In human and veterinary patients, cardiac diseases frequently progress into heart failure. The pathophysiologic understanding of this process has changed from a simple mechanical pump failure to a complex concept involving neurohormonal, immune, and metabolic pathways.1–5
Myocardial infiltration of inflammatory cells in people, rodents, and dogs with cardiac disease has been reported, and both inflammatory and myocardial cells produce cytokines.1,5 Depending on their role in inflammation, cytokines are classified into pro- and anti-inflammatory cytokines. Proinflammatory cytokines have direct toxic effects on the heart, contribute to inflammation, and result in changes in myocardial structure and function.1,2,5–7 Anti-inflammatory cytokines are suspected to be cardioprotective.8 Increased intracardiac concentrations of cytokines have been associated with heart failure.2,5 Furthermore, inflammatory cells, including lymphocytes and macrophages, interact directly with fibroblasts during the inflammatory phase of cardiac disease. Different T-cell subsets are involved in chronic cardiac injury, especially in fibrogenesis,9 and a synergic function of T lymphocytes and fibroblasts in cardiac remodeling is suspected.
T-helper cells develop into T-helper 1 and T-helper 2 cell subsets, which are characterized by the production of IFN-γ and IL-4, IL-5, and IL-13, respectively.9 In general, T-helper 2 cell-polarized responses promote fibrosis, whereas T-helper 1 cell–derived cytokines may be antifibrogenic during inflammation.9 In patients with heart failure, an immune response with predominance of T-helper 1 cells and an imbalance in the T-helper 1 cell–to–T-helper 2 cell ratio was reported.10
In addition, CD4+CD25+Foxp3+ regulatory T cells are known modulators of effector responses, and these cells can downregulate autoimmune responses and protect against inflammatory tissue injury.9 Along with other functions, regulatory T cells secrete TGF-β, which is a powerful immunosuppressive factor and the most potent profibrotic cytokine.9 However, other authors have reported a pivotal role of regulatory T cells in limiting fibrogenesis by suppressing excessive immune activation.11
Growth differentiation factor-15 is a member of the TGF-β superfamily.12 It is involved in regulating inflammatory and apoptotic pathways needed for development, differentiation, and tissue repair in various organs.12 In cardiac disease, cardiomyocytes express and secrete GDF-15, suggesting a possible protective factor. Growth differentiation factor-15 expression is increased in humans with cardiac disease and heart failure, and GDF-15 was reported as a biomarker of cardiovascular disease severity.12,13
The role of T-helper and regulatory T cells for regulation of inflammation and cardiac fibrosis is not entirely understood. Better characterization of the immune regulation associated with cardiac diseases may improve the understanding of cardiac disease progression and may provide potential targets for treatment development. Furthermore, GDF-15 as a potential biomarker of cardiac diseases in dogs has not been previously reported, to our knowledge. The objective of the study reported here was to compare myocardial expression of several pro- and anti-inflammatory, T-helper 1 cell– and T-helper 2 cell–, and regulatory T cell–derived cytokines and of GDF-15 in CDDs, SDDs, and dogs without cardiac or systemic diseases (control dogs).
Materials and Methods
Dogs—Myocardial samples were collected after death or euthanasia from 7 CDDs and 7 SDDs. Myocardial samples were also collected after euthanasia (via IV administration of high-dose barbiturate injection) from 8 pharmaceutical company–owned research dogs without cardiac or systemic diseases (control dogs). Four of the control dogs were used in experimental studies that ended 4 to 13 months prior to euthanasia. Informed consent was obtained from owners of CDDs and SDDs prior to inclusion in the study. Dogs were assigned arbitrary numbers as identifiers.
Of the 14 CDDs and SDDs, 12 dogs were evaluated at the Small Animal Teaching Hospital, University of Liverpool. The 7 SDDs underwent physical examination and then further diagnostic investigation; depending on each dog's underlying condition, additional evaluations included a CBC, serum biochemical analysis, urinalysis, ultrasonography, radiography, CT, MRI, cytologic examination of fine-needle aspirate samples, or histologic examination of biopsy specimens. The dogs were euthanized on request of their owners because of poor prognosis and progressive disease for which an improvement with treatment was not expected. Five CDDs were patients of the hospital's cardiology department and had a history of clinical signs for 3 weeks to 10 months. To obtain a diagnosis, a physical examination and cardiac workup including blood pressure measurement, ECG, echocardiography, and thoracic radiography were performed at various points prior to euthanasia. For classification of heart failure, the ABCD scheme14 was used. Investigations performed at evaluation for euthanasia differed among cases and were subject to decision of the attending cardiologist. For 2 other dogs, diagnosis was made by a board-certified cardiologist in another practice; the dogs were referred for euthanasia, and no further investigations were performed. Those dogs and 4 of the CDDs were euthanized because of endstage cardiac disease and refractory heart failure or because of the severity of disease. One CDD with recurrent ventricular tachycardia developed ventricular fibrillation and died.
Sample collection—The heart was removed from each dog within 1 hour after death. Each heart was opened and rinsed thoroughly to remove any blood contamination. Three to 4 myocardial tissue samples (approx 3 mm in thickness) were collected from the interventricular septum, right atrium, right ventricle, left atrium, and left ventricle of each heart. These samples were immediately immersed in an RNA-stabilizing solutiona at room temperature (approx 21°C) for 24 hours before being stored at −20°C until use, in accordance with the manufacturer's instructions. The remaining cardiac tissues were fixed in 10% formalin for gross pathological and histologic examination.
Gross pathological and histologic examinations—All hearts of SDDs and CDDs were investigated to confirm clinical diagnosis, and to exclude cardiac diseases and myocardial infiltration in SDDs, each heart was assessed for congenital or acquired cardiac disease lesions. The heart chambers and walls were assessed for dilation or hypertrophy. One or 2 tissue samples (approx 1 cm2 each) were collected from the right and left atria, interatrial and interventricular septae, left and right ventricular walls, left and right atrioventricular valves, and left- and right-sided ventricular outflow tracts, including aortic and pulmonic valves, for histologic examination. The samples were embedded in paraffin wax and routinely sectioned (3.5 μm) and stained with H&E stain. From each myocardial site, 2 to 4 tissue sections were microscopically examined by 1 pathologist (UH).
