• View in gallery

    Results of a PCR–ESI-MS assay performed with each of 2 primer pairs (BCT3575 [A] and BCT3570 [B]) to detect the Wolbachia endosymbiont of Dirofilaria immitis in a whole blood sample collected from a dog in which heartworm infection had been experimentally induced. For Wolbachia endosymbiont amplicon detection, primer pair BCT3575 targets rpoB and primer pair BCT3570 targets gltA; targets are conserved regions of endosymbiont DNA that border variable regions. The mass for both the forward and reverse strands of the amplicons are given. Between the major peaks in each panel, the numbers after the letters A, G, C, and T represent the amplicon base composition (ie, the number of adenine [A], guanine [G], cytosine [C], and thymine [T] bases).

  • 1 Mendoza N, Li A, Gill A, et al. Filariasis: diagnosis and treatment. Dermatol Ther 2009; 22:475490.

  • 2 Genchi C, Rinaldi L, Mortarino M, et al. Climate and Dirofilaria infection in Europe. Vet Parasitol 2009; 163:286292.

  • 3 Simon F, Morchon R, Gonzalez-Miguel J, et al. What is new about animal and human dirofilariosis? Trends Parasitol 2009; 25:404409.

  • 4 Sironi M, Bandi C, Sacchi L, et al. Molecular evidence for a close relative of the arthropod endosymbiont Wolbachia in a filarial worm. Mol Biochem Parasitol 1995; 74:223227.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 5 Bandi C, McCall JW, Genchi C, et al. Effects of tetracycline on the filarial worms B rugia pahangi and Dirofilaria immitis and their bacterial endosymbionts Wolbachia. Int J Parasitol 1999; 29:357364.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 6 Taylor MJ, Bandi C, Hoerauf A. Wolbachia bacterial endosymbionts of filarial nematodes. Adv Parasitol 2005; 60:245284.

  • 7 Kramer LH, Tamarozzi F, Morchon R, et al. Immune response to and tissue localization of the Wolbachia surface protein (WSP) in dogs with natural heartworm (Dirofilaria immitis) infection. Vet Immunol Immunopathol 2005; 106:303308.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 8 Kramer L, Simon F, Tamarozzi F, et al. Is Wolbachia complicating the pathological effects of Dirofilaria immitis infections? Vet Parasitol 2005; 133:133136.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 9 McCall JW, Genchi C, Kramer L, et al. Heartworm and Wolbachia: therapeutic implications. Vet Parasitol 2008; 158:204214.

  • 10 Crowder CD, Matthews HE, Schutzer S, et al. Genotypic variation and mixtures of Lyme Borrelia in Ixodes ticks from North America and Europe. PLoS ONE 2010; 5:e10650.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 11 Eshoo MW, Crowder CD, Li H, et al. Detection and identification of Ehrlichia species in blood by use of PCR and electrospray ionization mass spectrometry. J Clin Microbiol 2010; 48:472478.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 12 Grant-Klein RJ, Baldwin CD, Turell MJ, et al. Rapid identification of vector-borne flaviviruses by mass spectrometry. Mol Cell Probes 2010; 24:219228.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 13 Crowder CD, Rounds MA, Phillipson CA, et al. Extraction of total nucleic acids from ticks for the detection of bacterial and viral pathogens. J Med Entomol 2010; 47:8994.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 14 Eshoo MW, Whitehouse CA, Zoll ST, et al. Direct broad-range detection of alphaviruses in mosquito extracts. Virology 2007; 368:286295.

  • 15 Ecker JA, Massire C, Hall TA, et al. Identification of Acinetobacter species and genotyping of Acinetobacter baumannii by multilocus PCR and mass spectrometry. J Clin Microbiol 2006; 44:29212932.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 16 Muddiman DC, Anderson GA, Hofstadler SA, et al. Length and base composition of PCR-amplified nucleic acids using mass measurements from electrospray ionization mass spectrometry. Anal Chem 1997; 69:15431549.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 17 Duncan AW, Correa MT, Levine JF, et al. The dog as a sentinel for human infection: prevalence of Borrelia burgdorferi C6 antibodies in dogs from southeastern and mid-Atlantic states. Vector Borne Zoonotic Dis 2005; 5:101109.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 18 Hamer SA, Tsao JI, Walker ED, et al. Use of tick surveys and serosurveys to evaluate pet dogs as a sentinel species for emerging Lyme disease. Am J Vet Res 2009; 70:4956.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 19 Nelson CT, McCall JW, Rubin SB, et al. 2005 guidelines for the diagnosis, prevention and management of heartworm ( Dirofilaria immitis) infection in dogs. Vet Parasitol 2005; 133:255266.

