Previously, it was widely believed that neurons are formed only during development, but neurogenesis is now generally accepted to occur throughout adulthood in most mammals.1–3 In adult CNS, 2 major neurogenic zones have been identified. New neurons are generated in the SVZ adjacent to the lateral ventricles and in the SGZ of the dentate gyrus in the hippocampus.1,4,5 Although not fully understood, the weight of evidence suggests that a stem cell population residing in these niche regions of the brain gives rise to these neuronal populations.1–5 Stem cells are defined as multipotent cells with the capacity for self-renewal. The ability to self-renew allows NSCs to produce large numbers of daughter NSCs as well as NPCs that have the ability to differentiate into multiple lineages, including neurons, astrocytes, and oligodendrocytes.6,7
New neurons from the SVZ course through the rostral migratory stream to populate the olfactory bulbs,6–8 and studies9,10 also suggest that these cells can migrate and repopulate injured areas of the brain. Neurogenesis in the SGZ is believed to be important in the development and processing of new memories.1,6 In addition, cancer stem cells have emerged as important entities in the development of a number of solid tumors, notably malignant gliomas and ependymomas.11,12 Therefore, identification and understanding of NSC populations and neurogenesis are critical to understanding brain development, developing new strategies for CNS repair, and identifying new treatments for CNS neoplasia.13
Stem cells also have enormous potential in regenerative medicine. Strategies such as cellular transplantation or stimulation of endogenous NSCs to migrate to and populate areas of injury are being studied to treat or even potentially cure a variety of CNS diseases, such as stroke and neurodegenerative disease.14 Rodents are frequently used to model these disease processes, with the ultimate goal of extrapolating findings to human patients. However, problems inherent with such an approach include the inbred nature of many rodent strains, differences in life span, size limitations, and a lack of spontaneous development of disease in most strains. In addition to the obvious interest to veterinarians and the clients they serve, dogs are increasingly used to study a variety of human neurologic diseases.15 The canine nervous system is much closer in size to that of humans than of rodents, alleviating some concerns regarding scalability and technical limitations such as cellular migration. In addition, dogs may have CNS diseases that are similar to human conditions, including spinal cord injury,16,17 brain tumors,18 and hereditary neurodegenerative disorders.19,20 Such conditions may benefit from targeting of endogenous NSC populations or transplantation of these populations. Therefore, investigation of NSCs in adult dogs is of potential interest to both veterinarians and comparative medicine researchers.
There have been several studies15,19,21 of isolation of NSCs or NPCs from canine brain tissue; however, those studies used tissue from fetal or neonatal animals. Recently, cancer cells with stem-like properties and phenotype (cancer stem cells) were isolated from a glioblastoma in an older dog.22 The authors of that study22 hypothesized that this tumor originated from an adult population of stem cells within the SVZ. However, the persistence of such a population of cells, although documented in rodents and humans,6,23,24 has not been detected in dogs. The purpose of the study reported here was to identify and characterize populations of cells with progenitor and stem cell–like properties in the brain of mature dogs.
Materials and Methods
Tissue preparation—Five adult Beagles and 2 adult mixed-breed dogs of various ages (10, 12, 13, 23, 23, 24, and 60 months) were used for this study. There were 5 males and 2 females. All dogs were members of a research colony at the North Carolina State University College of Veterinary Medicine and were euthanized with pentobarbital sodium for reasons unrelated to this study. After euthanasia, the brains were removed and carefully separated from the meninges, placed into a balanced salt solution,a and grossly dissected. Reported methods for the isolation of NPCs were used.25–27 Briefly, the SVZ and SGZ were separated from the brain, minced, and digested in an enzyme solution at 37°C for 40 minutes. The enzymatic digestion was stopped with the addition of an inhibitory solution and incubation at 37°C for 2 minutes. The enzyme solution was composed of dissociation medium, with cysteine (3.2 mg/mL) and papain (10 μL/mL) added. The inhibitory solution was composed of dissociation medium, with bovine serum albumin (10 mg/mL) and trypsin inhibitor (10 mg/mL) added. Dissociation medium was composed of Na2SO4 (98mM), K2SO4 (30mM), MgCl2 (5.8mM), CaCl2 (0.25mM), HEPES (1mM), glucose (20mM), phenol red (0.001%), and NaOH (0.125mN). The tissue was triturated to a single cell suspension, and the total number of viable cells was determined by manual counting on a hemocytometer after the addition of 0.4% trypan blue.
Adult canine NPC culture—Suspended single cells were cultured on a noncoated, 6-well plateb at a concentration of 1 × 106 cells/well (1 × 105 cells/cm2) in neurobasal mediumc supplemented with 2% B27,d 1% N2,e and 0.1% penicillin-streptomycinf with 10 ng of bFGFg/mL and 100 ng of rhEGFh/mL. The cultures were maintained at 37°C and 5% CO2 in a humidified tissue culture incubator. Once neurospheres formed, half of the medium was replaced every 3 to 5 days. Passage was performed by dissociation of the neurospheres when their diameter reached 100 to 150 μm, which took 7 to 14 days. First and subsequent passage cells were cultured at 1 × 104 cells/cm2. To differentiate the NPCs, the neurospheres were plated into chamber slidesi in the supplemented neurobasal medium with 1% FBSj and cultured for 7 days.