RNA extraction and reverse transcriptase PCR assay—Tissue samples were removed from the RNA-stabilizing solution,a and total RNA was extracted with a commercially available kitb and a slightly modified manufacturer's protocol as reported.15 Ribonucleic acid was quantified, and cDNA was synthesized, as reported.15
Primer sequences were as follows: IL-1 (forward, 5′ATGAGGGCATCCAGTTGCA3′; reverse, 5′CACGAAATGCCTCAGACTCTTG3′), IL-2 (forward, 5′AGATGGAGCAATTACTGCTGG3′; reverse, 5′ATTCTGTGGCCTTCTTGGGCGTGT3′), IL-4 (forward, 5′ACATCCTCACAGCGAGAAACG3′; reverse, 5′GCAGTGAAGACGTCCTTGACAGT3′), IL-6 (forward, 5′GGCTACTGCTTTCCCTACCC3′; reverse, 5′TTTTCTGCCAGTGCCTCTTT3′), IL-8 (forward, 5′TTGCCTTGGTCTCTTCTTTATTCC3′; reverse, 5′TTCTGTGAGGTAGGATGCTTGCT3′), IL-10 (forward, 5′CCTGGGTTGCCAAGCCCTGTC3′; reverse, 5′ATGCGCTCTTCACCTGCTCC3′), TNF-α (forward, 5′TCTCGAACCCCAAGTGACAAG3′; reverse, 5′GGAGCTGCCCCTCAGCTT3′), IFN-γ (forward, 5′GAAAAGGAGTCAGAATCTGTTTCGA3′; reverse, 5′TGCAGGCAGGATGACCATTA3′), TGF-β1 (forward, 5′CACCCGCGTGCTAATGGT3′; reverse, 5′GCGGACTTTTCTTGACTTTCTCA3′), TGF-β2 (forward, 5′GACCCCACATCTCCTGCTAA3′; reverse, 5′CACCCAAGATCCCTCTTGAA3′), TGF-β3 (forward, 5′GGCTGGCGGAGCACAAT3′; reverse, 5′AAACCTTGGAGGTGATTCCTTTG3′), and GDF-15 (forward, 5′ACTCCAGTACCGACGTGTCC3′; reverse, 5′TCGCAGCTTTGGAGTGAGTA3′). Bioinformatic searchesc were performed to confirm gene specificity. Primers were synthesized by a biotechnology supplier.d The primer sequences for the housekeeping gene GAPDH have been previously reported.16 Primers were validated with a standard curve of 8 serial dilutions, and primer efficiencies were between 96% and 117%.
The PCR assay was performed as reported15 according to standard protocol with 2 minutes at 50°C, 10 minutes at 90°C followed by 40 cycles of 95°C for 15 seconds and 60°C for 1 minute. The PCR assay was followed by a dissociation program for 1 minute at 95°C, succeeded by 41 cycles during which the temperature was increased each cycle, starting at 55°C and ending at 95°C. All PCR amplifications resulted in 1 well-defined peak. Real-time data were analyzed with software.e Expression was normalized to GAPDH expression (relative expression) and calculated via the 2−ΔCt method.17
Statistical analysis—Data were entered into spreadsheets,f and analysis was performed with statistical software.g Following basic descriptive statistics, a number of variables were transformed to improve normality and the model assumptions necessary for parametric analysis. Expression of IL-1, IL-4, IL-6, IL-10, TNF-α, TGF-β2, TGF-β3, and GDF-15 was logarithmically transformed; the inverse square root was applied to expression of IL-2, IL-8, and TGF-β1, and the inverse was used for IFN-γ expression.
Age was not normally distributed, so a Mann-Whitney U test was used to compare differences in age among groups of dogs. Cytokine, growth factor, and GDF-15 expressions in different regions of the heart, between sexes, and among groups were compared via 1-way ANOVA. We performed a cluster analysis of the data, which were not transformed, to explore the relationships between cytokine, growth factor, and GDF-15 expression via the correlation matrix and a Ward linkage dendrogram. Individual correlations were examined with the Pearson correlation test. Values of P < 0.05 were considered significant.
Results
Dogs—The 8 dogs included in the study as control dogs were Beagles between 1.5 and 4.5 years old; the median age was 2.75 years, which was significantly (P = 0.02) younger than the median age of the SDDs or CDDs. Of the 8 control dogs, 4 were male and 4 were female; 3 of the male dogs and 1 female dog were used previously in a study by a pharmaceutical company.
Among the 7 SDDs included in the study, there was 1 crossbred dog with lymphoma, 1 German Shepherd Dog with suspected hemangiosarcoma, 1 crossbred dog with pancreatic carcinoma, 1 Boxer and 1 Cocker Spaniel with brain tumors, 1 Labrador Retriever with a vertebral column fracture after a road traffic accident, and 1 Rottweiler with secondary hyperparathyroidism. The diagnosis of suspected hemangiosarcoma in the German Shepherd Dog was not confirmed because aspirate samples or biopsy specimens were not collected for examination. Gross and histologic examination of the heart (performed as part of the study) did not reveal any cardiac involvement. Unfortunately, the remainder of the dog's body was not available for postmortem examination. The SDDs were between 0.5 and 11 years old (median age, 7.5 years). Of the 7 SDDs, 4 were sexually intact males and 3 were neutered females. No evidence of cardiac disease was detected via clinical examination for any SDD.
Among the 7 CDDs included in the study, 4 (2 Doberman Pinschers, 1 Great Dane, and 1 Bullmastiff) had dilated cardiomyopathy; 1 German Shepherd Dog had degenerative valvular disease, 1 Labrador Retriever had arrhythmogenic cardiomyopathy and recurrent refractory ventricular tachycardia, and 1 French Bulldog had myocarditis. All dogs were in current or refractory heart failure (stages C3 and D) at euthanasia. Four of the CDDs had atrial fibrillation (the German Shepherd Dog had degenerative valvular disease, and both Doberman Pinschers and the Great Dane had dilated cardiomyopathy). The dogs were between 6 and 14 years old; the median age was 8.0 years, which was similar to the median age of the dogs with SDDs (P = 0.44). Of the 7 CDDs, 2 were sexually intact males, 1 was a neutered male, 1 was a sexually intact female, and 3 were neutered females.
Histologic findings—Histologic evaluation of myocardial tissue samples from control dogs was not performed. There was no macroscopic or histopathologic evidence of cardiac disease or neoplastic myocardial infiltration in the SDDs (Figure 1). The crossbred dog with pancreatic carcinoma, the Labrador Retriever with vertebral column fracture, and the Cocker Spaniel with a brain tumor had mild lymphocytic infiltration in both atria.18
Photomicrographs of a section of nonaltered septal myocardium obtained from a Cocker Spaniel with a brain tumor (A) and a section of septal myocardium with necrosis of single cardiomyocytes and Anichkov cell formation obtained from a Bullmastiff with endstage dilated cardiomyopathy (B). H&E stain; bar = 20 μm.
Citation: American Journal of Veterinary Research 74, 3; 10.2460/ajvr.74.3.408
Among the CDDs, the diagnosis of the dogs with degenerative valvular disease and dilated cardiomyopathy was confirmed histologically (Figure 1). Dogs with dilated cardiomyopathy had lipomatosis cordis; interstitial, subendo- and subepicardial fibrosis; leukocyte infiltration; and focal cardiomyocyte necrosis, as reported.18,19 The dog with ventricular tachycardia had mild lymphocytic infiltration of unclear underlying etiopathogenesis in both atria and the interventricular septum. The French Bulldog had marked pyogranulomatous subepicarditis and myocarditis of unknown cause.