    • Crossref
    • Search Google Scholar
    • Export Citation

Advertisement

Detection of heartworm infection in dogs via PCR amplification and electrospray ionization mass spectrometry of nucleic acid extracts from whole blood samples

View More View Less
  • 1 Ibis Biosciences Incorporated, 1896 Rutherford Rd, Carlsbad, CA 92008.
  • | 2 Ibis Biosciences Incorporated, 1896 Rutherford Rd, Carlsbad, CA 92008.
  • | 3 Ibis Biosciences Incorporated, 1896 Rutherford Rd, Carlsbad, CA 92008.
  • | 4 Ibis Biosciences Incorporated, 1896 Rutherford Rd, Carlsbad, CA 92008.
  • | 5 Department of Medicine, New Jersey Medical School, University of Medicine and Dentistry of New Jersey, Newark, NJ 07103.
  • | 6 Ibis Biosciences Incorporated, 1896 Rutherford Rd, Carlsbad, CA 92008.
  • | 7 Ibis Biosciences Incorporated, 1896 Rutherford Rd, Carlsbad, CA 92008.
  • | 8 Ibis Biosciences Incorporated, 1896 Rutherford Rd, Carlsbad, CA 92008.
  • | 9 Ibis Biosciences Incorporated, 1896 Rutherford Rd, Carlsbad, CA 92008.

Abstract

Objective—To develop and evaluate a rapid and accurate assay involving PCR amplification and electrospray ionization mass spectrometry of nucleic acid extracts from whole blood samples for the detection of Dirofilaria immitis infection in dogs.

Sample—Whole blood nucleic acid extracts from 29 dogs experimentally infected with D immitis (and in which circulating D immitis antigen was detected) and 10 uninfected dogs.

Procedures—16 of the 29 whole blood samples from infected dogs were examined at the time of collection for circulating microfilaria. Nucleic acids were extracted from all whole blood specimens and underwent PCR amplification with 12 PCR primer pairs designed to detect a wide range of pathogens (including the Wolbachia endosymbiont of D immitis) and electrospray ionization mass spectrometry.

Results—On the basis of assay results, heartworm infection was detected in 13 of 13 antigen-positive dogs of unknown microfilaria status, 11 of 11 antigen-positive dogs with circulating microfilaria, 0 of 3 antigen-positive dogs tested at 3 months after larval infection, 0 of 2 antigen-positive dogs with occult infections, and 0 of 10 uninfected dogs.

Conclusions and Clinical Relevance—With the assay under investigation, it was possible to identify D immitis infection in dogs with circulating microfilaria via detection of the obligate Wolbachia endosymbiont of D immitis. It was not possible to identify dogs with occult infections, which suggested that circulating microfilaria must be present to detect infection with this assay, although further studies would be required to verify that finding.

Abstract

Objective—To develop and evaluate a rapid and accurate assay involving PCR amplification and electrospray ionization mass spectrometry of nucleic acid extracts from whole blood samples for the detection of Dirofilaria immitis infection in dogs.

Sample—Whole blood nucleic acid extracts from 29 dogs experimentally infected with D immitis (and in which circulating D immitis antigen was detected) and 10 uninfected dogs.

Procedures—16 of the 29 whole blood samples from infected dogs were examined at the time of collection for circulating microfilaria. Nucleic acids were extracted from all whole blood specimens and underwent PCR amplification with 12 PCR primer pairs designed to detect a wide range of pathogens (including the Wolbachia endosymbiont of D immitis) and electrospray ionization mass spectrometry.

Results—On the basis of assay results, heartworm infection was detected in 13 of 13 antigen-positive dogs of unknown microfilaria status, 11 of 11 antigen-positive dogs with circulating microfilaria, 0 of 3 antigen-positive dogs tested at 3 months after larval infection, 0 of 2 antigen-positive dogs with occult infections, and 0 of 10 uninfected dogs.

