Expression of interleukin-1β, interleukin-8, and interferon-γ in blood samples obtained from healthy and sick neonatal foals

Carolina Castagnetti Department of Veterinary Medical Sciences, Faculty of Veterinary Medicine, University of Bologna, 40064 Ozzano Emilia, Bologna, Italy.

Search for other papers by Carolina Castagnetti in
Current site
Google Scholar
PubMed
Close
 DVM, PhD
,
Jole Mariella Department of Veterinary Medical Sciences, Faculty of Veterinary Medicine, University of Bologna, 40064 Ozzano Emilia, Bologna, Italy.

Search for other papers by Jole Mariella in
Current site
Google Scholar
PubMed
Close
 DVM, PhD
,
Alessandro Pirrone Department of Veterinary Medical Sciences, Faculty of Veterinary Medicine, University of Bologna, 40064 Ozzano Emilia, Bologna, Italy.

Search for other papers by Alessandro Pirrone in
Current site
Google Scholar
PubMed
Close
 DVM, PhD
,
Stefano Cinotti Department of Veterinary Medical Sciences, Faculty of Veterinary Medicine, University of Bologna, 40064 Ozzano Emilia, Bologna, Italy.

Search for other papers by Stefano Cinotti in
Current site
Google Scholar
PubMed
Close
 DVM
,
Gaetano Mari Department of Veterinary Medical Sciences, Faculty of Veterinary Medicine, University of Bologna, 40064 Ozzano Emilia, Bologna, Italy.

Search for other papers by Gaetano Mari in
Current site
Google Scholar
PubMed
Close
 DVM
, and
Angelo Peli Department of Veterinary Medical Sciences, Faculty of Veterinary Medicine, University of Bologna, 40064 Ozzano Emilia, Bologna, Italy.

Search for other papers by Angelo Peli in
Current site
Google Scholar
PubMed
Close
 DVM, PhD
Full access

Abstract

Objective—To evaluate and compare the gene expression of interleukin(IL)-1β, IL-8, and interferon-γ during the first 72 hours after birth in healthy foals and during the first 72 hours after hospitalization in sick neonatal foals and investigate correlations of clinicopathologic variables with cytokine expressions in healthy and sick neonatal foals.

Animals—33 foals < 7 days old (10 healthy foals, 7 foals with sepsis, 6 foals with peripartum asphyxia syndrome, and 12 foals with other diseases [2 with failure of passive transfer of immunity only were not further evaluated]).

Procedures—A blood sample (15 mL) was collected from each foal immediately after birth or hospital admission (0 hours) and at 24 and 72 hours later. Clinicopathologic variables were evaluated, and cytokine gene expression in WBCs was measured with an absolute quantitative real-time reverse transcriptase PCR assay.

Results—At all time points, gene expression of interferon-γ was low in all groups. No time-dependent changes in cytokine expressions were detected in healthy or sick foals. Foals with sepsis had significantly higher IL-1β gene expression than did healthy foals, foals with peripartum asphyxia syndrome, or foals with other diseases. At 0 hours, IL-1β expression was correlated with plasma fibrinogen concentration in healthy foals and with the neutrophil-to-lymphocyte ratio in foals with sepsis; IL-8 expression was correlated with monocyte count in foals with sepsis and with arterial pH, plasma fibrinogen concentration, and plasma lactate concentration in foals with peripartum asphyxia syndrome.

Conclusions and Clinical Relevance—Data have suggested that evaluation of IL-1β expression in sick neonatal foals could help identify those with sepsis.

Abstract

Objective—To evaluate and compare the gene expression of interleukin(IL)-1β, IL-8, and interferon-γ during the first 72 hours after birth in healthy foals and during the first 72 hours after hospitalization in sick neonatal foals and investigate correlations of clinicopathologic variables with cytokine expressions in healthy and sick neonatal foals.

Animals—33 foals < 7 days old (10 healthy foals, 7 foals with sepsis, 6 foals with peripartum asphyxia syndrome, and 12 foals with other diseases [2 with failure of passive transfer of immunity only were not further evaluated]).

Procedures—A blood sample (15 mL) was collected from each foal immediately after birth or hospital admission (0 hours) and at 24 and 72 hours later. Clinicopathologic variables were evaluated, and cytokine gene expression in WBCs was measured with an absolute quantitative real-time reverse transcriptase PCR assay.

Results—At all time points, gene expression of interferon-γ was low in all groups. No time-dependent changes in cytokine expressions were detected in healthy or sick foals. Foals with sepsis had significantly higher IL-1β gene expression than did healthy foals, foals with peripartum asphyxia syndrome, or foals with other diseases. At 0 hours, IL-1β expression was correlated with plasma fibrinogen concentration in healthy foals and with the neutrophil-to-lymphocyte ratio in foals with sepsis; IL-8 expression was correlated with monocyte count in foals with sepsis and with arterial pH, plasma fibrinogen concentration, and plasma lactate concentration in foals with peripartum asphyxia syndrome.

Conclusions and Clinical Relevance—Data have suggested that evaluation of IL-1β expression in sick neonatal foals could help identify those with sepsis.

It is well-known that perinatal infections and PAS are the major causes of morbidity among equine neonates. An in-depth understanding of the pathophysiology of these diseases could help generate new diagnostic and prognostic tools that would have a major impact on equine medicine.

Cytokines are endogenous inflammatory mediators and integral components of the adaptive and innate immune responses. They may be classified as proinflammatory (eg, IFN-γ, TNF, IL-1, IL-2, IL-6, and IL-8) or anti-inflammatory (eg, IL-4, IL-5, IL-10, IL-11, IL-13, and TGF-β). The balance between pro- and anti-inflammatory cytokines is critical to allow the reestablishment of homeostasis after an inflammatory insult. Proinflammatory cytokines mainly have host-protective actions, but accentuation of their normal protective functions may lead to damaging effects on the integrity of the host organism. Ultimately, the deleterious events resulting from the derangement of the normal function of the cytokine network may lead to shock, multiorgan failure, and death.1,2

In adult horses, as in other species, TNF-α is involved in early stages of inflammation and is responsible for the induction of IL-1.3 A marked increase in serum TNF-α activity seems to be associated with higher mortality rate in some clinical colic cases.4 Serum activity of IL-6 increases in horses after experimental infusion of lipopolysaccharide5,6; increases in the blood or peritoneal fluid during acute abdominal disease have also been detected.7 In the latter study,7 high IL-6 activity in serum or peritoneal fluid was correlated with mortality rate, whereas high serum TNF activity was not correlated.

