Recently, various types of stem cells have been used in spinal cord regenerative therapy. Several types of such stem cell–based therapies have involved the use of BMSCs for humans, dogs, and other animals because of the abundant availability of BMSCs from adult mammals.1–4 Bone marrow stromal cells are ideal for transplantation and spinal cord repair because they can be easily isolated, expanded in culture, and delivered.1 Bone marrow stromal cells are adherent cells found in cultures of bone marrow aspirates, but they are not hematopoietic cells.4 Bone marrow stromal cells are capable of differentiating into bone, cartilage, fat, and muscle tissues under specific experimental conditions.5–7
Results of some studies8,9 have suggested that BMSCs can differentiate into neurons, astrocytes, and oligodendrocytes. However, the evidence from these studies was inconclusive because their experimental design focused exclusively on the morphological and immunocytochemical properties of BMSC-derived neuron-like cells. For this reason, additional studies that use human or mouse BMSCs have been conducted to determine the mRNA expression levels of neuron markers and the electrophysiological functions of induced BMSCs.
To verify the possible neuronal differentiation of BMSCs, some previous studies5,7,10–16 have examined changes in the mRNA expression of neural stem or progenitor cell and neuron markers before and after the induction of BMSCs into neurons. Investigations that used human or rat BMSCs have demonstrated that mRNA for the neural stem or progenitor cell markers nestin (gene symbol, NES) and β III tubulin (gene symbol, TUBB3) is present in undifferentiated BMSCs, whereas mRNA for the neuron markers microtubule-associated protein 2 (gene symbol, MAP2), neurofilament-L (gene symbol, NEFL), neurofilament-M (gene symbol, NEFM), neurofilament-H (gene symbol, NEFH), and NSE (gene symbol, ENO2) is present in neuron-like cells induced from BMSCs.5,7,10–16
Furthermore, the electrophysiological function of BMSCs has been investigated, and several studies13,17,18 have found an increase in the mRNA expression levels of ion channel markers during the neuronal induction of BMSCs. The electrophysiological function of BMSCs after neuronal induction has been examined with calcium imaging and patch clamp recording; the results suggest that human, mouse, and rat BMSCs have the potential to differentiate into functional neurons.16,18
A recent clinical trial3 investigated spinal regenerative therapy with autologous BMSCs in dogs that had paraplegia and loss of nociception in the pelvic limbs. It was reported that 6 of 10 dogs in the transplantation group regained the ability to walk, whereas only 2 of 13 dogs in the control nontransplantation group regained the ability to walk. Furthermore, at the study endpoint, the Texas Spinal Cord Injury Scale scores (a means of assessment of gait, proprioceptive positioning, and nociception) for the transplantation group were significantly higher than those for the control group.3 Surprisingly, there are very few basic research reports19–21 on the neuronal differentiation of canine BMSCs, despite the application of canine BMSCs in veterinary medicine. Kamishina et al19 reported that canine BMSCs develop neuron-like morphological characteristics after induction with dibutyryl cAMP and methyl-isobutylxanthine. We previously reported that canine BMSCs had neuron-like morphology and microstructure and were positive for a neuron marker after chemical induction with β-mercaptoethanol and BHA.20 However, as suggested by Lu et al,22 the morphological and immunocytochemical changes observed with such methods may be artifacts and may not accurately represent the true potency of BMSCs. On the other hand, Ping et al23 reported that rat BMSCs induced into neurons with β-mercaptoethanol and BHA were properly epigenetically modified and safe for clinical use. These conflicting interpretations highlight the need for additional investigations of genetic or electrophysiological techniques to clearly understand the neuronal differentiation potency of canine BMSCs.20,21
To our knowledge, no study has been conducted to determine the mRNA expression levels and electrophysiological function of canine BMSCs that have been induced into neurons. The purpose of the study reported here was to use molecular biological and electrophysiological techniques to investigate the in vitro differentiation of canine BMSCs into functional, mature neurons.
Materials and Methods
Isolation and culture of canine BMSCs—The study involved 6 healthy Beagles and was conducted with the approval of the Nihon University Animal Care and Use Committee (AP12B015). Each dog was premedicated IV with midazolam hydrochloridea (0.2 mg/kg) and butorphanol tartrateb (0.2 mg/kg). Anesthesia was induced with an IV injection of propofolc (4.0 mg/kg) and maintained with 1.5% to 2.0% isofluraned in 100% oxygen supplied with an endotracheal tube. Before awakening from anesthesia, each dog received another dose of butorphanol tartrateb (0.2 mg/kg) IV for pain relief.
Canine BMSCs were isolated in accordance with a method established previously in our laboratory.20 Briefly, for each dog, 3 mL of canine bone marrow was aspirated from a humerus, and mononuclear cells were separated with density gradient media.e Following collection, the mononuclear cells were transferred to a 25-cm2 plastic culture flaskf and static-cultured in an incubator at 5% CO2 and 37°C with α-modified Eagle minimum essential mediumg and 10% fetal bovine serum.h On the fourth day of culture, nonadherent cells were removed when the culture medium was replaced, thereby isolating the canine BMSCs. Canine BMSCs were collected with 0.25% trypsin-EDTAi once they achieved approximately 90% confluency.