Conclusions and Clinical Relevance—With the assay under investigation, it was possible to identify D immitis infection in dogs with circulating microfilaria via detection of the obligate Wolbachia endosymbiont of D immitis. It was not possible to identify dogs with occult infections, which suggested that circulating microfilaria must be present to detect infection with this assay, although further studies would be required to verify that finding.

Parasitic filarial nematodes cause diseases in humans and other animals. In humans, various types of filarial nematodes, such as Onchocerca vulvulus and Wuchereria bancrofti, are estimated to infect 120 million people worldwide annually; 40 million people develop infection-associated clinical symptoms.1 Dirofilaria immitis is a mosquito-borne nematode that infects both dogs and cats. In dogs, D immitis infections are typically subclinical initially but, if untreated, can progress to development of chronic respiratory tract problems or cardiac abnormalities and can eventually result in death. Incidence of D immitis infections in dogs can be > 50% in some regions, and this rate is increasing in Europe.2,3

Early detection and treatment of heartworm infection in dogs when the parasite burden is low can lessen the effects of the parasitic infection as well as the possible adverse effects from treatment. Additionally, the ability to measure the parasite burden during treatment can be used to monitor the efficacy of the treatment regimen as well as to confirm when the parasite infection has been eliminated.

Dirofilaria immitis, similar to other filarial nematodes, harbor a distinctive bacterial endosymbiont from the Wolbachia group.4 Research has shown that this Wolbachia endosymbiont is necessary for the proper development of adult D immitis.5 Administration of tetracycline to kill the Wolbachia endosymbionts in some filarial nematodes prevents development of larval stages and inhibits embryogenesis in adult heartworms.6 During infection with D immitis, these endosymbiotic bacteria can elicit an immunologic response from the host.7 Although there is evidence of such an immune response caused by the endosymbionts, the exact role of the Wolbachia organisms in the pathological changes associated with heartworm infection is unknown.8,9

In the study reported here, a broad-range PCR–ESI-MS assay that was designed to detect a wide range of vector-borne pathogens was used to indirectly detect D immitis infection in dogs. In previous studies,10–13 several of the assay primers were successfully used to detect flaviviruses and Ehrlichia, Rickettsia, and Borrelia spp. The strength of this assay is that the primers broadly amplify nucleic acids of a group of pathogens; the resulting base count signatures can be used to detect and identify pathogens to the species level, as demonstrated by the detection and species identification of several Ehrlichia organisms (eg, Ehrlichia chaffensis and Ehrlichia ewingii) from clinical specimens.11 The assay used also involves primers for the broad-range detection of Babesia spp and Alphaproteobacteria, including the Wolbachia endosymbionts. Thus, the purpose of the study reported here was to evaluate whether an assay involving PCR amplification and ESI-MS of nucleic acid extracts from whole blood samples could be used for the detection of Dirofilaria immitis infection in dogs through identification of the obligate Wolbachia endosymbiont.

Materials and Methods

Infection and blood sample collection—Blood samples were obtained from a companya that maintains dogs infected with D immitis. Whole blood samples (10 mL of blood/dog, of which 1.25 mL was used for extraction) were collected from 29 D immitis–infected dogs and 10 uninfected dogs in the company's facility at the time of the study. Infected dogs were Beagles that had been previously inoculated with adult or larval D immitis under the guidance of an animal ethics committee. Adult heartworms were inoculated intraventricularly, and larvae were inoculated SC. Prior to blood sample collection, infection in these dogs was confirmed on the basis of results of screening whole blood samples for D immitis antigen. Uninfected dogs were also screened to confirm the absence of circulating D immitis antigen prior to collection of whole blood samples for use in the present study. For 16 of the 29 infected dogs, blood samples were examined for circulating microfilaria at the time of sample collection, and the number of parasites/20 μL was recorded for each dog. Each blood sample was collected in a 7-mL tube containing EDTA, immediately frozen, and transported for analysis.b