Previous clinical studies of cytokines in neonatal foals have revealed that serum TNF activity is correlated with clinical criteria of sepsis and disease severity8 and that IL-6 and TNF-α concentrations increase in foals that receive an infusion of lipopolysaccharide.9,10 Boyd et al11 studied the temporal changes in PBMC cytokine expression in 72 foals and found that the expression of IFN-γ, IL-1α, and TGF-1 increased significantly during the first month after birth. Particularly, IFN-γ expression was low at birth but more than doubled from the day of birth to day 28 after birth, suggesting a weaker helper T-cell 1 response during the perinatal period or a subsequent exposure to environmental antigens. Transforming growth factor-β1 is a chemoattractant for neutrophils and monocytes, but it also limits inflammatory responses and promotes wound healing.12 Interestingly, in the study of Boyd et al,11 expression of TGF-β1 was less in foals that developed clinical signs of infectious disease, compared with findings in foals that did not. In the same study,11 IL-2, IL-4, IL-6, IL-10, or TNF-α expression did not significantly differ with age, but IL-1β and IL-8 expression appeared to increase with age. Interleukin-1 plays an important role in nonspecific immunologic defense, and IL-8 is an important proinflammatory chemokine for neutrophil migration.

It has been shown that lymphocytes from newborn foals have a profound deficiency in both IFN-γ gene expression and IFN-γ protein production in vitro.13 The production of IFN-γ approached a normal adult level when foals reached approximately 3 months of age. The inability to express the IFN-γ gene and produce the IFN-γ protein may explain the susceptibility of newborn foals to intracellular pathogens.

In a study of molecular markers in blood samples obtained from sick and healthy neonatal foals, Pusterla et al14 found that IL-10 expression was significantly greater in nonsurviving neonatal foals, compared with findings in sick foals that did survive. Expression of TNF-α or TGF-β was lower and expression of IL-8 was significantly greater in sick foals with or without sepsis, compared with findings in healthy foals.14 Expression of IL-1β, IL-6, or procalcitonin did not differ between sick and healthy foals.14 These results suggest that foals with sepsis have an immunosuppressive status.

Gold et al15 investigated the gene expression of IFN-γ, IL-1β, IL-6, IL-4, and IL-8 as well as the gene expression of toll-like receptor 4 in PBMCs isolated from 21 foals with sepsis during the first 72 hours after hospital admission and from 20 healthy neonatal foals at comparable ages. The results of that study indicated that at admission, toll-like receptor 4 gene expression was upregulated in foals with sepsis; such upregulation may enhance proinflammatory cytokine production. Compared with findings for healthy neonatal foals, there was a 6-fold decrease in IL-4 gene expression in foals with sepsis at the time of hospital admission; however, IFN-γ, IL-1β, IL-6, and IL-8 gene expression did not differ between the 2 groups of foals. In 3 foals with sepsis that died, there was a 15-fold increase in IL-6 expression at admission, compared with findings in foals with sepsis that survived.15

To our knowledge, reports of studies regarding cytokine expression in neonatal foals with PAS are lacking. The objective of the study reported here was to determine the temporal gene expression of IL-1β, IL-8, and IFN-γ in healthy foals during the first 72 hours after birth and in sick neonatal foals during the first 72 hours of hospitalization and compare gene expression of the 3 cytokines in the 2 groups of foals at all sample collection times. In addition, differences in cytokine gene expression among healthy foals, foals with sepsis, foals with PAS, and foals with other diseases were evaluated, and the correlation of gene expression of any of the 3 cytokines with clinicopathologic variables in healthy and in sick neonatal foals was investigated. We hypothesized that gene expression of the cytokines would be higher in sick neonatal foals than in healthy neonatal foals and that foals with PAS but no sepsis would have different patterns of gene expression of these cytokines, compared with findings in neonatal foals with sepsis. Another hypothesis was that gene expression of one or more of the cytokines would correlate with one or more of the recorded clinicopathologic variables.

Materials and Methods

Animals—All procedures performed on the foals were approved by the Ethic-Scientific Committee for Experiments on Animals of the University of Bologna, in accordance with DL 116/92, and approved by the Ministry of Health. Oral informed consent for foal participation was given by the owners. Foals included in the study were classified as healthy or sick. The healthy foals were the offspring of mares referred to the Equine Perinatology Unit Stefano Belluzzi of the University of Bologna for assisted delivery. Healthy foals had an Apgar score ≥ 9,16 and results of clinical evaluation were considered normal; at 24 hours after birth, serum IgG concentration was > 800 mg/dL. Sick foals were either born at the Equine Perinatology Unit or were referred after birth (< 7 days old). All sick foals born at the Equine Perinatology Unit were also assigned an Apgar score to evaluate the neonates' vitality.16

Data collection immediately after birth or at hospital admission—For healthy and sick foals, the following data were recorded at 0 hours (ie, immediately after birth or at the time of hospital admission): mare's age and parity; foal's gestational age, breed, and sex; age at time of evaluation; rectal temperature; WBC count; lymphocyte, monocyte, and neutrophil counts; N:L ratio (calculated); plasma lactate, serum magnesium, and plasma fibrinogen concentrations; and results of arterial blood gas analysis (pH, Paco2, and Pao2). All sick foals received a complete and standardized clinicopathologic evaluation at 0 hours, and the following additional data were recorded: duration of clinical signs before hospitalization, heart and respiratory rates, MAP, results of microbial culture of a blood sample, blood glucose concentration, and serum IgG concentration. Medications administered prior to or during hospitalization were also recorded. The sepsis score of each sick foal was calculated from the data obtained at 0 hours, as described by Brewer and Koterba.17

The mare's age and parity, foal's gestational age, foal's age, and duration of clinical signs before hospitalization were recorded from information provided by the owner. The MAP was measured indirectlya via a cuff over the coccygeal artery.

For each sick foal, microbial culture of a blood sample was performed regardless of prereferral antimicrobial treatment. Ten milliliters of blood was withdrawn from a jugular vein after clipping of hair and aseptic preparation of the skin. The sampling needle was then discarded, and a new needle was used to inoculate the blood into the commercially available culture bottle.b

Serum IgG concentrationc was measured at the time of hospital admission if the sick foals were at least 18 hours of age18; otherwise, testing was performed when the foals attained that age. A 12.5-mL blood sample was placed into plastic vialsd containing serum separation gel (for serum biochemical analysis), EDTA (for hematologic and immunoglobulin evaluation), or sodium citrate (for plasma fibrinogen concentration assessment). Blood (1.2 mL) was also collected into a tube containing sodium fluoride and potassium oxalate for evaluation of lactate concentration. The samples were delivered to the laboratory within 30 minutes after collection. After centrifugation, samples of serum and plasma were processed or were stored at −20°C until analyses. All analyses were performed within a 2-month period after collection.