Neuronal induction of canine BMSCs—After the first passage, canine BMSCs were placed in a 25-cm2 plastic culture flask at a density of 4,000 cells/cm2. The BMSCs were then induced into neurons by use of the method described by Woodbury et al.24 Briefly, after 3 days of culture, the medium was changed to low-glucose DMEMj supplemented with 20% fetal bovine serum and 1mM β-mercaptoethanolk to induce the neuronal phenotype. After 24 hours of culturing in this medium, differentiation into neurons was induced by transferring the cells to low-glucose DMEM with 2% dimethyl sulfoxidel and 200μM BHA.m The morphology of these cells was evaluated under an inverted microscope at 2, 4, 6, and 12 hours after the BMSCs were placed in low-glucose DMEM with 2% dimethyl sulfoxide and 200μM BHA.
Immunocytochemical analysis—Canine BMSCs were seeded on 35-mm glass base dishesn and cultured for 3 days. After 12 hours of neuronal induction achieved by the method described, the cells were fixed with 4% paraformaldehydeo for 15 minutes and processed for immunocytochemical analysis to identify the neuronal differentiation stages. Fixed cells were permeabilized by incubation in 0.2% octylphenol ethylene oxidep for 15 minutes at room temperature (approx 22°C). Nonspecific antibody reactions were blocked with serum-free blocking solution.q The cells were then incubated for 3 hours at room temperature with primary antibodies, including mouse monoclonal antibodies against rat nestin (Rat-401)r to identify a neural stem or progenitor cell marker and mouse monoclonal antibodies against human NSE (clone No. BBS/NC/VI-H14)s and against human neurofilament-L protein (clone No. 2F11)t to identify neuron markers. After being washed with PBS solution, the cells were incubated and exposed to goat anti-mouse IgG–conjugated secondary antibodyu for 1 hour in darkness at room temperature. Cells were also incubated without primary antibodies to control for nonspecific staining by secondary antibodies. Samples of canine spinal cords from 3 adult Beagles that were euthanized for other studies were used as the positive control. These samples were washed 3 times with PBS solution, dried, mounted with antifade reagent,v and observed with a confocal laser scanning microscope.w
Real-time reverse transcription PCR assay—Total RNAs were extracted from canine BMSCs before and after 6 and 12 hours of neuronal induction by use of a total RNA extraction solution.x First-strand cDNA synthesis was performed with 500 ng of total RNA with the aid of a cDNA synthesis kit.y Real-time PCR assays were then performed with 2 μL of the first-strand synthesis in a total reaction volume of 20 μL; primers (Appendix) specific for canine neural stem or progenitor cell markers (NES, TUBB3, and SOX2), neuron markers (MAP2, NEFH, NEFL, NEFM, ENO2, and solute carrier family genes [gene symbols, SLC1A1, SLC2A3, and SLC2A12]), sodium ion channel markers (gene symbols, SCN1A, SCN2A, and SCN8A), a calcium ion channel marker (gene symbol, CACNA1C), and potassium ion channel markers (gene symbols, KCNC1 and KCNA2), and a 2× mix for real-time PCR applications.z The real-time PCR assays of no-template controls were performed with 2 μL of RNase and DNA-free water. In addition, the real-time PCR assays of no-reverse transcription controls were performed with 2 μL of each RNA sample. The PCR assays were conducted with a thermal cycler,aa as follows: denaturation at 95°C for 30 seconds, 40 cycles of primer annealing at 95°C for 5 seconds each, and primer extension at 60°C for 30 seconds. The specificity of each primer was verified by a dissociation curve analysis and the direct sequence of each PCR product. The results were analyzed by the second derivative method and the comparative cycle threshold (ΔΔCt) method with the aid of softwarebb for real-time PCR analysis. The amplification of glucuronidase β from the same amount of cDNA was used as an endogenous control, and the amplification of the control group was used as a calibrator sample.