Extraction of DNA from blood samples—A combination of bead-beating cell lysis and magnetic bead isolation was used to extract nucleic acids from whole blood samples obtained from infected and uninfected dogs. For homogenization, 1.25 mL of each whole blood sample was placed in a single 2.0-mL screw-cap tubec filled with 1.35 g of 0.1-mm yttrium-stabilized zirconium oxide beads.d To each tube containing 1.25 mL of blood, proteinase K solutione (25 μL), 20% SDS solutionf (142 μL), extraction controlg (1 μL), and antifoam Ah (10 μL) were added. The mixture was then homogenized in a tissue homogenizeri at 6,200 revolutions/min for 90 seconds 3 times (5-second interval between events); total homogenization time was 270 seconds. Each homogenized lysate was incubated at 56°C for 15 minutes and then centrifuged for 3 minutes at 16,000 × g in a benchtop microcentrifuge. Subsequently, nucleic acids were isolated with a magnetic particle processor.j One milliliter of lysate was transferred to a 24-well deep-well platej along with lysis bufferg (1.1 mL) and magnetic particlesg (160 μL). Each lysate mixture was incubated for 16.5 minutes in the lysis buffer at 56°C. Specimens were then washed once in wash bufferk and 3 times in another wash bufferl (1-minute incubation for each wash step). The magnetic beads were then dried for 3 minutes at 65°C, and nucleic acids were eluted into 250 μL of elution bufferg by incubating the magnetic particles at 65°C for 3 minutes.

PCR and RT-PCR assay procedures—Detection of heartworm infection was performed with an assay involving PCR primers that were designed to detect a wide range of vector-borne pathogens by targeting conserved regions of DNA that border variable regions (Appendix 1). Primer pairs BCT3511, BCT3517, BCT2328, and INV4855 were run as a multiplex PCR procedure. A 1-step RT-PCR procedure was performed for the reactions containing primer pairs VIR2217 (single-plex reaction) and VIR2230 with BCT3570 (multiplex reaction). The remaining primer pairs were run in singleplex PCR procedures. For one of the primer pairs in the reactions, an internal positive control made from cloned synthetic DNAm (20 copies/reaction) was included. Each internal control was designed to be identical to the expected amplicon, with the exception of a 5-bp deletion to enable the control to be distinguished from the target-derived amplicon.

The PCR procedure was performed in a 50-μL reaction volume containing 10 μL of nucleic acid extract in a reaction mix that combined a 750nM concentration of each primer as previously described.10 The 1-step RT-PCR procedure was performed in a 50-μL reaction volume containing 10 μL of nucleic acid extract in a reaction mix that combined a 750nM concentration of each primer as previously described.14 Because all reactions for a sample were run in the same 96-well RT-PCR plate, cycling conditions were used for both the RT-PCR and PCR procedures as previously described.14

16S DNA sequence analysis—The presence of the Wolbachia endosymbiont in D immitis–infected dogs was confirmed via 16S DNA sequencing of a Wolbachia-positive specimen with primers 4F and 801R (Appendix 2) to amplify an 800-bp region of the 16S gene. The primers have an M13 tag sequence, which was used for the sequencing reactions. Nucleic acid extract from a blood sample of an infected dog included in the study was used as a representative extract of all D immitis–infected study dogs. Each 16S PCR assay was performed in a 40-μL reaction volume containing 1 μL of nucleic acid extract in a reaction mix composed of 1 U of immolase Taq polymerase, 20mM Tris (pH, 8.3), 75mM KCl, 1.5mM MgCl2, 0.4M betaine, 200μM deoxyadenosine triphosphate, 200μM deoxycytidine triphosphate, 200μM deoxythymidine triphosphate, 200μM deoxyguanosine triphosphate, 20mM sorbitol, 2 μg of sonicated poly A RNA/mL, 500 μg of ultrapure bovine serum albumin/mL, and a 750nM concentration of each primer. The following PCR cycling conditions were used to generate the 16S amplicons on an 96-well thermocyclern: 95°C for 10 minutes, followed by 8 cycles of 95°C for 15 seconds, 50°C for 45 seconds, and 72°C for 90 seconds, with the 50°C annealing temperature increasing 0.6°C for each cycle. The PCR assay then continued for 37 additional cycles of 95°C for 15 seconds, 60°C for 15 seconds, and 72°C for 60 seconds. The PCR cycle ended with a final extension of 4 minutes at 72°C, followed by a 4°C hold. The PCR amplicons were sequencedo with a DNA sequencer.p

MS and analysis—Mass spectrometry was performed with a biosensor.q After PCR amplification, 30-μL aliquots of each PCR product were desalted and analyzed via MS as previously described.10,11,15,16 Dogs were considered infected with D immitis when results yielded the appropriate base count for either the BCT3575 or BCT3570 primer pair.