Hematologic assessments were performed with a commercial semiautomated multichannel blood cell-counting system,e and differential counts were performed by manual cytologic examination of blood smears. Biochemical variables were evaluated with a commercial automated analyzer.f Blood glucose concentration was determined with a rapid method.g For blood gas analysis, an arterial blood sample (1 mL) was collected anaerobically from a dorsal metatarsal artery into a 1-mL plastic syringe, the dead space of which was filled with heparin sodium (1,000 U/mL). Blood gases, electrolytes, base excess, and anion gap were evaluated with an automated blood gas analyzerh within 10 minutes after sampling. Blood gas and pH were corrected for divergence of the temperature of the analyzer (37°C) from the rectal temperature of the foal at the time of sample collection.

All data were collected by 1 of the 2 admitting clinicians (CC and JM). A foal was classified as having sepsis on the basis of positive results of microbial culture of the blood sample, positive results of culture of pathogens from local sites of suspected infection, or findings of a postmortem examination. A foal was defined as unclassifiable if it had diarrhea of unknown etiology, a clinical response to antimicrobials without documented infection, or clinical evidence of inflammation without documented infection. A foal was classified as having PAS on the basis of anamnesis and clinical signs, especially neurologic signs,19 after other causes of neurologic disease such as meningitis had been ruled out. A foal was classified as premature when born prior to 320 days of gestation and as dysmature when born after 320 days of gestation but with immature physical characteristics (eg, low birth weight and inability to maintain body homeostasis).19 During the hospitalization, all sick foals were treated on the basis of the clinical signs and additional clinical data were collected to address the therapeutic choices. All nonsurviving foals underwent postmortem examination to confirm the diagnosis.

Cytokine expression evaluation—For each foal, a blood sample (2.6 mL) was obtained from a jugular vein for cytokine expression evaluation in the immediate postpartum period or at admission to the hospital (0 hours) and at 24 and 72 hours thereafter. Each jugular blood sample was collected into a tube containing EDTA and was overlaid on sterile gradient density mediumi for isolation of PBMCs.

Total cellular RNA from PBMCs was extracted by use of a total RNA isolation reagentj according to the manufacturer's instructions, and the concentrations of IL-1β, IFN-γ, and IL-8 gene products were determined by a real-time PCR assay. On the basis of previous studies15,20,21 to characterize cytokine profiles in PBMCs of healthy and sick foals, the β-actin gene was used as an internal reference gene to normalize the variation of cell numbers in the samples. The β-actin primers were chosen on the basis of the partial equine mRNA sequence as used by Giguère and Prescott.22 The primer pair for each cytokine was designed by use of softwarek on the basis of published sequences (Appendix). The RNA extracted from PBMCs of individual foals underwent reverse transcription into first-strand cDNA with random hexamers and purified avian myeloblastosis virus reverse transcriptasel in 20 μL of reaction after a DNAse treatment and stored at −80°C until use.

The PCR reactions were performed with the following cycle conditions: a denaturation step for 15 minutes at 95°C and 40 cycles of 30-second denaturation at 94°C, 30 seconds of annealing (IL-1β at 55°C, IL-8 at 55°C, IFN-γ at 55°C, and β-actin at 56°C), 15 seconds at 72°C, and 7 minutes of final extension at 72°C. The PCR products were visualized by electrophoresis on agarose gel 2% stained by ethidium bromide. The purified PCR products were cloned into a plasmid vector, transformed into an Escherichia coli kit, and purified with a kitm containing reagents needed to isolate plasmid DNA.

The recombinant plasmid was linearized upstream of the target sequence by use of the restriction endonuclease PmeI.n Ten-fold dilutions of recombinant plasmid from 106 copies to 101 copies were used as standards.

The real-time PCR assay was developed and evaluated on a real-time DNA detection system.o The reaction was performed in a final volume of 25 μL containing 1× premix reagent,p 200nM each of forward and reverse primers, 1× reference dye,q and 2 μL of cDNA. Cycling conditions were as follows: 10 minutes at 95°C for polymerase activation, followed by 40 cycles of 15 seconds at 95°C, 15 seconds of annealing (IL-1β at 55°C, IL-8 at 55°C, IFN-γ at 55°C, and β-actin at 56°C), and 20 seconds at 72°C.

The signal was acquired on the 6-carboxyfluorescein (FAM) channel (multichannel machine; source, 470 nm; detector, 510 nm; gain set to 5), with the fluorescence reading obtained at the end of each 72°C step. All of the data were then expressed as the ratio between copies of the target gene and copies of the reference gene β-actin.23

A melt step was added after a cycling run performed with the same conditions of the SYBR Green assay.p During the melt cycle, the temperature was increased by increments of 1°C from 72° to 95°C, and the signal was acquired on the FAM channel (source, 470 nm; detector, 510 nm; gain set to 5).

To distinguish specific from nonspecific products and primer dimers, a melting curve was obtained after amplification by holding the temperature at 72°C for 12 seconds, followed by a gradual increase in temperature to 95°C at a rate of 0.1°C/s, with the fluorescence signal acquisition mode set to step. In fact, melting curve analysis is considered essential in designing an efficient and specific quantitative PCR assay.

Statistical analysis—All data were evaluated for normal distribution with a Shapiro-Wilk normality test before statistical analyses were performed. Time-dependent changes in cytokine gene expressions were analyzed by the nonparametric Friedman test in healthy foals, all sick foals, and foals with various diseases (sepsis, PAS, and other).

The Kruskal-Wallis test was used to compare the gene expression among the 3 cytokines at all sample collection times in healthy foals and foals with various diseases (sepsis, PAS, and other). The Kruskal-Wallis test was used also to evaluate the differences among healthy foals and foals with various diseases (sepsis, PAS, and other) at all sample collection times.

On the basis of data distribution, the Pearson or the Spearman rank correlation test was used to evaluate the correlation of gene expression of the 3 cytokines immediately after birth or at admission to the hospital and the recorded data (Apgar score; mare's age and parity; gestational age; foal's age; duration of clinical signs; rectal temperature; heart and respiratory rates; MAP; WBC count; neutrophil, lymphocyte, and monocyte counts; N:L ratio; plasma fibrinogen, serum magnesium, and plasma lactate concentrations; arterial pH; Pao2; Paco2; and sepsis score). All analyses were performed with commercial software,r and values of P < 0.05 were considered significant.