Western blotting—Canine BMSCs before and after 2, 4, 6, and 12 hours of induction into neurons were lysed with a lysis buffer containing 100mM HEPES, 1mM phenylmethanesulfonyl fluoride, and complete mini EDTA-free protease inhibitor mixturecc at a pH of 7.4. Canine spinal cord lysate obtained by use of the same lysis solution was used as a positive control. Protein concentrations were adjusted in accordance with the method of Bradford.25 Extracted proteins were boiled at 95°C for 5 minutes in SDS buffer. Samples containing 5 μg of protein were loaded in each lane of 7.5% polyacrylamide geldd and separated through electrophoresis. Separated proteins were transferred to polyvinylidene difluoride membranes,ee treated with blocking solutionff for 50 minutes at room temperature, and incubated with the primary antibodies (antibodies against nestin [1:100],r neurofilament-L [1:100],gg NSE [1:200],s and β-actin [1:5,000]hh) for 120 minutes at room temperature. After washing, the membranes were incubated with horseradish peroxidase–conjugated anti-mouse IgG (1:10,000)ii for 90 minutes at room temperature. Immunoreactivity was detected with a western blotting detection reagent.jj The chemiluminescent signals of the membranes were measured, and densitometric analyses were performed with a chemiluminescent imager.kk
Ca2+ imaging—Canine BMSCs (4,000 cells/cm2) were seeded on 35-mm glass base dishes.j Before and after 12 hours of neuronal induction, the cells were incubated in 4.0μM fluorescent dyell to monitor Ca2+ influx for 30 minutes in the dark. Following incubation, the cells were washed twice in PBS solution. After washing, the culture medium was changed to Krebs-Ringer-HEPES and bovine serum albumin solution (containing 120mM NaCl, 5mM KCl, 0.96mM NaH2PO4, 1mM MgCl2, 11.1mM glucose, 1mM CaCl2, bovine serum albumin [1 mg/mL], and 10mM HEPES; pH, 7.4). The glass base dishes with fluorescent dye–loaded cells were placed at room temperature on the confocal laser scanning microscopy stage.mm Fluorescence of the fluorescent dyell was produced by excitation from a 75-W xenon arc lamp with appropriate filter sets (excitation, 488 nm; emission, 527 nm). Each frame in a time-lapse sequence was captured every 2 seconds. After baseline images were acquired, the cells were stimulated with KCl (50mM). The relative changes in intracellular Ca2+ concentrations over time were expressed as relative change in baseline fluorescence. Cultured canine neurons derived from 3 adult Beagles that were euthanized for other studies were used as positive controls.
Data analysis—The data are reported as mean ± SE. Statistical analyses were performed with a data analysis software package.nn A 2-way ANOVA was performed for comparisons among data obtained before and after 6 and 12 hours of the neuronal induction. A 1-way ANOVA was performed for comparisons between data for canine BMSCs and data for canine spinal cord samples. A Tukey test was used as the post hoc test, and values of P < 0.05 were considered significant.
Results
Culture of canine BMSCs and neuronal induction—Before induction, canine BMSCs had fibroblast-like spindle shape morphology (Figure 1). They started to develop neuron-like morphology within 2 hours after the BMSCs were placed in low-glucose DMEM with 2% dimethyl sulfoxide and 200μM BHA, and their morphology continued to change from 2 to 6 hours after the start of induction in a time-dependent manner. However, these changes in morphology ceased by 6 to 12 hours after the start of induction. At 12 hours after the start of induction, the cells had round cell bodies and several long, sharp processes resembling dendrites and axons (Figure 1). Some canine BMSCs detached from the culture flask after 12 hours of induction. There was no difference in neuronal differentiation of canine BMSCs among the 6 dogs.
Photomicrographs to illustrate the morphology (A and B) and immunocytochemical staining patterns (C through F) of canine BMSCs before (A, C, and E) and after (B, D, and F) neuronal induction. A large number of canine BMSCs developed neuron-like morphology with multipolar, rounded cell bodies and long, sharp processes after induction (B). Immunohistochemical staining yielded positive results for NSE (D) and neurofilament-L (F) in almost all neuron-like cells. Bar = 60 μm (A) or 30 μm (B, C, D, E, and F)
Citation: American Journal of Veterinary Research 74, 10; 10.2460/ajvr.74.10.1311
Immunocytochemical analysis—Almost all canine BMSCs that developed to neuron-like morphology were positive for nestin. In addition, all neuron-like cells derived from canine BMSCs were positive for the neuron markers NSE and neurofilament-L (Figure 1). Strong staining for NSE was evident in cell bodies, whereas neurofilament-L was localized in the cytoplasm, especially at the extremities of the dendrites and axons.
mRNA expression levels of markers for neural stem or progenitor cells, neurons, and ion channels—During the induction of canine BMSCs, mRNA expression levels of neural stem or progenitor cell markers such as SOX2, NES, and TUBB3 decreased significantly in a time-dependent manner (Figure 2). In contrast, the mRNA expression levels of neuron markers increased after canine BMSCs were induced into neurons (Figure 3). The mRNA expression levels of MAP2, NEFH, NEFL, SLC1A1, and SLC2A3 increased significantly as canine BMSCs were induced into neurons, whereas the mRNA expression levels of the neuron markers NEFM, ENO2, and SLC2A12 increased slightly. The mRNA expression levels of NEFH, NEFL, NEFM, ENO2, and SLC1A1 increased until 6 hours of induction but generally decreased thereafter.
Results (mean ± SE) of quantitative analysis of mRNA expression levels of neural stem or progenitor cell markers (SOX2, nestin [NES], and β III tubulin [TUBB3]) in BMSCs (obtained from 6 dogs) before neuronal induction (BNI) and at 6 and 12 hours after commencement of neuronal induction. The mRNA expression level of each evaluated marker decreased significantly after neuronal induction. *Difference between the BNI value and the other value within the bracket is significant (P < 0.001).