PCR assay results—In the control dogs, mean expression of only TNF-α, TGF-β1, and TGF-β3 mRNA was evident. The expression of TNF-α, TGF-β1, and TGF-β3 mRNA in male control dogs was significantly (P < 0.001) higher than the findings for female control dogs (Table 1). No differences in gene expressions were present among cardiac regions. In SDDs and CDDs, mRNA expression of all cytokines, growth factors, and GDF-15 was detected (Tables 2 and 3). In SDDs, there was significantly higher (P = 0.009) IFN-γ mRNA expression and lower (P < 0.001) TGF-β3 mRNA expression in the atria, compared with findings for the ventricles. In CDDs, expression of IL-2, IFN-γ, IL-1, and TGF-β1 differed among cardiac regions. Interleukin-2 and IFN-γ mRNA expression was significantly (P = 0.008 and P = 0.042, respectively) higher in right and left atria, compared with findings for the ventricles; IL-1 and TGF-β1 mRNA expression was significantly (P = 0.012 and P = 0.048, respectively) increased in the right atrium, compared with findings for the ventricles.
Relative expression of TNF-α, TGF-β1, and TGF-β3 mRNA in myocardial tissue samples obtained from 8 dogs with no cardiac or systemic diseases (control dogs), 7 SDDs, and 7 CDDs.
| Variable | Male | Female | ||||||
|---|---|---|---|---|---|---|---|---|
| Control (n = 20) | SDD (n = 20) | CDD (n = 15*) | P value | Control (n = 20) | SDD (n = 15†) | CDD (n = 20†) | P value | |
| TNF-α | 1.47 ± 0.57a | 0.63 ± 0.21 | 1.14 ± 0.51 | < 0.001 | 0.38 ± 0.41 | 0.83 ± 0.22 | 0.97 ± 0.66 | 0.015 |
| TGF-β1‡ | 0.01 ± 0.003a | 0.02 ± 0.005 | 0.02 ± 0.007 | 0.004 | 0.26 ± 0.18 | 0.018 ± 0.004 | 0.017 ± 0.005 | < 0.001 |
| TGF-β3 | 3.78 ± 0.48a | 2.82 ± 0.36 | 2.67 ± 0.42 | < 0.001 | 1.56 ± 0.75 | 2.89 ± 0.54 | 2.95 ± 0.43 | < 0.001 |
Data are reported as mean ± SD; gene expression was normalized to GAPDH expression (relative expression). Values in parentheses represent the number of evaluated tissue samples. Values of P represent the comparison of relative mRNA expression between groups; a value of P < 0.05 was considered significant.
Group included 1 neutered dog.
Group included 3 neutered dogs.
For normalization, data were inversed (smaller numeric values are greater than larger numeric values).
For a given variable, the value for the male control dogs was significantly (P < 0.001) different from the value for the female control dogs.
Relative expression of mRNA of various cytokines, growth factors, and GDF-15 in myocardial tissue samples obtained from various cardiac regions in 7 SDDs and 7 CDDs.
| Variable | SDD | CDD | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| IVS | LA | LV | RA | RV | P value | IVS | LA | LV | RA | RV | P value | |
| IL-1 | 0.97 ± 0.38 | 1.03 ± 0.27 | 1.03 ± 0.46 | 1.36 ± 0.60 | 0.85 ± 0.35 | 0.280 | 1.31 ± 0.62 | 1.33 ± 0.34 | 1.16 ± 0.34 | 1.83 ± 0.31 | 1.28 ± 0.44 | 0.012 |
| IL-2‡ | 0.57 ± 0.41 | 0.45 ± 0.44 | 0.72 ± 0.37 | 0.50 ± 0.36 | 0.56 ± 0.38 | 0.740 | 0.51 ± 0.36 | 0.44 ± 0.26 | 0.75 ± 0.12 | 0.30 ± 0.15 | 0.67 ± 0.16 | 0.008 |
| IL-4 | 0.10 ± 0.08 | 0.10 ± 0.13 | 0.09 ± 0.09 | 0.16 ± 0.16 | 0.10 ± 0.07 | 0.730 | 0.31 ± 0.63 | 0.18 ± 0.26 | 0.10 ± 0.08 | 0.29 ± 0.41 | 0.20 ± 0.23 | 0.840 |
| IL-6 | 1.13 ± 1.05 | 1.48 ± 0.80 | 1.12 ± 1.12 | 1.42 ± 0.90 | 1.00 ± 1.03 | 0.860 | 1.77 ± 0.85 | 1.67 ± 0.84 | 1.61 ± 0.62 | 2.25 ± 0.82 | 1.90 ± 1.19 | 0.680 |
| IL-8‡ | 0.12 ± 0.04 | 0.15 ± 0.83 | 0.13 ± 0.07 | 0.13 ± 0.07 | 0.16 ± 0.07 | 0.840 | 0.08 ± 0.05 | 0.06 ± 0.02 | 0.10 ± 0.04 | 0.04 ± 0.03 | 0.09 ± 0.06 | 0.200 |
| IL-10 | 1.24 ± 0.25 | 1.36 ± 0.24 | 1.22 ± 0.29 | 1.61 ± 0.41 | 1.20 ± 0.23 | 0.076 | 1.45 ± 0.47 | 1.77 ± 0.22 | 1.55 ± 0.30 | 1.98 ± 0.95 | 1.87 ± 0.60 | 0.410 |
| TNF-α | 0.67 ± 0.15 | 0.66 ± 0.20 | 0.70 ± 0.23 | 0.90 ± 0.28 | 0.64 ± 0.24 | 0.230 | 0.82 ± 0.59 | 1.0 ± 0.35 | 0.86 ± 0.37 | 1.29 ± 0.78 | 1.23 ± 0.77 | 0.490 |
| IFN-γ‡ | 0.50 ± 0.23 | 0.48 ± 0.28 | 0.73 ± 0.20 | 0.42 ± 0.15 | 0.77 ± 0.08 | 0.009 | 0.45 ± 0.34 | 0.31 ± 0.28 | 0.60 ± 0.17 | 0.20 ± 0.08 | 0.49 ± 0.20 | 0.042 |
| TGF-β1‡ | 0.02 ± 0.005 | 0.02 ± 0.004 | 0.02 ± 0.005 | 0.02 ± 0.005 | 0.02 ± 0.006 | 0.420 | 0.02 ± 0.002 | 0.02 ± 0.006 | 0.02 ± 0.006 | 0.01 ± 0.003 | 0.02 ± 0.006 | 0.048 |
| TGF-β2 | 2.59 ± 0.32 | 2.34 ± 1.08 | 2.52 ± 0.30 | 2.98 ± 0.25 | 2.44 ± 0.41 | 0.280 | 2.85 ± 0.28 | 2.64 ± 0.55 | 2.66 ± 0.48 | 2.90 ± 0.96 | 2.88 ± 0.49 | 0.860 |
| TGF-β3 | 3.07 ± 0.37 | 2.28 ± 0.38 | 2.97 ± 0.36 | 2.42 ± 0.40 | 3.05 ± 0.30 | < 0.001 | 2.98 ± 0.34 | 2.61 ± 0.31 | 2.87 ± 0.29 | 2.86 ± 0.55 | 3.13 ± 0.40 | 0.190 |
| GDF-15 | 0.99 ± 0.38 | 0.75 ± 0.50 | 0.94 ± 0.70 | 0.88 ± 0.99 | 0.66 ± 0.43 | 0.870 | 1.03 ± 0.54 | 0.79 ± 0.62 | 0.82 ± 0.36 | 1.21 ± 0.57 | 0.74 ± 1.36 | 0.770 |
Data are reported as mean ± SD; gene expression was normalized to GAPDH expression (relative expression). Values of P represent the comparison of relative mRNA expression between cardiac regions in SDDs and CDDs.