Results

Infection status of dogs—For all 29 dogs that had been inoculated with D immitis (adult or larval forms), circulating D immitis antigen was detected in the blood samples at the time of collection. Samples were collected from the infected dogs at 3 to 55 months after inoculation (Table 1). Blood samples from all uninfected dogs yielded negative results for circulating D immitis antigen.

Table 1—

Results of a PCR–ESI-MS assay performed with each of 2 primer pairs (BCT3575 and BCT3570) to detect the Wolbachia endosymbiont of Dirofilaria immitis in whole blood samples collected from 29 dogs in which adult or larval D immitis had been previously inoculated.

Microfilarial status at time of blood sample collectionD immitis inoculationInterval after D immitis inoculation (mo)Wolbachia endosymbiont detected with BCT3575Wolbachia endosymbiont detected with BCT3570
YesNoYesNo
Not determined (n = 13)6 F and 6 M adults (5)5 (5)54
 10 F and 10 M adults (1)35 (1)1
 50 larva (3)22 (2)2
  33 (1)11
 250 larva (2)7 (2)22
 300 larva (1)7 (1)11
 400 larva (1)7 (1)11
Negative (0 microfilaria/20 μL of blood [5])10 F and 10 M adults (1*)7 (1) 1 1
 13 F and 13 M adults (1*)19 (1)11
 400 larva (3)3 (3)33
Positive (2 to 460 microfilaria/20 μL of blood [11])10 F and 10 M adults (3)19 (1)1 1
  55 (2)22
 13 F and 13 M adults (1)19 (1)11
 21 F and 20 M adults (1)24 (1)11
 50 larva (2)10 (2)22
 300 larva (4)11 (3)321
  19 (1)11

Values in parentheses representthe number of dogs (1 sample/dog).

Dog with occult infection.

— = Not applicable. F = Female. M = Male.

Detection of D immitis infections in canine blood samples via the PCR–ESI-MS assay—Whole blood samples from 29 dogs infected with D immitis and 10 uninfected dogs were used to estimate the ability of the assay under investigation (which was designed to detect a wide range of clinically relevant vector-borne pathogens) to identify D immitis infection in dogs via detection of the obligate Wolbachia endosymbiont of D immitis. Two of the assay primer pairs, BCT3575 and BCT3570, target Alphaproteobacteria and result in specific amplicons in the blood samples from dogs infected with D immitis (Figure 1). These signatures were not observed in blood samples collected from uninfected dogs. These base count signatures were also unique, compared with those of other Alphaproteobacteria that have been screened with these primers (data not shown).

Figure 1—
Figure 1—

Results of a PCR–ESI-MS assay performed with each of 2 primer pairs (BCT3575 [A] and BCT3570 [B]) to detect the Wolbachia endosymbiont of Dirofilaria immitis in a whole blood sample collected from a dog in which heartworm infection had been experimentally induced. For Wolbachia endosymbiont amplicon detection, primer pair BCT3575 targets rpoB and primer pair BCT3570 targets gltA; targets are conserved regions of endosymbiont DNA that border variable regions. The mass for both the forward and reverse strands of the amplicons are given. Between the major peaks in each panel, the numbers after the letters A, G, C, and T represent the amplicon base composition (ie, the number of adenine [A], guanine [G], cytosine [C], and thymine [T] bases).

Citation: American Journal of Veterinary Research 73, 6; 10.2460/ajvr.73.6.854

Blood samples collected from 16 of the 29 infected dogs were examined for circulating microfilaria at the time of sample collection; microfilarial status was not determined for the other 13 infected dogs. In the 13 D immitis antigen–positive blood samples for which the microfilarial status was unknown, the Wolbachia endosymbiont of D immitis was detected by BCT3575 and BCT3570 in all samples and in 9 samples, respectively (Table 1). In 11 blood samples in which microfilaria concentrations ranged from 2 to 460 microfilaria/20 μL of blood, the Wolbachia endosymbiont of D immitis was detected by BCT3575 and BCT3570 in all samples and in 10 samples, respectively. Two dogs had occult infections; the blood samples collected from those dogs were D immitis–antigen positive but microfilaria negative. The endosymbiont was not detected in the blood samples collected from dogs with occult heartworm infections. Additionally, the endosymbiont was not detected with either primer pair in blood samples collected from 3 dogs that had been inoculated with D immitis larvae 3 months earlier. The Wolbachia endosymbiont of D immitis was not detected by BCT3575 or BCT3570 in any blood sample collected from the 10 uninfected dogs. For all blood samples (from infected and uninfected dogs), no other pathogens were detected via the PCR–ESI-MS assay.