Citation: American Journal of Veterinary Research 74, 10; 10.2460/ajvr.74.10.1311
The mRNA expression levels of the sodium ion channel markers SCN1A and SCN2A significantly increased after the induction (Figure 4). However, levels of SCN8A mRNA expression did not change significantly. The mRNA expression levels of CACNA1G (a calcium ion channel marker) increased significantly during the neuronal induction of canine BMSCs. The mRNA expression levels of the potassium ion channel marker KCNA2 did not significantly change as a result of neuronal induction, and no fluorescent signals of KCNC1 were observed before or after neuronal induction.
The mRNA expression levels for almost all neuron markers and several ion channel markers increased after the induction of BMSCs (Figures 3 and 4). The mRNA expression levels of SCN2A and CACNA1G in canine BMSCs after their neuronal induction were equivalent to those in canine spinal cord samples (Figure 4), whereas expressions of other markers did not reach levels comparable to those found in canine spinal cord samples.
Results (mean ± SE) of quantitative analysis of mRNA expression levels of neuron markers (microtubule-associated protein 2 [MAP2], neurofilament-H [NEFH], neurofilament-L [NEFL], neurofilament-M [NEFM], NSE [ENO2], and solute carrier genes [SLC1A1, SLC2A3, and SLC2A12]) in BMSCs (obtained from 6 dogs) BNI and at 6 and 12 hours after commencement of neuronal induction and in spinal cord samples obtained from 3 adult Beagles that were euthanized for other studies. All markers increased after neuronal induction. However, the mRNA expression levels of neuron markers in BMSCs did not reach those found in canine spinal cord samples. †Significant (P < 0.01) difference between bracketed values. ‡Significant (P < 0.05) difference between bracketed values. See Figure 2 for remainder of key.
Citation: American Journal of Veterinary Research 74, 10; 10.2460/ajvr.74.10.1311
Results (mean ± SE) of quantitative analysis of mRNA expression levels of sodium ion channel markers [SCN1A, SCN2A, and SCN8A]; the calcium ion channel marker [CACNA1G]; and potassium ion channel markers [KCNA2 and KCNC1] in BMSCs (obtained from 6 dogs) BNI and at 6 and 12 hours after commencement of neuronal induction and in spinal cord samples obtained from 3 adult Beagles that were euthanized for other studies. The mRNA expression levels of SCN1A, SCN2A, and CACNA1G increased significantly after neuronal induction. However, expression levels of the other markers did not change significantly after induction. The mRNA expression levels of SCN2A and CACNA1G in canine BMSCs after neuronal induction were equivalent to those in canine spinal cord samples. See Figures 2 and 3 for remainder of key.
Citation: American Journal of Veterinary Research 74, 10; 10.2460/ajvr.74.10.1311
Western blotting—Protein expression levels for nestin, neurofilament-L, and NSE increased after the induction (Figure 5). Nestin and neurofilament-L expression levels increased significantly until 4 hours after the neuronal induction and then decreased. Neuron-specific enolase protein expression increased, albeit not significantly.
Results of western blotting (A) to illustrate protein expression levels of nestin (first row), neurofilament-L (second row), NSE (third row), and β-actin (fourth row) and relative protein expression rates (chemiluminescent intensity) of nestin (B), neurofilament-L (C), and NSE (D) in BMSCs (obtained from 6 dogs) BNI and at 2, 4, 6, and 12 hours after commencement of neuronal induction. Western blotting included samples of spinal cord obtained from 3 adult Beagles that were euthanized for other studies. The expression of these proteins generally increased after neuronal induction. See Figure 3 for remainder of key.
Citation: American Journal of Veterinary Research 74, 10; 10.2460/ajvr.74.10.1311
Ca2+ influx—Before neuronal induction, intracellular Ca2+ concentration in canine BMSCs did not increase in response to KCl stimulation. Similarly, after neuronal induction, intracellular Ca2+ concentration in canine BMSCs did not increase in response to KCl stimulation (Figure 6).
Intracellular Ca2+ concentrations determined with confocal laser scanning microscopy and a 75-W xenon arc lamp with appropriate filter sets (excitation, 488 nm; emission, 527 nm) in BMSCs (obtained from 6 dogs) before (A) and after (B) neuronal induction and in cultured canine neurons (C; positive control) obtained from 3 adult Beagles that were euthanized for other studies. After baseline data were acquired, the cells were stimulated (0 seconds) with KCl (50mM). The relative changes in intracellular Ca2+ concentrations over time were calculated as fluorescence at a given time point divided by baseline fluorescence (F/F0). Canine BMSCs did not respond to stimulation with 50mM KCl before or after neuronal induction.