Results

Foals—Thirty-three foals (10 healthy foals and 25 sick foals) were initially included in the study. The breed distribution of foals reflected that of the local equine population: Standardbred (n = 23), Italian Saddlebred (4), Arabian (4), Appaloosa (2), Quarter Horse (1), and Paint (1). It was determined that 2 Arabian foals had FPT only, and were not further evaluated; data from these foals were not included in the descriptive statistics or any analyses.

The mean age of the 10 healthy foals was 0 hours. The mean age of the 23 sick foals at time of admission to the hospital was 41 hours. Two sick foals were born at the Equine Perinatology Unit, and 21 foals were referred after birth. Clinical diagnoses for the sick foals included sepsis (n = 7), PAS (6), meconium impaction (2), dysmaturity (2), congenital malformation (2), and umbilical hematoma (1). The remaining 3 foals had weakness of undetermined etiology.

Clinical and laboratory findings for healthy and sick foals—For purposes of data analysis, sick foals were classified as foals with sepsis (n = 7), foals with PAS (6), and foals with other diseases (10, including the 3 foals for which a diagnosis was not made). Total FPT (serum IgG concentration < 400 mg/dL) was detected in 5 of the sick foals and partial FPT (serum IgG concentration > 400 mg/dL but < 800 mg/dL) in 2 foals. In 6 foals, serum IgG concentration was not determined at time of admission to the hospital because the foals were < 18 hours old. When they reached 18 hours of age, 2 foals had serum IgG concentration < 400 mg/dL and 4 foals had serum IgG concentration > 800 mg/dL. For each of the healthy foals, serum IgG concentration at 24 hours after birth was > 800 mg/dL. Clinical and laboratory findings for healthy and sick foals were summarized (Table 1).

Table 1—

Clinical and laboratory findings (including mare's age and parity [median ± SD]) for healthy and sick foals at the time of birth or admission to the hospital (0 hours).

VariableHealthy foals (n = 10)Foals with sepsis (n = 7)Foals with PAS (n = 6)Foals with other diseases (n = 10*)
Mare's age (y)14 ± 413 ± 515 ± 612 ± 8
Mare's parity4 ± 35 ± 46 ± 45 ± 2
No. of males/No. of females5/53/43/36/4
Gestational age (d)349 ± 8332 ± 4338 ± 7339 ± 23
Rectal temperature (°C)38 ± 0.538.5 ± 0.237.9 ± 0.438.4 ± 0.5
Heart rate (beats/min)116 ± 28115 ± 15113 ± 20
Respiratory rate (breaths/min)30 ± 733 ± 1744 ± 24
MAP (mm Hg)67 ± 1464 ± 775 ± 8
Duration of signs before hospitalization (h)13 ± 815.5 ± 16.58.5 ± 8.5
Sepsis score11.3 ± 4.34.2 ± 2.86.6 ± 4.6
WBCs (cells × 103)8,460 ± 1,9605,700 ± 4,4008,510 ± 2,1408,290 ± 4,300
Lymphocytes (cells × 103)1,720 ± 5801,380 ± 8501,390 ± 4701,680 ± 1,170
Monocytes (cells × 103)95 ± 70460 ± 6201,170 ± 1,980550 ± 460
Neutrophils (cells × 103)6,580 ± 2,1503,870 ± 3,8305,960 ± 3,4406,780 ± 3,340
N:L ratio5.6 ± 6.82.5 ± 1.55.5 ± 2.65.4 ± 4.0
Plasma lactate (mmol/L)3.4 ± 1.10.9 ± 1.40.7 ± 0.51.1 ± 2.3
Serum magnesium (mmol/L)0.65 ± 0.080.82 ± 0.490.90 ± 0.160.41 ± 0.20
Plasma fibrinogen (g/L)3.2 ± 0.65.0 ± 2.73.2 ± 0.94.0 ± 1.7
Blood glucose (mmol/L)5.2 ± 2.96.9 ± 3.07.1 ± 3.0
Arterial blood pH7.37 ± 0.07.35 ± 0.047.35 ± 0.037.38 ± 0.03
Paco2 (mm Hg)53.8 ± 5.846.6 ± 4.551.3 ± 9.049.9 ± 4.9
Pao2 (mm Hg)40.7 ± 12.878.5 ± 15.277.5 ± 11.270.6 ± 12.7

Two other foals initially included in the study had FPT only and were not further evaluated; no data from those animals were used in any analyses

— = Not applicable.

Microbial culture of blood samples obtained at the time of admission to the hospital from 7 foals with sepsis yielded positive results (growth of gram-negative organisms, n = 4; growth of gram-positive organisms, 3); for 1 foal, a synovial fluid sample was also collected, which yielded positive results following microbial culture. Among the 7 foals with sepsis, only 3 had a sepsis score ≥ 11 (scores of 14, 16, and 17).

One foal included in the other diseases group had received glucocorticoids prior to hospitalization but not during hospitalization. Two foals (1 foal with sepsis and 1 foal with other diseases) had been treated with flunixin meglumine (1 mg/kg, IM) prior to admission; 14 foals (7 foals with sepsis and 7 foals with other diseases) were treated with flunixin meglumine during the first 72 hours of hospitalization with the same dosage (0.25 mg/kg, IV, q 8 h). Three foals had received a plasma transfusion before admission to the hospital; 10 foals received a plasma transfusion during the first 72 hours after admission.

Five foals had been treated with antimicrobials before admission, and all were treated after admission with the same protocol (ampicillin [50 mg/kg, IV, q 6 h] and amikacin sulfate [30 mg/kg, IV, q 24 h]). Twenty-four foals survived, and only 1 sick foal died of septic shock.

Cytokine expression evaluation—Blood samples were collected from all 33 foals at 0 hours (at birth or at the time of hospital admission), 24 hours, and 72 hours. With regard to β-actin, used as an internal reference gene, the ratio between the SD and the mean expression within each foal group was constant and did not differ by more than 2 SDs from the mean (1.7 in healthy foals, 1.8 in foals with sepsis, and 1.8 in foals with PAS), except for foals with other diseases (2.9). Time-dependent changes in IL-1β, IL-8, and IFN-γ gene expression were evident (Figure 1), and the median, minimum values, maximum values, and SD of cDNA copies of cytokine/β actin were summarized (Table 2).