Identification of the Wolbachia endosymbiont of D immitis via 16S DNA sequencing—The presence of the Wolbachia endosymbiont of D immitis in the blood samples collected from infected dogs was confirmed via sequencing of the 16S amplicon from a representative sample of 1 infected dog. The sequencing results obtained matched that of the previously sequenced Wolbachia endosymbiont of D immitis (719/720 nucleotides; GenBank accession No. AF088187). No other 16S sequence was detected in the blood sample collected from that D immitis–infected dog.

Discussion

Companion and domestic animals can become infected with a wide range of vector-borne pathogens (bacteria, viruses, protozoa, and nematodes), which can be both life-threatening and difficult to diagnose. These animals also can serve as sentinel species for the spread of vector-borne pathogens to humans.17,18 To this end, we have developed a single broad-range PCR–ESI-MS assay to detect and identify a wide range of vector-borne pathogens important to animal health, including Spirochaetes (eg, Borrelia and Leptospira spp), Gammaproteobacteria (eg, Francisella spp), Alphaproteobacteria (eg, Ehrlichia, Anaplasma, Rickettsia, Bartonella, and Wolbachia spp), flaviviruses (eg, Powassan virus and tick-borne encephalitis virus), and protozoa (eg, Babesia spp). In the present study, we demonstrated the ability of this assay to identify D immitis infection in dogs via detection of the heartworm Wolbachia endosymbiont in whole blood samples. The entire assay process, from specimen preparation to result reporting, can be completed within 6 hours for 1 sample; moreover, the biosensor systemq used in the present study has a potential throughput of > 150 samples/24 h. Assay results provide veterinarians with useful information about a wide range of infectious organisms, including coinfections. To our knowledge, this is the first report of heartworm infection in dogs that was directly detected via assessment of blood samples by use of the PCR–ESI-MS assay.

Identification of D immitis infection has been routinely performed via microscopic detection of the circulating microfilaria or detection of circulating D immitis antigen via an ELISA or other immunochromatographic tests. Visual detection of circulating microfilaria requires examination of ≤ 1 mL of blood by a skilled technician, and a positive result can be overlooked. It has been previously reported that even in areas with a high prevalence of heartworm infection, approximately 20% of the infected dogs may not have circulating microfilaria, which creates challenges for visual detection methods.19 In the present study, the Wolbachia endosymbiont was detected in all blood samples that contained microfilaria, but it was not detected in blood samples from 2 dogs with occult infections, suggesting that circulating microfilaria might be required to detect the heartworm endosymbiont in canine blood samples. However, further controlled investigations of blood samples collected from dogs with occult infections would be needed to test this hypothesis. Nevertheless, results of the present study have suggested that the PCR–ESI-MS assay could be used in place of microscopy to detect D immitis infections in dogs with circulating microfilaria.

Similar to D immitis, Wolbachia bacteria are harbored by many other filarial nematodes, including pathogens of other domesticated animals (eg, Parafilaria bovicola in horses and Onchocerca spp in cattle) and humans (eg, W bancrofti, Onchocerca volvulus, and Brugia malayi).6 Due to the broad-range design of the assay, it may be possible to detect these and other filarial nematode infections in humans and other animals via detection of their respective obligate endosymbionts, although further studies would be required.

Heartworm is one of many vector-borne diseases that infect dogs. In the study reported here, a broad-range PCR–ESI-MS assay designed to detect vector-borne pathogens was used to identify D immitis infection in dogs through detection of the heartworm Wolbachia endosymbiont in whole blood samples. By use of the assay, whole blood samples collected from experimentally infected dogs with circulating microfilaria were analyzed and results confirmed D immitis infection. This assay can also detect a wide range of vector-borne bacterial, viral, and protozoal pathogens (including co-infections) in a single blood sample. Further controlled studies to evaluate the use of this PCR–ESI-MS assay for the diagnosis of D immitis infection in dogs in clinical settings are warranted.

ABBREVIATIONS

ESI

Electrospray ionization

MS

Mass spectrometry

RT

Reverse transcription

a.

TRS Labs Inc, Athens, Ga.

b.