IVS = Interventricular septum. LA = Left atrium. LV = Left ventricle. RA = Right atrium. RV = Right ventricle.
See Table 1 for remainder of key.
Relative expression of mRNA of various cytokines, growth factors, and GDF-15 in myocardial tissue samples obtained from 7 SDDs and 7 CDDs and further subclassified on the basis of sex and cardiac region.
| Variable | All dogs | Male dogs | Female dogs | Atria | Ventricles | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| SDD (n = 35) | CDD (n = 35) | P value | SDD (n = 20) | CDD (n = 15) | P value | SDD (n = 15) | CDD (n = 20) | P value | SDD (n = 14) | CDD (n = 14) | P value | SDD (n = 14) | CDD (n = 14) | P value | |
| IL-1 | 1.05 ± 0.43 | 1.43 ± 0.46 | 0.001 | 1.0 ± 0.40 | 1.50 ± 0.46 | 0.002 | 1.12 ± 0.48 | 1.38 ± 0.47 | 0.120 | 1.20 ± 0.48 | 1.58 ± 0.40 | 0.031 | 0.94 ± 0.40 | 1.22 ± 0.38 | 0.076 |
| IL-2‡ | 0.56 ± 0.38 | 0.53 ± 0.27 | 0.730 | 0.59 ± 0.33 | 0.51 ± 0.24 | 0.450 | 0.52 ± 0.45 | 0.55 ± 0.29 | 0.830 | 0.47 ± 0.39 | 0.37 ± 0.22 | 0.400 | 0.64 ± 0.37 | 0.71 ± 0.14 | 0.540 |
| IL-4 | 0.11 ± 0.10 | 0.22 ± 0.36 | 0.100 | 0.18 ± 0.09 | 0.32 ± 0.48 | 0.190 | 0.03 ± 0.04 | 0.13 ± 0.21 | 0.056 | 0.13 ± 0.14 | 0.23 ± 0.34 | 0.310 | 0.10 ± 0.08 | 0.16 ± 0.17 | 0.290 |
| IL-6 | 1.23 ± 0.95 | 1.84 ± 0.86 | 0.007 | 1.58 ± 1.07 | 2.09 ± 0.79 | 0.130 | 0.77 ± 0.48 | 1.65 ± 0.88 | 0.001 | 1.45 ± 0.82 | 1.96 ± 0.85 | 0.120 | 1.06 ± 1.04 | 1.75 ± 0.92 | 0.075 |
| IL-8‡ | 0.14 ± 0.07 | 0.07 ± 0.05 | < 0.001 | 0.12 ± 0.07 | 0.08 ± 0.05 | 0.022 | 0.16 ± 0.06 | 0.07 ± 0.05 | < 0.001 | 0.14 ± 0.08 | 0.05 ± 0.03 | < 0.001 | 1.45 ± 0.07 | 0.09 ± 0.05 | 0.033 |
| IL-10 | 1.33 ± 0.31 | 1.73 ± 0.57 | 0.001 | 1.29 ± 0.33 | 1.77 ± 0.48 | 0.001 | 1.38 ± 0.30 | 1.69 ± 0.64 | 0.097 | 1.49 ± 0.35 | 1.88 ± 0.67 | 0.070 | 1.21 ± 0.25 | 1.71 ± 0.49 | 0.002 |
| TNF-α | 0.72 ± 0.23 | 1.04 ± 0.60 | 0.004 | 0.63 ± 0.21 | 1.14 ± 0.51 | 0.001 | 0.83 ± 0.22 | 0.97 ± 0.66 | 0.430 | 0.78 ± 0.27 | 1.51 ± 0.60 | 0.048 | 0.67 ± 0.23 | 1.04 ± 0.61 | 0.044 |
| IFN-γ‡ | 0.58 ± 0.24 | 0.42 ± 0.26 | 0.008 | 0.53 ± 0.28 | 0.34 ± 0.23 | 0.041 | 0.65 ± 0.16 | 0.47 ± 0.27 | 0.036 | 0.45 ± 0.22 | 0.27 ± 0.21 | 0.180 | 0.75 ± 0.15 | 0.54 ± 0.19 | 0.004 |
| TGF-β1‡ | 0.02 ± 0.005 | 0.02 ± 0.006 | 0.130 | 0.02 ± 0.005 | 0.02 ± 0.007 | 0.750 | 0.02 ± 0.004 | 0.02 ± 0.004 | 0.810 | 0.02 ± 0.005 | 0.02 ± 0.006 | 0.030 | 0.02 ± 0.005 | 0.02 ± 0.006 | 0.770 |
| TGF-β2 | 2.57 ± 0.57 | 2.79 ± 0.57 | 0.120 | 2.61 ± 0.70 | 2.8 ± 0.57 | 0.400 | 2.53 ± 0.36 | 2.78 ± 0.59 | 0.150 | 2.66 ± 0.82 | 2.77 ± 0.76 | 0.710 | 2.48 ± 0.35 | 2.77 ± 0.48 | 0.080 |
| TGF-β3 | 2.76 ± 0.48 | 2.89 ± 0.40 | 0.220 | 2.82 ± 0.36 | 2.67 ± 0.42 | 0.210 | 2.89 ± 0.54 | 2.95 ± 0.43 | 0.490 | 2.35 ± 0.38 | 2.74 ± 0.45 | 0.022 | 3.01 ± 0.32 | 3.00 ± 0.36 | 0.920 |
| GDF-15 | 0.84 ± 0.61 | 0.92 ± 0.74 | 0.640 | 0.80 ± 0.76 | 0.99 ± 0.68 | 0.440 | 0.90 ± 0.37 | 0.86 ± 0.80 | 0.860 | 0.81 ± 0.76 | 1.0 ± 0.62 | 0.490 | 0.80 ± 0.58 | 0.78 ± 0.95 | 0.960 |
Data are reported as mean ± SD; gene expression was normalized to GAPDH expression (relative expression). Values of P represent the comparison of relative mRNA expression in SDDs and CDDs.
See Table 1 for remainder of key.
