes evoked in a venous segment exposed to arterial flow. J Vasc Surg 2006; 44:863–870.
19. Chazova I, Robbins I, Loyd J, et al. Venous and arterial changes in pulmonary veno-occlusive disease, mitral stenosis and fibrosing mediastinitis. Eur Respir J 2000; 15:116–122.
20. Johnson JE, Perkett EA, Meyrick B. Pulmonary veins and bronchial vessels undergo remodeling in sustained pulmonary hypertension induced by continuous air embolization into sheep. Exp Lung Res 1997; 23:459–473.
21. Wallner K, Li C, Fishbein MC, et al. Arterialization of human vein grafts is associated with tenascin-C expression. J Am Coll Cardiol 1999; 34:871–875.
22. Nikol S, Huehns TY, Weir L, et al. Restenosis in human vein bypass grafts. Atherosclerosis 1998; 139:31–39.
23. Passerini AG, Milsted A, Rittgers SE. Shear stress magnitude and directionality modulate growth factor gene expression in preconditioned vascular endothelial cells. J Vasc Surg 2003; 37:182–190.
24. Wan S, Yim AP, Johnson JL, et al. The endothelin 1A receptor antagonist BSF 302146 is a potent inhibitor of neointimal and medial thickening in porcine saphenous vein–carotid artery interposition grafts. J Thorac Cardiovasc Surg 2004; 127:1317–1322.
25. Watts SW, Rondelli C, Thakali K, et al. Morphological and biochemical characterization of remodeling in aorta and vena cava of DOCA-salt hypertensive rats. Am J Physiol Heart Circ Physiol 2007; 292: H2438–H2448.
26. Wolff RA, Malinowski RL, Heaton NS, et al. Transforming growth factor-beta1 antisense treatment of rat vein grafts reduces the accumulation of collagen and increases the accumulation of h-caldesmon. J Vasc Surg 2006; 43:1028–1036.
27. Stenmark KR, Davie N, Frid M, et al. Role of the adventitia in pulmonary vascular remodeling. Physiology (Bethesda) 2006; 21:134–145.
28. Tetens J, Derksen FJ, Stick JA, et al. Efficacy of prosthetic laryngoplasty with and without bilateral ventriculocordectomy as treatments for laryngeal hemiplegia in horses. Am J Vet Res 1996; 57:1668–1673.
29. Hinchcliff KW, Jackson MA, Brown JA, et al. Tracheobronchoscopic assessment of exercise-induced pulmonary hemorrhage in horses. Am J Vet Res 2005; 66:596–598.
30. Lugo J, Stick JA, Peroni J, et al. Safety and efficacy of a technique for thoracoscopically guided pulmonary wedge resection in horses. Am J Vet Res 2002; 63:1232–1240.
31. Schroeder A, Mueller O, Stocker S, et al. The RIN: an RNA integrity number for assigning integrity values to RNA measurements. BMC Mol Biol 2006; 7:3.
32. Fleige S, Pfaffl MW. RNA integrity and the effect on the real-time qRT-PCR performance. Mol Aspects Med 2006; 27:126–139.
33. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-delta delta C(T)) method. Methods 2001; 25:402–408.
34. Pick R, Jalil JE, Janicki JS, et al. The fibrillar nature and structure of isoproterenol-induced myocardial fibrosis in the rat. Am J Pathol 1989; 134:365–371.
35. Tschanz SA, Burri PH, Weibel ER. A simple tool for stereological assessment of digital images: the STEPanizer. J Microsc 2011; 243:47–59.
36. Steibel JP, Poletto R, Coussens PM, et al. A powerful and flexible linear mixed model framework for the analysis of relative quantification RT-PCR data. Genomics 2009; 94:146–152.
37. Nagase H, Visse R, Murphy G. Structure and function of matrix metalloproteinases and TIMPs. Cardiovasc Res 2006; 69:562–573.
38. Lehoux S, Lemarie CA, Esposito B, et al. Pressure-induced matrix metalloproteinase-9 contributes to early hypertensive remodeling. Circulation 2004; 109:1041–1047.
39. Castro MM, Rizzi E, Prado CM, et al. Imbalance between matrix metalloproteinases and tissue inhibitor of metalloproteinases in hypertensive vascular remodeling. Matrix Biol 2010; 29:194–201.
40. Jones PL, Crack J, Rabinovitch M. Regulation of tenascin-C, a vascular smooth muscle cell survival factor that interacts with the alpha v beta 3 integrin to promote epidermal growth factor receptor phosphorylation and growth. J Cell Biol 1997; 139:279–293.
41. Wallner K, Sharifi BG, Shah PK, et al. Adventitial remodeling after angioplasty is associated with expression of tenascin mRNA by adventitial myofibroblasts. J Am Coll Cardiol 2001; 37:655–661.
42. Miyauchi T, Masaki T. Pathophysiology of endothelin in the cardiovascular system. Annu Rev Physiol 1999; 61:391–415.
43. Takahashi H, Soma S, Muramatsu M, et al. Upregulation of ET-1 and its receptors and remodeling in small pulmonary veins under hypoxic conditions. Am J Physiol Lung Cell Mol Physiol 2001; 280: L1104–L1114.
44. Heldin CH, Westermark B. Mechanism of action and in vivo role of platelet-derived growth factor. Physiol Rev 1999; 79:1283–1316.
45. Francis SE, Hunter S, Holt CM, et al. Release of platelet-derived growth factor activity from pig venous arterial grafts. J Thorac Cardiovasc Surg 1994; 108:540–548.
46. Pardali E, Goumans MJ, ten Dijke P. Signaling by members of the TGF-beta family in vascular morphogenesis and disease. Trends Cell Biol 2010; 20:556–567.