Citation: American Journal of Veterinary Research 74, 10; 10.2460/ajvr.74.10.1311
Discussion
Various types of neuronal differentiation media for BMSCs have been described. Treatment with 2% dimethyl sulfoxide and 200μM BHA is reportedly most effective for neuronal induction of human and rat BMSCs.20 Therefore, we used media with these constituents to differentiate canine BMSCs into neurons.24
In the present study, a large number of canine BMSCs developed neuron-like morphology in a time-dependent manner after chemical induction of neuronal differentiation. Furthermore, immunocytochemical analysis revealed that nearly all neuron-like cells derived from canine BMSCs were positive for neuron markers. These findings are consistent with those of previous studies16,20,21,24 involving dogs and other animals. Importantly, we observed significant changes in mRNA and protein expression of some neural stem or progenitor cell, neuron, and ion channel markers. However, intracellular Ca2+ concentrations in these cells did not increase in response to stimulation with KCl.
Changes in the mRNA expression levels of neuron markers in BMSCs that have differentiated into neurons have been quantitatively investigated by means of real-time PCR assay in several non–dog animal species.13–15,26,27 However, those studies investigated only a small number of markers and did not examine the time-dependent changes in expression levels. Therefore, in the present study, we quantitatively evaluated the time-dependent changes of 17 markers after the neuronal induction of canine BMSCs.
The mRNA expression levels of all evaluated neural stem or progenitor cell markers significantly decreased during the neuronal induction of canine BMSCs in the present study. Previous studies in humans13 and chickens28 have revealed decreases in mRNA expression levels for SOX2 and NES in association with neuron maturation. The findings of the present study have suggested that neural stem or progenitor cell–specific mRNA expression is inhibited during the neuronal induction of canine BMSCs, as in previous studies.13,28 Furthermore, mRNA expression levels for all evaluated neuron-specific markers increased during the neuronal induction of canine BMSCs. Specifically, significant increases were observed in the mRNA expression level of MAP2 (as determined in a previous study13), NEFL, NEFH, SLC1A1, and SLC2A3. To our knowledge, the present study is the first in which such changes in canine BMSCs have been identified.
To confirm whether the observed increases in the mRNA expression levels of neuron markers were associated with concomitant changes in protein expression, we performed western blotting for determining protein expression levels of neuron markers. Results of another study29 indicated that the protein expression level of nestin temporarily increases during the neuronal differentiation of human BMSCs. A similar pattern of change was evident during the neuronal induction of canine BMSCs in the present study. The expression levels of neurofilament-L and NSE proteins were found to increase in human BMSCs that differentiated into neurons.26 Similarly, in the present study, the protein expression of neurofilament-L increased significantly and the protein expression of NSE appeared to increase (albeit not significantly) after the neuronal induction of canine BMSCs.
Furthermore, the mRNA expression levels of sodium ion channel markers SCN1A and SCN2A and a calcium ion channel marker CACNA1G significantly increased during the neuronal induction of canine BMSCs in the present study. Together, these results suggested that chemical induction with β-mercaptoethanol and BHA could enhance the mRNA expression of both neuron and ion channel markers and could induce canine BMSCs into a neuronal lineage.
In addition, we also investigated the electrophysiological function of the neuron-like cells derived from canine BMSCs to determine whether canine BMSCs can differentiate into functional, mature neurons. If canine BMSCs are able to differentiate into functional and mature neurons, these cells may be able to integrate into preexisting neural circuits and be used in regenerative therapies for neurologic disorders in dogs. However, in the present study, exposure of the neuron-like cells derived from canine BMSCs to 50mM KCl did not result in an increase in intracellular calcium concentration, indicating the absence of a typical neuronal response.
The protocol used in the present study was probably insufficient to induce development of canine BMSCs into functional neurons.20 The study data indicated that the mRNA expression levels of some neuron and ion channel markers did not reach levels comparable to those found in canine spinal cord samples, which may have hindered the normal ion channel kinetics required for generating action potentials. Unfortunately, a large number of canine BMSCs detached from the culture flask within 6 to 12 hours after the start of neuronal induction in the present study, an occurrence that has been observed in previous studies.19,20 Tondreau et al15 reported that neuronal differentiation of human BMSCs requires cascades of transcriptional events that do not occur within a few hours. A protocol of longer duration might be more successful in inducing canine BMSCs into functional neurons. Lu et al22 reported that the combination of β-mercaptoethanol with BHA may have cytotoxic effects on BMSCs and may induce apoptosis. The results of the present study suggested the possibility that the cellular damage caused by these chemical compounds may interfere in electrophysiological function of the canine BMSCs. In addition, other factors or supplements may be needed for canine BMSCs to differentiate into functional neurons. Other researchers have succeeded in differentiating human and mouse BMSCs into functional, mature neurons with basic fibroblast growth factor or brain-derived neurotrophic factor.16,30 For canine BMSCs, it seems probable that protocols that involve the use of such growth factors and that can maintain cell viability for longer durations are needed. Longer durations of cell viability will be necessary to confirm whether canine BMSCs can differentiate into fully functional, mature neurons.