Comparison of groups—In the control group, a significant difference in mean TNF-α, TGF-β1, and TGF-β3 mRNA expression was detected between the sexes. Therefore, TNF-α, TGF-β1, and TGF-β3 expressions were considered separately for male and female dogs. Male SDDs and CDDs had significantly lower mean TNF-α (P < 0.001), TGF-β1 (P = 0.004), and TGF-β3 (P < 0.001) mRNA expression than did male control dogs, whereas female SDDs and CDDs had significantly higher TNF-α (P = 0.015), TGF-β1 (P < 0.001), and TGF-β3 (P < 0.001) expression than female control dogs (Table 1).
Compared with findings for SDDs, the IL-1 (P = 0.001), IL-6 (P = 0.007), IL-8 (P < 0.001), IL-10 (P = 0.001), TNF-α (P = 0.004), and IFN-γ (P = 0.008) mRNA expression in CDDs was significantly increased (Table 3). In female CDDs, expression of the proinflammatory cytokines IL-6 (P = 0.001), IL-8 (P < 0.001), and IFN-γ (P = 0.036) was increased, compared with findings for female SDDs. In male CDDs, expression of IL-1 (P = 0.002), IL-8 (P = 0.022), TNF-α (P = 0.001), IFN-γ (P = 0.041), and anti-inflammatory and profibrotic IL-10 (P = 0.001) was increased, compared with findings for male SDDs. In the atria of CDDs, the expression of mRNA for IL-1 (P = 0.031), IL-8 (P < 0.001), TNF-α (P = 0.048), TGF-β1 (P = 0.03), and TGF-β3 (P = 0.022) mRNA was significantly greater than that in the atria of SDDs (Table 3). In the ventricles of CDDs, the expression of mRNA for IL-8 (P = 0.033), IL-10 (P = 0.002), TNF-α (P = 0.044), and IFN-γ (P = 0.004) mRNA was significantly greater than that in the ventricles of SDDs.
Cluster analysis and correlations—Cluster analysis of the CDD data revealed a group consisting of IL-6, GDF-15, IL-8, TNF-α, IL-10, TGF-β1, and TGF-β3 and a second group consisting of IL-1, IL-2, TGF-β2, IFN-γ, and IL-4 (Figure 2). Pearson correlation analysis revealed a significant (P < 0.002) positive correlation among IL-6, IL-8, TNF-α, GDF-15, IL-10, TGF-β1, and TGF-β3 expressions (Table 4). Additionally, IL-2 and TGF-β2 expressions (P < 0.001) and IFN-γ and IL-4 expressions (P < 0.001) were positively correlated.
Correlations among expressions of mRNA for various cytokines, growth factors, and GDF-15 in myocardial tissue samples obtained from 7 CDDs.
| Variable | IL-1 | IL-6 | TNF-α | IL-10 | TGF-β2 | TGF-β3 | GDF-15 | IL-4 | IL-2 | IL-8 | IFN-γ |
|---|---|---|---|---|---|---|---|---|---|---|---|
| IL-6 | 0.309 (0.071) | — | — | — | — | — | — | — | — | — | — |
| TNF-α | 0.356 (0.036) | 0.923 (< 0.001) | — | — | — | — | — | — | — | — | — |
| IL-10 | 0.407 (0.015) | 0.852 (< 0.001) | 0.948 (< 0.001) | — | — | — | — | — | — | — | — |
| TGF-β2 | 0.415 (0.013) | 0.338 (0.047) | 0.435 (0.009) | 0.456 (0.006) | — | — — | — — | — | |||
| TGF-β3 | 0.221 (0.201) | 0.547 (0.001) | 0.527 (0.001) | 0.533 (0.001) | 0.056 (0.750) | — | — | — | — | — | — |
| GDF-15 | 0.217 (0.211) | 0.937 (< 0.001) | 0.966 (< 0.001) | 0.874 (< 0.001) | 0.341 (0.045) | 0.538 (0.001) | — | — | — | — | — |
| IL-4 | 0.240 (0.165) | 0.030 (0.865) | −0.047 (0.787) | −0.075 (0.670) | 0.153 (0.381) | 0.017 (0.923) | −0.018 (0.918) | — | — | — | — |
| IL-2 | 0.253 (0.143) | 0.081 (0.644) | 0.063 (0.721) | 0.156 (0.369) | 0.596 (< 0.001) | −0.078 (0.655) | 0.015 (0.934) | 0.024 (0.893) | — | — | — |
| IL-8 | 0.220 (0.204) | 0.933 (< 0.001) | 0.969 (< 0.001) | 0.876 (< 0.001) | 0.351 (0.039) | 0.536 (0.001) | 0.999 (< 0.001) | −0.026 (0.883) | 0.017 (0.921) | — | — |
| IFN-γ | 0.323 (0.058) | 0.087 (0.621) | 0.003 (0.985) | 0.039 (0.825) | 0.143 (0.413) | 0.042 (0.811) | 0.012 (0.946) | 0.864 (< 0.001) | 0.105 (0.548) | −0.001 (0.994) | — |
| TGF-β1 | 0.475 (0.004) | 0.723 (< 0.001) | 0.834 (< 0.001) | 0.881 (< 0.001) | 0.738 (< 0.001) | 0.447 (0.007) | 0.732 (< 0.001) | −0.046 (0.794) | 0.460 (0.005) | 0.738 (< 0.001) | 0.056 (0.751) |
Data are reported as Pearson correlation value, with P value in parentheses.
— = Not applicable.
See Table 2 for remainder of key.
Cluster dendrogram generated from data regarding mRNA expression (determined via quantitative PCR assays) of IL-1β, IL-2, IL-4, IL-6, IL-8, IL-10, TNF-α, IFN-γ, TGF-β1, TGF-β2, TGF-β3, and GDF-15 in myocardial tissue samples obtained from 7 CDDs. Greater similarity among clusters is indicated by lower horizontal lines that connect clusters. Cluster analysis of the CDD data revealed one group with association of IL-6, GDF-15, IL-8, TNF-α, IL-10, TGF-β1, and TGF-β3, and a second group with association of IL-1, IL-2, and TGF-β2 and association of IFN-γ and IL-4.
Citation: American Journal of Veterinary Research 74, 3; 10.2460/ajvr.74.3.408
Discussion
In myocardial samples from control dogs (ie, dogs without cardiac or systemic diseases), only mRNA expression for TNF-α, TGF-β1, and TGF-β3 was detected with significantly higher transcription in male than in female control dogs. In SDDs and CDDs, significantly greater mRNA expression of pro- and anti-inflammatory cytokines IL-1, IL-2, IL-4, IL-6, IL-8, IL-10, IFN-γ, TGF-β2, and GDF-15 was present in both sexes with a further increase of IL-1, IL-6, IL-8, IL-10, and IFN-γ mRNA in CDDs. This suggested an activation of the inflammatory system in both groups of dogs.