47. Jiang Z, Tao M, Omalley KA, et al. Established neointimal hyperplasia in vein grafts expands via TGF-beta–mediated progressive fibrosis. Am J Physiol Heart Circ Physiol 2009; 297: H1200–H1207.
48. Ferrara N. Vascular endothelial growth factor: basic science and clinical progress. Endocr Rev 2004; 25:581–611.
49. Ohtani K, Egashira K, Hiasa K, et al. Blockade of vascular endothelial growth factor suppresses experimental restenosis after intraluminal injury by inhibiting recruitment of monocyte lineage cells. Circulation 2004; 110:2444–2452.
50. Zhang J, Silva T, Yarovinsky T, et al. VEGF blockade inhibits lymphocyte recruitment and ameliorates immune-mediated vascular remodeling. Circ Res 2010; 107:408–417.
51. Shebl FM, Pinto LA, Garcia-Piñeres A, et al. Comparison of mRNA and protein measures of cytokines following vaccination with human papillomavirus-16 L1 virus-like particles. Cancer Epidemiol Biomarkers Prev 2010; 19:978–981.
52. Lichtinghagen R, Musholt PB, Lein M, et al. Different mRNA and protein expression of matrix metalloproteinases 2 and 9 and tissue inhibitor of metalloproteinases 1 in benign and malignant prostate tissue. Eur Urol 2002; 42:398–406.
53. Southgate KM, Mehta D, Izzat MB, et al. Increased secretion of basement membrane-degrading metalloproteinases in pig saphenous vein into carotid artery interposition grafts. Arterioscler Thromb Vasc Biol 1999; 19:1640–1649.
54. Kalish JA, Willis DJ, Li C, et al. Temporal genomics of vein bypass grafting through oligonucleotide microarray analysis. J Vasc Surg 2004; 39:645–654.
55. Evans DL, Rose RJ. Determination and repeatability of maximum oxygen uptake and other cardiorespiratory measurements in the exercising horse. Equine Vet J 1988; 20:94–98.
56. Hemmeryckx B, Emmerechts J, Bovill EG, et al. Effect of ageing on the murine venous circulation. Histochem Cell Biol 2012; 137:537–546.
57. Li Z, Froehlich J, Galis ZS, et al. Increased expression of matrix metalloproteinase-2 in the thickened intima of aged rats. Hypertension 1999; 33:116–123.
58. O'Leary DH, Polak JF, Kronmal RA, et al. Carotid-artery intima and media thickness as a risk factor for myocardial infarction and stroke in older adults. Cardiovascular Health Study Collaborative Research Group. N Engl J Med 1999; 340:14–22.
59. Lakatta EG. Age-associated cardiovascular changes in health: impact on cardiovascular disease in older persons. Heart Fail Rev 2002; 7:29–49.
60. Saucy F, Probst H, Alonso F, et al. Ex vivo pulsatile perfusion of human saphenous veins induces intimal hyperplasia and increased levels of the plasminogen activator inhibitor 1. Eur Surg Res 2010; 45:50–59.
Appendix
Primers and probes used for detection of various genes in pulmonary vein samples of horses via qRT-PCR assay.
| Gene | GenBank accession No. | Forward primer (5′-3′) | Reverse primer (5′-3′) | Probe |
|---|---|---|---|---|
| MMP-2 | AJ010314 | TCCGAGTCTGGAGTGATGTGA | GATCATGATGTCAGCCTCTCCAT | CCCACTACGGTTTTCT |
| MMP-9 | NM-001111302 | GCAAGGAGTACTCTGCCTGTA | CCAGAGGCGCCCATCA | CTGCGGCCCTCTCTG |
| TIMP-1 | NM_001082515 | GCCAGGGCTTCACCAAGA | CAGTGTCACTCTGCAGTTTGC | ATGCTCAGTGTTTCCC |
| TIMP-2 | AJ010315 | CTGACAAGGACATCGAGTTCATCTA | GCGAGACCCCGCACA | ACGGCTCCCTCCTCG |
| PDGF | XM001914920 | GAGCCCAGAGCAGATGCAA | CTTCTTGCTCTGACCCACGAT | ACAGCAGCCCACTTGC |
| TGF-β | NM-001081849 | GGAATGGCTGTCCTTTGATGTCA | CGAAGGCCCTCCATTGC | CTGCCGCACGACTCC |
| Endothelin-1 | AY730629 | CGACATCATCTGGGTCAACACT | GGATCGCTTGGACCTGGAA | CCGAGCACATTGTTCC |
| Collagen type I | AF034691 | CGGACAGCCTGGACTCC | CAGCAAATTTCTCATCATAGCCATAAGAC | CCTCCTGGACCTCCCG |
| VEGF | NM_001081821 | GCAAATGTGAATGCAGACCAAAGAA | GCTTTCTCCGCTCTGAGCAA | CCACAGGGATTTTC |
| Tenascin-C | AY246747 | GTGGAGTATTTCATCCGTGTGTTTG | GCCACCCTGGCACTGA | CCATCCCGGAGAACAA |
| β-Actin | NM 001081838 | GGGACCTGACGGACTACCT | CCGTGGTGGTGAAGCTGTAG | TCCGTGAGGATCTTCA |
| β2-microglobulin | NM_001082502 | CGCCTGAGATTGAAATTGATTTGCT | GACCAGTCCTTGCTGAAAGACA | ACCGGTCGACTTTCAT |
| Elongation factor-1α | AY237113 | CCACCAACTCGTCCAACTGATAAG | GACAGTACCGATACCACCAATTTTG | CCCTTGCGTCTGCCCC |