The results of the present study indicated that canine BMSCs develop neuron-like morphology and are positive for neuron markers following chemical induction with β-mercaptoethanol and BHA. In addition, the mRNA and protein expression levels of some neuron and ion channel markers increased after the neuronal induction of canine BMSCs. However, the mRNA expression levels of almost all the neuron and ion channel markers in canine BMSCs after neuronal induction in the present study were lower than levels in canine spinal cord samples, and the neuron-like cells induced from canine BMSCs had no electrophysiological function. Further investigations with improved neuronal induction methods are necessary to confirm whether canine BMSCs have the ability to differentiate into fully functional, mature neurons.
ABBREVIATIONS
| BHA | Butylated hydroxyanisole |
| BMSC | Bone marrow stromal cell |
| DMEM | Dulbecco modified Eagle medium |
| NSE | Neuron-specific enolase |
| SOX2 | Sex-determining region Y-box 2 |
Midazolam hydrochloride, Astellas Pharma Inc, Tokyo, Japan.
Butorphanol tartrate, Meiji Seika Pharma Co Ltd, Tokyo, Japan.
Propofol, Schering-Plough Co, Osaka, Japan.
Isoflurane, Intervet KK, Osaka, Japan.
Histopaque-1077, Sigma-Aldrich Inc, St Louis, Mo.
25-cm2 plastic culture flask, Corning Life Sciences Inc, Lowell, Mass.
α-Modified Eagle minimum essential medium, Invitrogen Co, Carlsbad, Calif.
Fetal bovine serum, Invitrogen Co, Carlsbad, Calif.
Trypsin-EDTA, Invitrogen Co, Carlsbad, Calif.
DMEM-LG, Invitrogen Co, Carlsbad, Calif.
BME, Sigma-Aldrich Inc, St Louis, Mo.
Dimethylsulfoxide, Sigma-Aldrich Inc, St Louis, Mo.
BHA, Sigma-Aldrich Inc, St Louis, Mo.
35-mm Glass base dish, Iwaki Co Ltd, Tokyo, Japan.
Paraformaldehyde, Nacalai Tesque Inc, Kyoto, Japan.
Triton X-100, Sigma-Aldrich Inc, St Louis, Mo.
Serum-free blocking solution, DAKO North America Inc, Carpinteria, Calif.
Anti-rat nestin mouse monoclonal IgG1 antibody, Santa Cruz Biotechnology Inc, Santa Cruz, Calif.
Anti-human NSE mouse monoclonal antibody, DAKO North America Inc, Carpinteria, Calif.
Anti-human NF protein mouse monoclonal antibody, DAKO North America Inc, Carpinteria, Calif.
Alexa fluor 594 F (ab')2 fragments of goat anti-mouse IgG (H+L), Invitrogen Co, Carlsbad, Calif.
ProLong Gold Antifade Reagent, Invitrogen Co, Carlsbad, Calif.
FV1000D IX81, Olympus Co, Tokyo, Japan.
TRIzol, Invitrogen Co, Carlsbad, Calif.
PrimeScript RT Master Mix, TaKaRa Bio Inc, Shiga, Japan.
SYBR Premix Ex Taq II, TaKaRa Bio Inc, Shiga, Japan.
Thermal Cycler Dice Real Time System II, TaKaRa Bio Inc, Shiga, Japan.
TP900 DiceRealTime, version 4.02B, TaKaRa Bio Inc, Shiga, Japan.
Complete Mini EDTA-free, Roche Pharma AG, Mannheim, Germany.
Mini-PROTEAN TGX gel, Bio-Rad Laboratories Inc, Hercules, Calif.
Immobilon-P Transfer Membranes, Merck Millipore, Billerica, Mass.
Block Ace, DS Pharma Biomedical Co Ltd, Osaka, Japan.
Anti-human NF protein mouse monoclonal antibody, Thermo Fisher Scientific Inc, Rockford, Ill.
Anti-β-actin mouse monoclonal antibody, Sigma-Aldrich Inc, St Louis, Mo.
Horseradish peroxidase–conjugated secondary anti mouse IgG, GE Healthcare, Piscataway, NJ.
ECL plus Western blotting Analysis System, GE Healthcare, Piscataway, NJ.
ImageQuant LAS 4000 mini, GE Healthcare, Piscataway, NJ.
Fluo3-AM, Dojindo Laboratories, Kumamoto, Japan.
LSM-510, Carl Zeiss AG, Oberkochen, Germany.
StatMate IV, ATMS, Tokyo, Japan.
References
1. Jung DI, Ha J, Kang BT, et al. A comparison of autologous and allogenic bone marrow–derived mesenchymal stem cell transplantation in canine spinal cord injury. J Neurol Sci 2009; 285:67–77.