The activation of the inflammatory system in SDDs was likely in response to the dogs' neoplastic or systemic disease. Even in the absence of histologic evidence of cardiac involvement, stimulation of cardiac expression of inflammatory cytokines might be possible in diseased states. Cytokines and growth factors are involved in regulation of myocardial collagen metabolism1,3,20,21 and proinflammatory cytokines, in particular IL-1, IL-6, and TNF-α, affect cardiomyocyte contractility, influence cardiomyocyte hypertrophy and apoptosis, and contribute to left ventricular remodeling.1,3,5,22 In mice, even mild renal insufficiency results in cardiac apoptosis and fibrosis caused by alterations of TGF-β pathways and apoptotic pathways, which progresses to global left ventricular dysfunction and remodeling.23 In humans, increases in circulating concentrations of proinflammatory markers are associated with a higher risk of cardiac disease and heart failure.24 The expression of cytokines and growth factors in SDDs and CDDs of the present study was therefore suggestive of myocardial dysfunction and cardiac remodeling, and the further increase of cytokine transcription in CDDs, compared with that in SDDs, was not surprising. It would be of interest to investigate a possible association of cardiac impairment, systemic diseases, and increased circulating cytokine concentrations in veterinary patients to identify the potential use of cytokines as early markers for cardiac impairment and their prognostic value. Unfortunately, circulating cytokine concentrations were not measured in the present study.
The higher level of IFN-γ mRNA expression in CDDs, compared with findings in SDDs, might indicate an activation of T-helper 1 cells, especially considering that IL-4 (a cytokine produced by T-helper 2 cells) was not similarly increased. T-helper 1 cell polarization and T-helper 1-T-helper 2 cell imbalance has been detected in humans with heart failure10 and has been suggested to occur during initiation of fibrosis.25
The transcription of IL-10, a product of type 1 regulatory T cells,26 was greater in myocardial samples from male CDDs than that in myocardial samples from male SDDs, whereas the expression of TNF-α mRNA and profibrotic TGF-β1 and TGF-β3 was reduced in male SDDs and male CDDs, compared with the respective expressions in control dogs. The anti-inflammatory and antifibrotic effects of IL-1026,27 together with reduced TNF-α and TGF-β transcription might be associated with control of the inflammatory reaction and improved left ventricular function and possibly has cardioprotective effects. However, between male CDDs and male SDDs, proinflammatory IL-1, IL-8 and TNF-α mRNA were increased in male CDDs. High expression levels of IL-6, TNF-α, and IL-10 were found to be highly predictive of poor outcome in humans with decompensated acute heart failure.28 Therefore, further investigations are needed analyzing the role of TNF-α and IL-10 in dogs with cardiac diseases.
In contrast to findings among male dogs, female SDDs and CDDs had higher TGF-β1 and TGF-β3 mRNA expression than did female control dogs. In rat hearts, norepinephrine increases the expression of the TGF-β isoforms and sex differences in expressions between male and female rats have been observed.29 In valve tissues of dogs with degenerative valvular disease, an increase of TGF-β1 and TGF-β3 expression was detected, compared with findings in healthy dogs, and an involvement in the pathogenesis of the disease was suspected.30 However, sex differences were not investigated.30
In addition to their profibrotic function,20,31 TGF-β1 and TGF-β3 are necessary for the expansion and survival of regulatory T cells.32,33 Regulatory T cells actively suppress innate and adaptive immunity and maintain a suppressive T-cell population in vivo. Intravenous infusion of regulatory T cells was associated with reduced angiotensin II-induced cardiac damage, reduced cardiac inflammation characterized by reduced myocardial infiltration of inflammatory cells, reduced TNF-α expression, diminished gap junction delocalization, reduced cardiac hypertrophy, and less fibrosis in hypertensive mice.11 In humans with heart failure, the frequencies of circulating regulatory T cells were reduced, compared with apparently normal subjects.33
Therefore, the greater level of TGF-β1 and TGF-β3 mRNA expression in female SDDs and CDDs, compared with findings in female control dogs, and the correlation with expressions of several cytokines might indicate preserved extracellular matrix control of the immune system and reduced cardiac damage in heart failure and, consequently, less progressive development of cardiac disease and potentially improved rate and duration of survival.
The extent to which sex has a role in development of cardiac diseases and whether a reduction or an increase in TGF-β1 and -3 transcriptions, as in male and female ill dogs, respectively, is cardioprotective in dogs is not known. One could speculate that the higher expression of TGF-β1 and -3 mRNA in male control dogs and female ill dogs suggests a higher regenerative capacity in male control dogs and less progressive cardiac disease in female ill dogs. In ventricular tissue samples from adult male rats, TGF-β1 mRNA expression was suspected to be associated with higher regenerative capacity of the interstitial compartment.34 In humans, women have a better prognosis after the onset of heart failure than do men, and gender-related differences in cardiac remodeling are suspected.35,36 Sex-related differences in clinical signs and progression of diseases were also reported for Doberman Pinschers with dilated cardiomyopathy37 and dogs with valvular disease.38
The myocardial expression of TGF-β2 mRNA in male and female dogs might suggest activation of fetal gene expression and increased synthesis of collagen and cardiac remodeling in both cardiac and systemic diseases. Transforming growth factor-β2 is involved in embryonic cardiac development, cardiomyocyte differentiation, and increased synthesis of collagen type III, which has an important role during heart failure.31,39 Aupperle et al30 did not detect an increase in TGF-β2 concentration in valve tissues from dogs with degenerative valvular disease. However, most of those dogs had mild to moderate valvular disease and no clinical information about these dogs was available, whereas the dogs in the present study had endstage cardiac diseases or severe systemic diseases. Furthermore, protein instead of mRNA was detected by Aupperle et al.30
Comparison of data for various cardiac regions in the CDDs with findings in SDDs in the present study revealed significantly higher expression of mRNA for several cytokines and TGF-β in the atria. These differences are suggestive of different remodeling processes, as reported.40 Atria are chambers of dynamic cellular and extracellular matrix remodeling. The expression of TGF-β mRNA in human atria is increased by angiotensin II,41 and an increase in the amount of TGF-β1 protein in the left atrium in dogs with tachypacing-induced heart failure has been reported.42 Marked atrial dilatation and high atrial pressures are found with intense collagen turnover, and increased TGF-β1 expression is reported to be associated with atrial remodeling, fibrotic changes, and atrial fibrillation.43,44 The resulting structural atrial remodeling might be a crucial response in evolving heart failure.45 The comparative increase of inflammatory cytokines and TGF-β mRNA expression in the atria of CDDs might therefore be associated with developing heart failure and atrial fibrillation, the latter of which was evident in 4 of 7 CDDs in the present study.
Growth differentiation factor-15, which is a member of the TGF-β superfamily, is considered a reliable biomarker for adverse prognosis in humans with congestive heart failure.13 Expression of GDF-15 mRNA was positively correlated with the expression of proinflammatory and profibrotic cytokines and growth factors in the present study. However, no differences in GDF-15 transcription were detected between SDDs and CDDs. It appears that myocardial GDF-15 mRNA might be useful as a marker for myocardial involvement but is not specific for cardiac diseases in ill dogs. However, in the present study, myocardial mRNA expression instead of circulating protein expression was determined and the use of GDF-15 protein as a marker for myocardial disease or myocardial cell damage and as a prognostic marker in dogs requires further investigations.