Ibis Biosciences Inc, Carlsbad, Calif.

c.

Sarstedt AG & Co, Newton, NC.

d.

Glen Mills Inc, Clifton, NJ.

e.

Qiagen Inc, Valencia, Calif.

f.

Ambion Inc, Austin, Tex.

g.

Abbott Molecular Inc, Des Plaines, Ill.

h.

Sigma Chemical Co, St Louis, Mo.

i.

Precellys 24, Bioamerica Inc, Miami, Fla.

j.

Kingfisher Flex, Thermo Scientific, Waltham, Mass.

k.

Wash buffer I, Abbott Molecular Inc, Des Plaines, Ill.

l.

Wash buffer II, Abbott Molecular Inc, Des Plaines, Ill.

m.

Blue Heron Biotechnology Inc, Bothell, Wash.

n.

MJ Dyad, MJ Research Inc, Waltham, Mass.

o.

SeqWright Inc, Houston, Tex.

p.

ABI Prism 3730xl DNA sequencer, Applied Biosystems Inc, Foster City, Calif.

q.

PLEX-ID biosensor, Abbott Molecular Inc, Des Plaines, Ill.

References

  • 1 Mendoza N, Li A, Gill A, et al. Filariasis: diagnosis and treatment. Dermatol Ther 2009; 22:475490.

  • 2 Genchi C, Rinaldi L, Mortarino M, et al. Climate and Dirofilaria infection in Europe. Vet Parasitol 2009; 163:286292.

  • 3 Simon F, Morchon R, Gonzalez-Miguel J, et al. What is new about animal and human dirofilariosis? Trends Parasitol 2009; 25:404409.

  • 4 Sironi M, Bandi C, Sacchi L, et al. Molecular evidence for a close relative of the arthropod endosymbiont Wolbachia in a filarial worm. Mol Biochem Parasitol 1995; 74:223227.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 5 Bandi C, McCall JW, Genchi C, et al. Effects of tetracycline on the filarial worms B rugia pahangi and Dirofilaria immitis and their bacterial endosymbionts Wolbachia. Int J Parasitol 1999; 29:357364.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 6 Taylor MJ, Bandi C, Hoerauf A. Wolbachia bacterial endosymbionts of filarial nematodes. Adv Parasitol 2005; 60:245284.

  • 7 Kramer LH, Tamarozzi F, Morchon R, et al. Immune response to and tissue localization of the Wolbachia surface protein (WSP) in dogs with natural heartworm (Dirofilaria immitis) infection. Vet Immunol Immunopathol 2005; 106:303308.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 8 Kramer L, Simon F, Tamarozzi F, et al. Is Wolbachia complicating the pathological effects of Dirofilaria immitis infections? Vet Parasitol 2005; 133:133136.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 9 McCall JW, Genchi C, Kramer L, et al. Heartworm and Wolbachia: therapeutic implications. Vet Parasitol 2008; 158:204214.

  • 10 Crowder CD, Matthews HE, Schutzer S, et al. Genotypic variation and mixtures of Lyme Borrelia in Ixodes ticks from North America and Europe. PLoS ONE 2010; 5:e10650.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 11 Eshoo MW, Crowder CD, Li H, et al. Detection and identification of Ehrlichia species in blood by use of PCR and electrospray ionization mass spectrometry. J Clin Microbiol 2010; 48:472478.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 12 Grant-Klein RJ, Baldwin CD, Turell MJ, et al. Rapid identification of vector-borne flaviviruses by mass spectrometry. Mol Cell Probes 2010; 24:219228.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 13 Crowder CD, Rounds MA, Phillipson CA, et al. Extraction of total nucleic acids from ticks for the detection of bacterial and viral pathogens. J Med Entomol 2010; 47:8994.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 14 Eshoo MW, Whitehouse CA, Zoll ST, et al. Direct broad-range detection of alphaviruses in mosquito extracts. Virology 2007; 368:286295.