2. Lee JB, Kuroda S, Schinohe H, et al. A pre-clinical assessment model of rat autogeneic bone marrow stromal cell transplantation into the central nervous system. Brain Res Brain Res Protoc 2004; 14:37–44.
3. Nishida H, Nakayama M, Tanaka H, et al. Evaluation of transplantation of autologous bone marrow stromal cells into cerebrospinal fluid for treatment of chronic spinal cord injury in dogs. Am J Vet Res 2011; 72:1118–1123.
4. Ohta M, Suzuki Y, Noda T, et al. Bone marrow stromal cells infused into the cerebrospinal fluid promotes functional recovery of the injured rat spinal cord with reduced cavity formation. Exp Neurol 2004; 187:266–278.
5. Bae KS, Park JB, Kim HS, et al. Neuron-like differentiation of bone marrow–derived mesenchymal stem cells. Yonsei Med J 2011; 52:401–412.
6. Kadiyala S, Young RG, Thiede MA, et al. Culture expanded canine mesenchymal stem cells possess osteochondrogenic potential in vivo and in vitro. Cell Transplant 1997; 6:125–134.
7. Montzka K, Lassonczyk N, Tschoke B, et al. Neural differentiation potential of human bone marrow–derived mesenchymal stromal cells: misleading marker gene expression. BMC Neurosci 2009; 10:16–27.
8. Bahat-Stroomza M, Barhum Y, Levy YS, et al. Induction of adult human bone marrow mesenchymal stromal cells into functional astrocyte-like cells: potential for restorative treatment in Parkinson's disease. J Mol Neurosci 2009; 39:199–210.
9. Kaka GR, Tiraihi T, Delshad A, et al. In vitro differentiation of bone marrow stromal cells into oligodendrocyte-like cells using triiodothronine as inducer. Int J Neurosci 2012; 122:237–247.
10. Dezawa M, Kanno H, Hoshino M, et al. Specific induction of neuronal cells from bone marrow stromal cells and application for autologous transplantation. J Clin Invest 2004; 113:1701–1710.
11. Kim S, Honmou O, Kato K, et al. Neural differentiation potential of peripheral blood- and bone marrow–derived precursor cells. Brain Res 2006; 1123:27–33.
12. Lei Z, Yongda L, Jun M, et al. Culture and neural differentiation of rat bone marrow mesenchymal stem cells in vitro. Cell Biol Int 2007; 31:916–923.
13. Mareschi K, Novara M, Rustichelli D, et al. Neural differentiation of human mesenchymal stem cells: evidence for expression of neural markers and eag K+ channel types. Exp Hematol 2006; 34:1563–1572.
14. Neuhuber B, Gallo G, Howard L, et al. Reevaluation of in vitro differentiation protocols for bone marrow stromal cells: disruption of actin cytoskeleton induces rapid morphological changes and mimics neuronal phenotype. J Neurosci Res 2004; 77:192–204.
15. Tondreau T, Dejeneffe M, Meuleman N, et al. Gene expression pattern of functional neuronal cells derived from human bone marrow mesenchymal stromal cells. BMC Genomics 2008; 9:166–176.
16. Tropel P, Platet N, Platel JC, et al. Functional neuronal differentiation of bone marrow–derived mesenchymal stem cells. Stem Cells 2006; 24:2868–2876.
17. Sun W, Buzanska L, Domanska-janik K, et al. Voltage-sensitive and ligand-gated channels in differentiating neural stem–like cells derived from the nonhematopoietic fraction of human umbilical cord blood. Stem Cells 2005; 23:931–945.
18. Zeng R, Hu ZB, Guo WT, et al. Electrophysiological study on differentiation of rat bone marrow stromal stem cells into neuron-like cells in vitro by edaravone. Chin J Traumatol 2009; 12:167–172.
19. Kamishina H, Deng J, Oji T, et al. Expression of neural markers on bone marrow–derived canine mesenchymal stem cells. Am J Vet Res 2006; 67:1921–1928.
20. Edamura K, Kuriyama K, Kato K, et al. Proliferation capacity, neuronal differentiation potency and microstructures after the differentiation of canine bone marrow stromal cells into neurons. J Vet Med Sci 2012; 74:923–927.
21. Ryu HH, Kang BJ, Park SS, et al. Comparison of mesenchymal stem cells derived from fat, bone marrow, Wharton's jelly, and umbilical cord blood for treating spinal cord injuries in dogs. J Vet Med Sci 2012; 74:1617–1630.
22. Lu P, Blesch A, Tsuzynski MH, et al. Induction of bone marrow stromal cells to neurons: differentiation, transdifferentiation, or artifact? J Neurosci Res 2004; 77:174–191.
23. Ping D, Ying Z, Xufei H, et al. Effect of neuronal induction on NSE, Tau, and Oct4 promoter methylation in bone marrow mesenchymal stem cells. In Vitro Cell Dev Biol 2012; 48:251–258.
24. Woodbury D, Schwarz EJ, Prockop DJ, et al. Adult rat and human bone marrow stromal cells differentiate into neurons. J Neurosci Res 2000; 61:364–370.