Limitations of the present study included its descriptive nature. Because clinical cases were used, availability of myocardial samples was limited and only a small heterogeneous group of dogs was assessed. Clinical procedures were subject to decision by the attending clinician and varied among dogs. Therefore, assessment of any association of PCR results with findings of physical examination, clinicopathologic investigations, or echocardiography was not possible. Gross and histologic examination of relevant tissue samples was performed to confirm diagnosis and to exclude cardiac diseases and myocardial infiltration in SDDs, but further histologic characterization was not performed in SDDs and CDDs.
The control dogs were younger than the ill dogs, which enabled detection of basal transcription levels by avoiding the influence of age-related changes. However, potential age-related variability in cytokine expression in dogs needs further investigation. Four of the control dogs had been included in pharmaceutical studies, and no further information was available. These studies were finished several months prior to euthanasia, and the dogs were apparently healthy with grossly unaltered hearts; however, the hearts were not available for histologic examination. An influence of novel pharmaceutical compounds on myocardial cytokine and growth factor expression cannot be excluded, but no differences in mRNA expressions were present between the control dogs used in pharmaceutical studies and the other 4 control dogs. On the other hand, significant differences in mRNA expressions were present between the 8 control dogs and the SDDs or CDDs.
The groups of SDDs and CDDs included dogs with different systemic and cardiac diseases, and subtle differences in cytokine expression associated with the various diseases will have been missed. However, comparison of cytokine expression in dogs with different cardiac diseases was not the aim of the present study, and differences between groups were identified and provided useful results. Among the ill dogs, endstage diseases with different periods of decompensation and applied treatment protocols were present, which might have had an influence on myocardial cytokine expression.
For the various cytokines of interest in the present study, myocardial mRNA expression and not protein concentration was assessed, and differences in mRNA expression between ill and control dogs might not reflect corresponding differences in protein production. In particular, cytokines in the TGF-β superfamily are expressed in a latent form and must be cleaved before being activated. Unfortunately, an investigation of protein production and the corresponding association with gene expression was not performed. However, activation of cytokines and growth factors in dogs with end-stage diseases in the present study was likely.
The results of the present study revealed a significant increase in myocardial cytokine and growth factor gene expression in SDDs and CDDs, suggesting that cardiac diseases and systemic diseases that do not directly affect the myocardium are associated with activation of the inflammatory system in dogs. Sex differences in myocardial cytokine expression might be present but require further investigation. Cardiac disease–affected dogs had the highest cytokine mRNA expression; one can speculate that heart failure might be a major stimulant of myocardial cytokine expression, which then may contribute to further progression of heart failure. However, only dogs with endstage cardiac diseases and mRNA expression were investigated, which limits conclusions. The role of cytokine mRNA expression and protein production in the progression of diseases in dogs requires further investigation.
Under the influence of IFN-γ, there may have been a predominance of T-helper 1 cells in the CDDs in the present study, and that predominance may be antifibrogenic under the condition of inflammation.9 The different expressions of cytokines in the atria and ventricles comparing SDDs and CDDs were interesting. In the ventricles, expression of inflammatory and T-helper 1 cytokines was comparatively higher, whereas in the atria, there was a greater predominance of profibrotic TGF-β expression, which might indicate increased fibrosis of the atria and predisposition to atrial arrhythmias. However, further investigations, including immunohistochemical analysis of atrial and ventricular tissue samples to investigate protein expression, are needed to assess the role of cytokines and growth factors in progressive cardiac diseases in dogs.
Without doubt, better knowledge of cardiac involvement in SDDs is needed because this might affect morbidity and mortality rates. Furthermore, knowledge about the association of the inflammatory system and cardiac diseases will enhance understanding of disease progression in dogs and might lead to novel treatment approaches.
ABBREVIATIONS
| CDD | Cardiac disease–affected dog |
| GAPDH | Glyceraldehyde-3-phosphate dehydrogenase |
| GDF | Growth differentiation factor |
| IFN | Interferon |
| IL | Interleukin |
| SDD | Systemic disease–affected dog |
| TGF | Transforming growth factor |
| TNF | Tumor necrosis factor |
RNAlater, Ambion Ltd, Huntingdon, Cambridgeshire, England.
RNeasy Minikit, Qiagen Ltd, Crawley, West Sussex, England.
BLAST, National Center for Biotechnology Information, National Institutes of Health, Bethesda, Md. Available at: blast.ncbi.nlm.nih.gov/. Accessed May 20, 2009.
Eurogentec, Seraing, Belgium.
Sequence Detection Systems software, version 2.2.1, Applied Biosystems, Life Technologies Corp, Carlsbad, Calif.
Excel, Microsoft Corp, Redmond, Wash.
Minitab, version 16, Minitab Inc, State College, Pa.
References
1. Anker SD, von Haehling S. Inflammatory mediators in chronic heart failure: an overview. Heart 2004; 90: 464–470.
2. Chen D, Assad-Kottner C, Orrego C, et al. Cytokines and acute heart failure. Crit Care Med 2008; 36: S9–S16.
3. von Haehling S, Schefold JC, Lainscak M, et al. Inflammatory biomarkers in heart failure revisited: much more than innocent bystanders. Heart Fail Clin 2009; 5: 549–560.
4. Tamariz L, Hare JM. Inflammatory cytokines in heart failure: roles in aetiology and utility as biomarkers. Eur Heart J 2010; 31: 768–770.
5. Hedayat M, Mahmoudi MJ, Rose NR, et al. Proinflammatory cytokines in heart failure: double-edged swords. Heart Fail Rev 2010; 15: 543–562.
6. Siwik DA, Colucci WS. Regulation of matrix metalloproteinases by cytokines and reactive oxygen/nitrogen species in the myocardium. Heart Fail Rev 2004; 9: 43–51.
7. Castellano G, Affuso F, Di Conza P, et al. Myocarditis and dilated cardiomyopathy: possible connections and treatments. J Cardiovasc Med (Hagerstown) 2008; 9: 666–671.
8. Kaur K, Dhingra S, Slezak J, et al. Biology of TNFalpha and IL-10, and their imbalance in heart failure. Heart Fail Rev 2009; 14: 113–123.
9. Wei L. Immunological aspect of cardiac remodeling: T lymphocyte subsets in inflammation-mediated cardiac fibrosis. Exp Mol Pathol 2011; 90: 74–78.
10. Cheng X, Ding Y, Xia C, et al. Atorvastatin modulates Th1/Th2 response in patients with chronic heart failure. J Card Fail 2009; 15: 158–162.
11. Kvakan H, Kleinewietfeld M, Qadri F, et al. Regulatory T cells ameliorate angiotensin II-induced cardiac damage. Circulation 2009; 119: 2904–2912.
12. Kempf T, Wollert KC. Growth differentiation factor-15: a new biomarker in cardiovascular disease. Herz 2009; 34: 594–599.