  • 15 Ecker JA, Massire C, Hall TA, et al. Identification of Acinetobacter species and genotyping of Acinetobacter baumannii by multilocus PCR and mass spectrometry. J Clin Microbiol 2006; 44:29212932.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 16 Muddiman DC, Anderson GA, Hofstadler SA, et al. Length and base composition of PCR-amplified nucleic acids using mass measurements from electrospray ionization mass spectrometry. Anal Chem 1997; 69:15431549.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 17 Duncan AW, Correa MT, Levine JF, et al. The dog as a sentinel for human infection: prevalence of Borrelia burgdorferi C6 antibodies in dogs from southeastern and mid-Atlantic states. Vector Borne Zoonotic Dis 2005; 5:101109.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 18 Hamer SA, Tsao JI, Walker ED, et al. Use of tick surveys and serosurveys to evaluate pet dogs as a sentinel species for emerging Lyme disease. Am J Vet Res 2009; 70:4956.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 19 Nelson CT, McCall JW, Rubin SB, et al. 2005 guidelines for the diagnosis, prevention and management of heartworm ( Dirofilaria immitis) infection in dogs. Vet Parasitol 2005; 133:255266.

    • Crossref
    • Search Google Scholar
    • Export Citation

Appendix 1

Primers, gene targets, and bacterial targets used in a PCR–ESI-MS assay to identify Dirofilaria immitis infection in dogs through detection of the heartworm Wolbachia endosymbiont in whole blood samples.

Primer pairPrimer identifierPrimer sequence (5′ to 3′)Gene targetBacterial target clade or genus      
BCT3511BCT8229FTGCATTTGAAAGCTTGGCATTGCCgyrBAll Spirochaetes      
 BCT8230RTCATTTTAGCACTTCCTCCAGCAGAATC        
BCT3514BCT8235FTTTGGTACCACAAAGGAATGGGArpoCAll Spirochaetes      
 BCT8236RTGCGAGCTCTATATGCCCCAT        
BCT3517BCT8241FTGCTGAAGAGCTTGGAATGCAflagellinAll Borrelia spp      
 BCT8242RTACAGCAATTGCTTCATCTTGATTTGC        
BCT2328BCT5602FTGAGGGTTTTATGCTTAAAGTTGGTTTTATTGGTTasdFrancisella tularensis      
 BCT5603RTGATTCGATCATACGAGACATTAAAACTGAG        
BCT1083BCT2764FTAAGAGCGCACCGGTAAGTTGGRNasePAll Rickettsia spp      
 BCT2763RTCAAGCGATCTACCCGCATTACAA        
BCT3570BCT8336FTGCATGCAGATCATGAACAGAATGCgltAAlphaproteobacteria      
 BCT8337RTCCACCATGAGCTGGTCCCCA        
BCT3575BCT8346FTGCATCACTTGGTTGATGATAAGATACATGCrpoBAlphaproteobacteria      
 BCT8347RTCACCAAAACGCTGACCACCAAA        
INV4443INV10034FTGCGCAAATTACCCAATCCTGACAC18S rRNAAll Babesia spp      
 INV10035RTCCAGACTTGCCCTCCAATTGGTA        
INV4855INV10812FTGAGAGAAATCGTACACATTCAAGCGGGβ-tubulinAll Babesia spp      
 INV10813RTCCATGTTCGTCGGAGATGACTTCCCA        
VIR2217VIR5397FTGTGTCTACAACATGATGGGAAAGAGAGARdRpFlaviviruses      
 VIR5398RTGCTCCCAGCCACATGTACCA        
VIR2230VIR5420FTCACACCGTGGCTGGCATGGCARdRpFlaviviruses      
 VIR5421RTCCTCTGGGCCTTCCCATGTCCA        
PLN4437PLN10022FTGACGAGTTCATGAGGGCAGGC Extraction control      
 PLN10023RTCTGGCCTTTCAGCAAGTTTCCAAC        

Appendix 2

Primers used for amplification and sequencing of 16S DNA of the heartworm Wolbachia endosymbiont in a whole blood sample collected from a dog with experimentally induced D immitis infection.

PrimerPrimer sequence (5′ to 3′)
4FM13F/TTGGAGAGTTTGATCCTGGCTC
801RM13R/GGCGTGGACTTCCAGGGTATCT
M13FCCCAGTCACGACGTTGTAAAACG
M13RAGCGGATAACAATTTCACACAGG

Contributor Notes

Supported by the National Institute of Allergy and Infectious Diseases grant No. 2R44AI077156-02.

The content of this report is solely the responsibility of the authors and does not necessarily represent the official views of the National Institute of Allergy and Infectious Diseases or the National Institutes of Health.

Address correspondence to Dr. Crowder (christopher.crowder@abbott.com).