25. Bradford MM. A rapid and sensitive method for the quantification of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 1976; 72:248–254.
26. Suon S, Jin H, Donaldson AE, et al. Transient differentiation of adult human bone marrow cells into neuron-like cells in culture: development of morphological and biochemical traits in mediated by different molecular. Stem Cells Dev 2004; 13:625–635.
27. Wislet-Gendebien S, Hans G, Leprince P, et al. Plasticity of cultured mesenchymal stem cells: switch from nestin-positive to excitable neuron-like phenotype. Stem Cells 2005; 23:392–402.
28. Uwanogho D, Rex M, Cartwright EJ, et al. Embryonic expression of the chicken sox2, sox3 and sox11 genes suggests an interactive role in neuronal development. Mech Dev 1995; 49:23–36.
29. Choi CB, Cho YK, Prakash KV, et al. Analysis of neuron-like differentiation of human bone marrow mesenchymal stem cells. Biochem Biophys Res Commun 2006; 350:138–146.
30. Trzaska KA, King CC, Li KY, et al. Brain-derived neurotrophic factor facilities maturation of mesenchymal stem cell-derived dopamine progenitors to functional neurons. J Neurochem 2009; 110:1058–1069.
Appendix
Primers specific for canine neural stem or progenitor cell, neuron, and ion channel markers.
| Gene symbol | Protein | Sequence | Marker |
|---|---|---|---|
| GUSB | Glucuronidase β | F: ACATCGACGACATCACCGTCA | Housekeeping gene |
| R: GGAAGTGTTCACTGCCCTGGA | |||
| SOX2 | Transcription factor SOX2 | F: ATGCACCGCTACGACGTGA | Neural stem or progenitor cell |
| R: TGCTGCGAGTAGGACATGCTG | |||
| NES | Nestin | F: GGACGGGCTTGGTGTCAATAG | Neural stem or progenitor cell |
| R: AGACTGCTGCAGCCCATTCA | |||
| TUBB3 | β III tubulin | F: TACAACGCCACGCTGTCCA | Neural stem or progenitor cell |
| R: CTTGAGAGTGCGGAAGCAGATG | |||
| MAP2 | Microtubule-associated | F:AAGCATCAACCTGCTCGAATCC | Neuron |
| protein 2 | R: GCTTAGCGAGTGCAGCAGTGAC | ||
| NEFH | Neurofilament heavy chain | F: GGAGGTTCCTGCCAAGGTGA | Neuron |
| R: CTCTGCTGCTTTGCTGGGTTC | |||
| NEFL | Neurofilament light chain | F: TGAATATCATGGGCAGAAGTGGAA | Neuron |
| R: GGTCAGGATTGCAGGCAACA | |||
| NEFM | Neurofilament medium chain | F: CTTAAGCCCAGCCGATGAA | Neuron |
| R: TGAGTGACGGTTACAGATTTAGTGA | |||
| ENO2 | Neuron specific enolase | F: GCATCCAGGCAGAGCAATCA | Neuron |
| R: AATGGGTGGATGCAGCACAA | |||
| SLC1A1 | Glutamate transporter | F: CATGTTGTCTGATTGTTCCACGTC | Neuron |
| R: AATGGTGATGCCACCTTGGAG | |||
| SLC2A3 | Glucose transporter 3 | F: CTTCAGATCGCGCAGCTACC | Neuron |
| R: TGCATCTTTGAAGATTCCTGTTGAG | |||
| SLC2A12 | Glucose transporter 12 | F: TTGTCAAGGTCATCAGCACCATC | Neuron |
| R: AATGAAGCCGCCATCACAGAG | |||
| SCN1A | Nav 1.1 | F: CTGAGCGAGGATGACTTTGAGATG | Sodium ion channel α subunit |
| R: TCGGTTGTGGCAAATTGAGTG | |||
| SCN2A | Nav 1.2 | F: TGGTCATGTTCATCTACGCCATC | Sodium ion channel α subunit |
| R: TCATGCTGTTGCCAAAGGTCTC | |||
| SCN8A | Nav 1.6 | F: GTCTGATCAAAGGCGCCAAAG | Sodium ion channel α subunit |
| R: GCGAAATTGGACATCCCAAAG | |||
| CACNA1C | Cav 1.2 | F: GCTGTGTCTGCTGCCTCTGAA | Calcium ion channel α subunit |
| R: GTCGCTTTGGTAGTAGCTGACGTG | |||
| KCNC1 | Kv 1.2 | F: ACACCACAGTACTCAGAGTGACACA | Potassium ion channel α subunit |
| R: AGGAGTGAGGGCCTGGTCTA | |||
| KCNA2 | Kv 3.1 | F: CCTGATCTCGATTGTGAGCTTCTG | Potassium ion channel α subunit |
| R: TGGTACCCGATTGTGCTGTTG |
F = Forward. R = Reverse.