13. Kempf T, von Haehling S, Peter T, et al. Prognostic utility of growth differentiation factor-15 in patients with chronic heart failure. J Am Coll Cardiol 2007; 50: 1054–1060.
14. Strickland KN. Pathophysiology and therapy of heart failure. In: Tilley LP, Smith FWK, Oyama MA, et al., eds. Manual of canine and feline cardiology. 4th ed. St Louis: Saunders Elsevier, 2008;288–314.
15. Fonfara S, Hetzel U, Tew S, et al. Leptin expression in dogs with cardiac disease and congestive heart failure. J Vet Intern Med 2011; 25: 1017–1024.
16. Clements DN, Carter SD, Innes JF, et al. Analysis of normal and osteoarthritic canine cartilage mRNA expression by quantitative polymerase chain reaction. Arthritis Res Ther 2006; 8: R158.
17. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(–Delta Delta C(T)) method. Methods 2001; 25: 402–408.
18. Fonfara S, Hetzel U, Tew S, et al. Expression of matrix metalloproteinases, their inhibitors, and lysyl oxidase in hearts from dogs with end-stage systemic and cardiac diseases. Am J Vet Res 2013; 74: 216–223.
19. Tidholm A, Jonsson L. Histologic characterization of canine dilated cardiomyopathy. Vet Pathol 2005; 42: 1–8.
20. Adamopoulos S, Kolokathis F, Gkouziouta A, et al. Cytokine gene polymorphisms are associated with markers of disease severity and prognosis in patients with idiopathic dilated cardiomyopathy. Cytokine 2011; 54: 68–73.
21. Aukrust P, Ueland T, Lien E, et al. Cytokine network in congestive heart failure secondary to ischemic or idiopathic dilated cardiomyopathy. Am J Cardiol 1999; 83: 376–382.
22. Kumar A, Paladugu B, Mensing J, et al. Nitric oxide-dependent and -independent mechanisms are involved in TNF-alpha–induced depression of cardiac myocyte contractility. Am J Physiol Regul Integr Comp Physiol 2007; 292: R1900–R1906.
23. Martin FL, McKie PM, Cataliotti A, et al. Experimental mild renal insufficiency mediates early cardiac apoptosis, fibrosis, and diastolic dysfunction: a kidney-heart connection. Am J Physiol Regul Integr Comp Physiol 2012; 302: R292–R299.
24. Kalogeropoulos A, Georgiopoulou V, Psaty BM, et al. Inflammatory markers and incident heart failure risk in older adults: the Health ABC (Health, Aging, and Body Composition) study. J Am Coll Cardiol 2010; 55: 2129–2137.
25. Yu Q, Horak K, Larson DF. Role of T lymphocytes in hypertension-induced cardiac extracellular matrix remodeling. Hypertension 2006; 48: 98–104.
26. Roncarolo MG, Gregori S, Battaglia M, et al. Interleukin-10-secreting type 1 regulatory T cells in rodents and humans. Immunol Rev 2006; 212: 28–50.
27. Krishnamurthy P, Rajasingh J, Lambers E, et al. IL-10 inhibits inflammation and attenuates left ventricular remodeling after myocardial infarction via activation of STAT3 and suppression of HuR. Circ Res 2009; 104: e9–e18.
28. Miettinen KH, Lassus J, Harjola VP, et al. Prognostic role of pro- and anti-inflammatory cytokines and their polymorphisms in acute decompensated heart failure. Eur J Heart Fail 2008; 10: 396–403.
29. Briest W, Homagk L, Rassler B, et al. Norepinephrine-induced changes in cardiac transforming growth factor-beta isoform expression pattern of female and male rats. Hypertension 2004; 44: 410–418.
30. Aupperle H, Marz I, Thielebein J, et al. Expression of transforming growth factor-beta1, -beta2 and -beta3 in normal and diseased canine mitral valves. J Comp Pathol 2008; 139: 97–107.
31. Lim H, Zhu YZ. Role of transforming growth factor-beta in the progression of heart failure. Cell Mol Life Sci 2006; 63: 2584–2596.
32. Shah S, Qiao L. Resting B cells expand a CD4+CD25+Foxp3+Treg population via TGF-beta3. Eur J Immunol 2008; 38: 2488–2498.
33. Li N, Bian H, Zhang J, et al. The Th17/Treg imbalance exists in patients with heart failure with normal ejection fraction and heart failure with reduced ejection fraction. Clin Chim Acta 2010; 411: 1963–1968.
34. Rosenkranz-Weiss P, Tomek RJ, Mathew J, et al. Gender-specific differences in expression of mRNAs for functional and structural proteins in rat ventricular myocardium. J Mol Cell Cardiol 1994; 26: 261–270.
35. Villari B, Campbell SE, Schneider J, et al. Sex-dependent differences in left ventricular function and structure in chronic pressure overload. Eur Heart J 1995; 16: 1410–1419.
36. Arshad A, Moss AJ, Foster E, et al. Cardiac resynchronization therapy is more effective in women than in men: the MADIT-CRT (Multicenter Automatic Defibrillator Implantation Trial with Cardiac Resynchronization Therapy) trial. J Am Coll Cardiol 2011; 57: 813–820.
37. Wess G, Schulze A, Butz V, et al. Prevalence of dilated cardiomyopathy in Doberman Pinschers in various age groups. J Vet Intern Med 2010; 24: 533–538.
38. Serfass P, Chetboul V, Sampedrano CC, et al. Retrospective study of 942 small-sized dogs: prevalence of left apical systolic heart murmur and left-sided heart failure, critical effects of breed and sex. J Vet Cardiol 2006; 8: 11–18.
39. Sivakumar P, Gupta S, Sarkar S, et al. Upregulation of lysyl oxidase and MMPs during cardiac remodeling in human dilated cardiomyopathy. Mol Cell Biochem 2008; 307: 169–167.
40. Brundel BJ, Melnyk P, Rivard L, et al. The pathology of atrial fibrillation in dogs. J Vet Cardiol 2005; 7: 121–129.
41. Khan R, Sheppard R. Fibrosis in heart disease: understanding the role of transforming growth factor-beta in cardiomyopathy, valvular disease and arrhythmia. Immunology 2006; 118: 10–24.
42. Hanna N, Cardin S, Leung TK, et al. Differences in atrial versus ventricular remodeling in dogs with ventricular tachypacing-induced congestive heart failure. Cardiovasc Res 2004; 63: 236–244.
43. Kim SK, Park JH, Kim JY, et al. High plasma concentrations of transforming growth factor-beta and tissue inhibitor of metalloproteinase-1. Circ J 2011; 75: 557–564.
44. Verheule S, Sato T, Everett T IV, et al. Increased vulnerability to atrial fibrillation in transgenic mice with selective atrial fibrosis caused by overexpression of TGF-beta1. Circ Res 2004; 94: 1458–1465.
45. Khan A, Moe GW, Nili N, et al. The cardiac atria are chambers of active remodeling and dynamic collagen turnover during evolving heart failure. J Am Coll Cardiol 2004; 43: 68–76.