Figure 1—
Figure 1—

Gene expression of IL-1β (triangles), IL-8 (diamonds), and IFN (squares) in blood samples collected from 10 healthy foals (A) at birth and from 23 sick foals (B) at the time of birth or admission to the hospital (0 hours) and at 24 and 72 hours later. Sick foals (all < 7 days old) were classified into subgroups (foals with sepsis [C; n = 7], foals with PAS [D; 6], and foals with other diseases [E; 10 {2 other foals initially included in the study had FPT only and were not further evaluated; no data from those animals were used in any analyses}]). Gene expression is reported as the number of cDNA copies of cytokine/β-actin (housekeeping gene); IL-1β gene expression is marked on the right y-axis when present (B, C, and E).

Citation: American Journal of Veterinary Research 73, 9; 10.2460/ajvr.73.9.1418

Table 2—

Data regarding gene expression of IL-1β, IL-8, and IFN-γ (median, minimum, and maximum values and SD of the number of cDNA copies of cytokine/β-actin [housekeeping gene]) in blood samples collected from healthy foals at birth and from sick foals (all < 7 days old) at the time of birth or admission to the hospital (0 hours) and at 24 and 72 hours later.

Foal groupIL-1βIL-8IFN-γ
0 hours24 hours72 hours0 hours24 hours72 hours0 hours24 hours72 hours
Healthy foals (n = 10)
   Median1.8 × 10−41.0 × 10−27.2 × 10−33.8 × 10−35.2 × 10−44.2 × 10−40.01.8 × 10−30.0
   Minimum0.00.08.8 × 10−40.00.00.00.00.00.0
   Maximum4.7 × 10−16.3 × 10−24.3 × 10−21.31.3 × 10−22.7 × 10−34.2 × 10−52.4 × 10−12.3
   SD1.9 × 1012.8 × 10−21.8 × 10−25.1 × 10−15.0 × 10−31.3 × 10−31.9 × 10−51.1 × 10−11.1
Sick foals (n = 23*)
   Median4.0 × 10−38.4 × 10−31.7 × 10−34.6 × 10−43.8 × 10−51.7 × 10−40.00.00.0
   Minimum0.00.00.00.00.00.00.00.00.0
   Maximum4.6 × 1035.9 × 1031.7 × 1037.4 × 106.01.3 × 106.57.7 × 10−22.7 × 10
   SD1.1 × 1031.3 × 1033.8 × 1021.6 × 101.62.71.41.9 × 10−25.6
Foals with sepsis (n = 7)
   Median1.01.01.01.4 × 10−43.0 × 10−50.00.00.00.0
   Minimum0.01.00.00.00.00.00.00.00.0
   Maximum4.6 × 1035.9 × 1031.7 × 1037.4 × 106.01.3 × 106.57.7 × 10−29.9 × 10−5
   SD1.7 × 1032.2 × 1036.5 × 1022.8 × 102.34.92.52.9 × 10−23.7 × 10−5
Foals with PAS (n = 6)
   Median1.2 × 10−44.6 × 10−58.8 × 10−63.7 × 10−42.3 × 10−51.5 × 10−50.00.00.0
   Minimum3.5 × 10−62.3 × 10−60.05.5 × 10−68.3 × 10−60.00.00.00.0
   Maximum2.1 × 10−22.2 × 10−37.3 × 10−33.6 × 10−26.8 × 10−39.6 × 10−40.01.4 × 10−40.0
   SD8.3 × 10−38.6 × 10−42.9 × 10−31.5 × 10−22.7 × 10−33.9 × 10−40.05.9 × 10−50.0
Foals with other diseases (n = 10*)
   Median2.6 × 10−35.7 × 10−33.9 × 10−35.4 × 10−45.6 × 10−43.0 × 10−40.00.04.3 × 10−4
   Minimum0.00.00.00.00.00.00.00.00.0
   Maximum2.6 × 1032.1 × 1036.7 × 1025.54.98.7 × 10−21.04.7 × 10−22.7 × 10
   SD8.2 × 1026.6 × 1022.1 × 1021.71.52.8 × 10−23.2 × 10−11.5 × 10−28.5

For analysis, sick foals were classified into subgroups (foals with sepsis, foals with PAS, and foals with other diseases).

See Table 1 for key.

Interferon-γ was expressed in much lower copy numbers than were the other 2 cytokines. Interleukin-1β gene expression in healthy foals at birth was evaluated in only 6 of 10 foals. Among all foals, the highest IL-1β and IL-8 copy numbers were detected in the nonsurviving foal. The highest IL-8 copy numbers in foals with PAS were detected in the foal with the most severe neurologic signs.

Data analysis—Among healthy foals, data that were normally distributed included Apgar score; mare's age; foal's gestational age; rectal temperature; WBC count; lymphocyte, monocyte, and neutrophil counts; serum magnesium concentration; arterial pH; Paco2; and plasma lactate concentration. Among healthy foals, data that were not normally distributed included the mare's parity, N:L ratio, plasma fibrinogen concentration, Pao2, and cytokine gene expression at all sampling times. Among sick foals, data that were normally distributed included the mare's age, rectal temperature, respiratory rate, WBC count, neutrophil and lymphocyte counts, N:L ratio, Pao2, and sepsis score. Among sick foals, data that were not normally distributed included mare's parity, foal's gestational age, foal's age, duration of clinical signs before hospitalization, heart rate, MAP, monocyte count, plasma fibrinogen and serum magnesium concentrations, arterial pH, Paco2, lactate concentration, blood glucose concentration, and cytokine gene expression at all sample collection times. Breed, sex, and serum IgG concentration were not evaluated statistically.

No time-dependent changes in IL-1β and IL-8 gene expressions were found in healthy foals during the first 72 hours after birth or in sick neonatal foals during the first 72 hours of hospitalization. In healthy foals, there were no significant differences in IL-1β or IL-8 gene expression at all sample collection times. Similarly, there were no significant differences in IL-1β or IL-8 gene expression at all sample collection times in foals with sepsis, PAS, or other diseases. In foals with sepsis, IFN-γ gene expression was significantly lower, compared with that of IL-1β, at 0 hours (P < 0.05), 24 hours, (P < 0.01), and 72 hours (P < 0.05). In foals with PAS, IFN-γ gene expression was significantly lower, compared with expressions of IL-1β and IL-8, at 0 hours (each P < 0.01), 24 hours, (each P < 0.05), and 72 hours (each P < 0.01). Because no time-dependent changes in IL-1β and IL-8 gene expressions were found, all results were considered together for the comparison between groups. Interleukin-1β gene expression in foals with sepsis was significantly (P < 0.01) higher than findings in healthy foals, foals with PAS, and foals with other diseases (Figure 2).

Figure 2—
Figure 2—

Box-and-whisker plots of IL-1β gene expression in blood samples collected from 10 healthy foals, 7 foals with sepsis, 6 foals with PAS, and 10 foals with other diseases. For each box, the square represents the median and the upper and lower boundaries represent the 75th and 25th percentiles, respectively. Whiskers represent the minimum and maximum values. Gene expression is reported as the number of cDNA copies of cytokine/β-actin (housekeeping gene).

Citation: American Journal of Veterinary Research 73, 9; 10.2460/ajvr.73.9.1418

At birth, IL-1β gene expression was correlated with plasma fibrinogen concentration (r = 0.93; P < 0.05) in healthy foals (n = 6; Figure 3). In foals with sepsis (n = 7), IL-1β gene expression was correlated with the N:L ratio (r = −0.77; P < 0.05) and IL-8 gene expression was correlated with monocyte count (r = 0.98; P < 0.01) at time of admission or at birth. In foals with PAS (n = 6), IL-8 gene expression was correlated with arterial blood pH (r = −0.89; P < 0.05), plasma fibrinogen concentration (r = −0.89; P < 0.01), and plasma lactate concentration (r = 0.83; P < 0.05) at time of admission or at birth.

Figure 3—
Figure 3—

Plots of IL-1β gene expression against plasma fibrinogen concentration in 6 healthy foals (A [2 values are superimposed]); N:L ratio (B) and monocyte count (C [2 values are superimposed]) in 7 foals with sepsis; and arterial blood pH (D), plasma fibrinogen concentration (E), and plasma lactate concentration (F) in 6 foals with PAS. Data were obtained from healthy foals at birth and from sick foals at birth or at the time of admission to the hospital; all sick foals were < 7 days old. In healthy foals, IL-1β gene expression was correlated with plasma fibrinogen concentration (r = 0.93; P < 0.05). In foals with sepsis, IL-1β gene expression was correlated with N:L ratio (r = −0.77; P < 0.05) and with monocyte count (r = 0.98; P < 0.01). In foals with PAS, IL-1β gene expression was correlated with arterial blood pH (r = −0.89; P < 0.05), plasma fibrinogen concentration (r = −0.89; P < 0.01), and plasma lactate concentration (r = 0.83; P < 0.05).

Citation: American Journal of Veterinary Research 73, 9; 10.2460/ajvr.73.9.1418

Discussion

As in previous investigations in foals,11,13,15 IFN-γ was expressed at low levels at birth or in a short period thereafter in foals (healthy or sick) of the present study; moreover, IFN-γ gene expression did not differ between healthy foals and foals with sepsis. This finding is in disagreement with results of a study24 of preterm human infants with sepsis, in whom serum concentrations of IFN-γ and other cytokines increase and remain increased for at least 48 hours after sepsis develops.

In the present study involving foals < 7 days old, no time-dependent changes in expression of any cytokine were detected, which is similar to other reported findings.15 Considering that blood samples were collected from healthy foals at birth and before colostrum consumption, it appears that colostrum intake does not influence cytokine gene expression. However, because of the low number of foals with total FPT (n = 5), we did not compare their cytokine gene expressions with those of foals with adequate serum IgG concentration. Breathnach et al13 investigated whether colostrum itself was responsible for the observed IFN-γ suppression in young foals by comparing data from blood samples collected within 30 minutes after birth (prior to nursing) and again 36 hours later in 5 healthy foals. Unlike the results of the present study, an extremely low level of IFN-γ gene expression prior to colostrum ingestion was detected within 30 minutes after birth in that investigation13; 36 hours later, that gene expression had increased. On the basis of data from other species,25–29 the effects of colostrum and milk ingestion on immune maturation in foals should be studied in greater depth, in our opinion. Goto et al25 found that IL-1β could be transferred to newborn calves via ingestion of colostrum. In women, most of the cytokines that are known to be deficient in neonates, particularly in preterm infants, have been found in considerable amounts in human milk and are thought to provide immunologic benefit and to promote the development of the digestive system.26–29

The absence of time-dependent changes in cytokine expression in sick foals suggested that treatments administered during the first 72 hours of hospitalization did not influence cytokine expression. Also, it has been reported that plasma administration in foals with FPT does not seem to influence cytokine expression.15 With regard to treatments administered before admission to the hospital in the present study, only the foal that received a corticosteroid dose had high expressions of IL1-β and IL-8 (2,594.24 cDNA copies/β-actin and 5.47 cDNA copies/β-actin, respectively) at 0 hours.

The results of the present study disagree somewhat with those of Pusterla et al14 and Gold et al15 in that our findings suggested that foals upregulate IL-1β gene expression in response to sepsis and that IL-1β gene expression is positively correlated with plasma fibrinogen concentration in healthy foals and negatively correlated with the N:L ratio in foals with sepsis. Because fibrinogen is an acute-phase protein, its production is stimulated by proinflammatory cytokines such as IL-1β.1 A low N:L ratio in full-term sick foals is generally attributable to neutropenia; overzealous production of cytokines in overwhelming or uncontrolled sepsis induces margination of neutrophils, extravasation into affected tissues, or apoptosis, which results in neutropenia with or without a left shift.30

The differences between the results of the present study and those of the studies of Pusterla et al14 and Gold et al15 could reflect the different numbers of foals or a slightly different classification of foals with sepsis in each study. Also, different methods were used; in the present study, an absolute quantification of the amount of a target gene was performed, whereas in the other 2 studies, a comparative threshold cycle method was used.

In human medicine, serum IL-1β, IL-6, IL-8, and TNF-α concentrations are significantly higher in infants with sepsis, compared with findings in healthy infants,31 although results of different studies are contradictory.32,33 In our opinion, the difference in results could also reflect different phases of the disease; as stated by Lam and Ng,34 IL-6 and IL-8 concentrations have a good diagnostic value as early-phase markers in infants with sepsis, although acute-phase reactants (eg, C-reactive protein and procalcitonin) are more useful during the later phases.

The large SDs of the values of IL-1β and IL-8 gene expression, mainly in foals with sepsis, could be related to the degree of sepsis in those foals, as suggested by Pusterla et al.14 In the present study, the highest gene expression was measured in a nonsurviving foal with septic shock.

Serum concentrations of IL-8 in human infants with sepsis, necrotizing enterocolitis, other inflammatory states, and perinatal asphyxia are greater than those in healthy infants, and it has been suggested that large quantities of IL-8 have a trophic function in the developing human intestine.27 In 1 study,35 a high gene expression of IL-8 in umbilical cord blood was a sensitive marker of neonatal infection.

Unlike results of studies36,37 of asphyxiated neonatal humans, foals with PAS in the present study did not express any cytokine at levels higher than those in healthy foals, but IL-8 gene expression was correlated with some variables that are typically altered in association with PAS (arterial blood pH and lactate concentration). It is worth noting that the foal with the more severe neurologic signs had the highest IL-8 gene expression among foals with PAS in the present study. Further studies with a larger number of foals with PAS are necessary. Fotopoulos et al36 found that serum IL-8 concentration was significantly elevated in perinatally asphyxiated and perinatally infected human neonates during the first day after birth, compared with healthy controls, probably because of its passage from the ischemic brain of the affected neonates. It was suggested that inhibition of inflammatory chemokines could possibly contribute to the prevention of brain damage in neonates.36

The correlations between clinicopathologic data and cytokine gene expression identified in the present study could be influenced by data from the 2 foals with the highest IL-1β and IL-8 gene expressions. In accordance with previous studies that revealed an overall reduced variability of β-actin gene expression in PBMCs of adult horses38 and neonatal foals,15,20,21 results of the present study suggested that this housekeeping gene is expressed at more or less constant levels.

In the present study, we did not perform an evaluation of the prognostic value of cytokine expression because there was only 1 foal with sepsis that died. However, it is interesting to note that this foal had much higher values of IL-1β gene expression than did the other foals with sepsis.

Because of the rapid progression of diseases in neonates, it is well-known that the key to a successful outcome is early diagnosis and treatment. In the authors' opinion, once suitable reagents and detection systems have been developed, cytokine evaluation will be useful as a diagnostic and prognostic tool, as it is for human infants. After a complete clinical evaluation, while waiting for results of microbial culture of a blood sample, detection of a high level of IL-1β gene expression, together with other clinicopathologic data (eg, high plasma fibrinogen concentration and neutropenia), could help clinicians to more promptly diagnose disease in and initiate treatment of foals with sepsis.

ABBREVIATIONS

cDNA

Complementary DNA

FPT

Failure of passive transfer of immunity

IFN

Interferon

IL

Interleukin

MAP

Mean arterial blood pressure

N:L

Neutrophil-to-lymphocyte

PAS

Peripartum asphyxia syndrome

PBMC

Peripheral blood mononuclear cell

TGF

Transforming growth factor

TNF

Tumor necrosis factor

a.

Dynamap Pro Series 300, Critikon Co LLC, Tampa, Fla.

b.

OXOID signal blood-culture system, Oxoid Ltd, Basingstoke, Hampshire, England.

c.

SNAP Foal IDEXX, IDEXX Laboratories Inc, Milan, Italy.

d.

S-Monovette, Sarstedt Inc, Verona, Italy.

e.

CELL-DYN 3500R, Abbott Laboratories Inc, Santa Clara, Calif.

f.

Chemistry Analyzer AU400, Olympus Diagnostica GmbH, Lismeehan, Ireland.

g.

Medisense Optium, Abbott Laboratories Inc, Bedford, Mass.

h.

Roche Opti CCA, Roche Diagnostic Corp, Indianapolis, Ind.

i.

Ficoll-Paque, Amersham Bioscience Corp, Uppsala, Sweden.

j.

Tri-reagent, Sigma-Aldrich, Deisenhofen, Germany.

k.

Oligo, Molecular Biology Insights, Cascade, Colo.

l.

Takara Bio Inc, Otsu, Japan.

m.

Turbo Kit, QBIOgene Inc, Irvine, Calif.

n.

MBI Fermentas Inc, Burlington, ON, Canada.

o.

Rotor-Gene 3000 system, Corbett Research, Sydney, NSW, Australia.

p.

SYBR PREMIX Ex Taq, Takara Bio Inc, Otsu, Japan.

q.

ROX Reference Dye, Roche Applied Science, Indianapolis, Ind.

r.

Analyse-it, version 2.03, Analyse-it Software Ltd, Leeds, West Yorkshire, England.

Appendix

Real-time PCR primers designed with software according to published gene sequences and used to assess gene expressions of IL-8, IFN-γ, and IL-1β in healthy and sick foals.

Target genePrimer forward (5′−3′)Primer reverse (5′−3′)Frame (bp)Reference sequence Genbank code
β-actinCTGGCACCACACCTTCTACAACGAGTCACCGGAGTCCATCACGA214AF035774.1
IL-8TCTCTTGGCCGTCTTCCTGCCGTTGACGAGCTTTACAA195AY184956.1
IFN-γGTGTGCGATTTTGGGTTCTTCTATTGAATGACCTGGTTATCT235D28520.1
IL-1βGAGGCAGCCATGGCAGCAGTATGTGAGCAGGGAACGGGTATCTT257D42165.1

References

  • 1.

    Dinarello CA. Proinflammatory cytokines. Chest 2000; 118:503508.

  • 2.

    Tsiotou AGSakorafas GHAnagnostopoulos G, et al. Septick shock; current pathogenetic concepts from a clinical perspective. Med Sci Monit 2005; 11:RA76RA85.

    • Search Google Scholar
    • Export Citation
  • 3.

    Morris DDCrowe NMoore JN. Correlation of clinical and laboratory data with serum tumor necrosis factor activity in horses with experimentally induced endotoxemia. Am J Vet Res 1990; 51:19351940.

    • Search Google Scholar
    • Export Citation
  • 4.

    Morris DDMoore JNCrowe N. Serum tumor necrosis factor activity in horses with colic attributable to gastrointestinal tract disease. Am J Vet Res 1991; 52:15651569.

    • Search Google Scholar
    • Export Citation
  • 5.

    Morris DDMoore JNCrowe N, et al. Effect of experimentally induced endotoxemia on serum interleukin-6 activity in horses. Am J Vet Res 1992; 53:753756.

    • Search Google Scholar
    • Export Citation
  • 6.

    MacKay RJLester GD. Induction of the acute-phase cytokine, hepatocyte-stimulating factor/interleukin 6, in the circulation of horses treated with endotoxin. Am J Vet Res 1992; 53:12851289.

    • Search Google Scholar
    • Export Citation
  • 7.

    Barton MHCollatos C. Tumor necrosis factor and interleukin-6 activity and endotoxin concentration in peritoneal fluid and blood of horses with acute abdominal disease. J Vet Intern Med 1999; 13:457464.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 8.

    Morris DDMoore JN. Tumor necrosis factor activity in serum from neonatal foals with presumed septicemia. J Am Vet Med Assoc 1991; 199:15841589.

    • Search Google Scholar
    • Export Citation
  • 9.

    Robinson JAAllen GKGreen EM, et al. Serum interleukin-6 concentrations in endotoxin-infused neonatal foals. Am J Vet Res 1993; 54:14111414.

    • Search Google Scholar
    • Export Citation
  • 10.

    Allen GKGreen EMRobinson JA, et al. Serum tumor necrosis factor alpha concentrations and clinical abnormalities in colostrum-fed and colostrum-deprived neonatal foals given endotoxin. Am J Vet Res 1993; 54:14041410.

    • Search Google Scholar
    • Export Citation
  • 11.

    Boyd NKCohen NDLim W-S, et al. Temporal changes in cytokine expression of foals during the first month of life. Vet Immunol Immunopathol 2003; 92:7585.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 12.

    Letterio JJRoberts AB. Regulation of immune responses by TGF-β. Annu Rev Immunol 1998; 16:137161.

  • 13.

    Breathnach CCSturgill-Wright TStiltner JL, et al. Foals are interferon gamma-deficient at birth. Vet Immunol Immunopathol 2006; 112:199209.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 14.

    Pusterla NMagdesian KGMapes S, et al. Expression of molecular markers in blood of neonatal foals with sepsis. Am J Vet Res 2006; 67:10451049.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 15.

    Gold JRPerkins GAErb HN, et al. Cytokine profiles of peripheral blood mononuclear cells isolated from septic and healthy neonatal foals. J Vet Intern Med 2007; 21:482488.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 16.

    Vaala WEHouse JKMadigan JE. Initial management and physical examination of the neonate. In: Smith BP, ed. Large animal internal medicine. 3rd ed. St Louis: Mosby, 2002:277293.

    • Search Google Scholar
    • Export Citation
  • 17.

    Brewer BDKoterba AM. Development of a scoring system for the early diagnosis of equine neonatal sepsis. Equine Vet J 1988; 20:1822.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 18.

    LeBlanc MM. Immunologic considerations. In: Koterba AMDrummond WHKosch PC, eds. Equine clinical neonatology. Philadelphia: Lea & Febiger, 1990:275294.

    • Search Google Scholar
    • Export Citation
  • 19.

    Knottenbelt DCHoldstock NMadigan JE. Neonatal syndromes. In: Knottenbelt DCHoldstock NMadigan JE, eds. Equine neonatology medicine and surgery. Philadelphia: Saunders, 2004:155363.

    • Search Google Scholar
    • Export Citation
  • 20.

    Svansson VRoelse MOlafsdòttir G, et al. Immune response against equine gammaherpesvirus in Icelandic horses. Vet Microbiol 2009; 137:363368.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 21.

    Flaminio MJBFNydam DVMarquis H, et al. Foal monocyte-derived dendritic cells become activated upon Rhodococcus equi infection. Clin Vaccine Immunol 2009; 16:176183.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 22.

    Giguère SPrescott JF. Quantitation of equine cytokine mRNA expression by reverse transcription-competitive polymerase chain reaction. Vet Immunol Immunopathol 1999; 67:115.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 23.

    Bowels KSBeadle REMouch S, et al. A novel model for equine recurrent airway obstruction. Vet Immunol Immunopathol 2002; 87:385389.

  • 24.

    Ng PCLi KWong RPO, et al. Pro-inflammatory and anti-inflammatory cytokine responses in preterm infants with systemic infections. Arch Dis Child Fetal Neonatal Ed 2003; 88:F209F213.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 25.

    Goto MMaruyama MKitadate K, et al. Detection of interleukin-1β in sera and colostrum of dairy cattle and in sera of neonates. J Vet Med Sci 1997; 59:437441.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 26.

    Srivastava MDSrivastava ABrouhard B, et al. Cytokines in human milk. Res Commun Mol Pathol Pharmacol 1996; 93:263287.

  • 27.

    Maheshwari ALu WLacson A, et al. Effects of interleukin-8 on the developing human intestine. Cytokine 2002; 20:256267.

  • 28.

    Takahata YTakada HNomura A, et al. Interleukin-18 in human milk. Pediatr Res 2001; 50:268272.

  • 29.

    Chirico GMarzollo RCortinovis S, et al. Antiinfective properties of human milk. J Nutr 2008; 138:1801S1806S.

  • 30.

    MacKay R. Inflammation in horses. Vet Clin North Am Equine Pract 2000; 16:1527.

  • 31.

    Kurt ANAygun ADGodekmerdan A, et al. Serum IL-β, IL-6, IL-8, and TNF-α levels in early diagnosis and management of neonatal sepsis. Mediators Inflamm 2007; 2007:31397.

    • Search Google Scholar
    • Export Citation
  • 32.

    Ng PCCheng SHChui KM, et al. Diagnosis of late onset neonatal sepsis with cytokines, adhesion molecule, and C-reactive protein in preterm very low birthweight infants. Arch Dis Child Fetal Neonatal Ed 1997; 77:F221F227.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 33.

    Santana Reyes CGarcía-Muñoz FReyes D, et al. Role of cytokines (interleukin-1β, 6, 8, tumour necrosis factor-α, and soluble receptor of interleukin-2) and C-reactive protein in the diagnosis of neonatal sepsis. Acta Paediatr 2003; 92:221227.

    • Search Google Scholar
    • Export Citation
  • 34.

    Lam HSNg PC. Biochemical markers of neonatal sepsis. Pathology 2008; 40:141148.

  • 35.

    Berner RTuxen BClad A, et al. Elevated gene expression of interleukin-8 in cord blood is a sensitive marker for neonatal infection. Eur J Pediatr 2000; 159:205210.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 36.

    Fotopoulos SMouchtouri AXanthou G, et al. Inflammatory chemokine expression in the peripheral blood of neonates with perinatal asphyxia and perinatal or nosocomial infections. Acta Pediatr 2005; 94:800806.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 37.

    Okazaki KNishida AKato M, et al. Elevation of cytokine concentrations in asphyxiated neonates. Biol Neonate 2006; 89:183189.

  • 38.

    Cappelli KFelicetti MCapomaccio S, et al. Exercise induced stress in horses: selection of the most stable reference genes for quantitative RT-PCR normalization. BMC Mol Biol 2008; 9:49.

    • Crossref
    • Search Google Scholar
    • Export Citation
All Time Past Year Past 30 Days
Abstract Views 54 0 0
Full Text Views 2984 2034 225
PDF Downloads 364 130 10
Advertisement