RNA isolation and RT-PCR characterization of NPCs—Secondary neurospheres were washed twice with PBS solution, trypsinized, and then lysed directly in the collecting tube. The total RNA was extracted with an RNA purification kit,k and then cDNA was synthesized from total RNA with a cDNA synthesis kitl according to the manufacturer's directions. For thermal cycling, DNA polymerasem was used. The DNA was amplified in 32 cycles with a melting step of 98°C for 5 seconds, annealing at 55°C for 5 seconds, and extension at 72°C for 5 seconds. Specific primers were used for canine OCT4, NANOG, SOX2, nestin, NCAM, neuronal class III β-tubulin, GFAP, and β-actin (Appendix).28–30 The PCR products were loaded onto 1.5% agarose gels with ethidium bromide and visualized with UV transillumination.
Immunocytochemical staining—Evaluation of the presence of neural markers was performed in both floating secondary neurospheres and neurospheres that were differentiated for 7 to 13 days. The neurospheres were fixed with 4% paraformaldehyde (pH, 7.4) in PBS solution for 30 minutes at room temperature (21°C), rinsed 3 times in PBS solution, and permeabilized with a 0.3% solution of nonionic surfactantn for 15 minutes. After 3 additional PBS solution rinses, a blocking solution of 1% bovine serum albumin in PBS solution was applied for 50 minutes. Cells were then incubated overnight at 4°C with one of the following antibodies: polyclonal rabbit anti-GFAPo (1:1,000), monoclonal mouse anti–neuronal class III β-tubulinp (Tuj1, 1:500), monoclonal mouse anti-CNPaseq (1:200), or monoclonal mouse anti-nestinr (1:200). Cells were then incubated for 1 hour with either goat anti-rabbits (1:1,000) or goat anti-mouset–(1:1,000) conjugated secondary antibodies and counterstained with 4′, 6-diamidino-2-phenylindole.u For positive controls, immunohistochemical staining of frozen sections of normal canine brain was performed, which revealed labeling of cells with the appropriate morphology and in the appropriate region for all antibodies. Preparation of negative controls included omission of the primary antibody, substitution of irrelevant isotype matched controls, and use of antibodies for antigens not expected in neural stem or progenitor populations. Immunostaining was visualized on a fluoromicroscope.v
Results
Culture of NPCs from the SVZ and SGZ—Neurospheres were generated from both the SVZ and SGZ (Figure 1). However, the SVZ produced greater numbers of primary (ie, first passage) neurospheres than did the SGZ. After passage, secondary neurospheres could be detected as early as day 4, and the time taken to form secondary spheres was similar between SVZ and SGZ cultures. The secondary spheres were morphologically similar to the primary spheres. Up to 5 passages could be performed, maintaining similar cellular morphology, although few spheres were generated after the fifth passage. Some cells grew as an adherent monolayer, with primarily bipolar or fusiform morphologies. Attempts to isolate primary neurospheres from other regions of the CNS, including the cerebellar nuclei, cerebellar cortex, and cervical spinal cord, were unsuccessful.
Characterization of canine NPCs. A—Photomicrograph of neurospheres in neurobasal medium supplemented with bFGF and rhEGF after 14 days in culture. Bar = 100 μm. B—Photomicrograph of individual cells in cultures with identical conditions; the cells are small, round, and bipolar or unipolar with short processes. Bar = 50 μm. C—Agarose gel electrophoretogram of RT-PCR assay detection of stem, progenitor, and neural markers in undifferentiated secondary neurospheres. First lane on the left side is a 50-bp ladder.
Citation: American Journal of Veterinary Research 73, 12; 10.2460/ajvr.73.12.1963
RT-PCR assay of NPCs—Secondary undifferentiated neurospheres were assayed via RT-PCR assay for expression of phenotypic markers. Analysis of markers of pluripotency in neurospheres isolated from both the SVZ and SGZ revealed positive expression of SOX2 but an absence of OCT4 and NANOG. Expression of the neural markers nestin, NCAM, neuronal class III β-tubulin (Tuj1), and GFAP was also noted (Figure 1).
Immunocytochemical staining and morphology of undifferentiated and differentiated NPCs—Glial fibrillary acidic protein, neuronal class III β-tubulin, and nestin antibodies were used to identify the expression of these molecules within neurospheres. Both GFAP and nestin were abundantly expressed in floating (undifferentiated) neurospheres, whereas only rare expression of neuronal class III β-tubulin was observed (Figure 2). After changing to differentiation medium, the neurospheres became adherent to the culture wells and cells migrated out of the spheres (Figure 3). Migrating cells began extending long processes from the neurospheres, and cells migrating completely out of the sphere became flattened and had a stellate morphology. These cellular processes were GFAP or neuronal class III β-tubulin positive, without the expression of nestin, although patchy nestin expression was observed within the neurospheres. Some processes expressed both GFAP and neuronal class III β-tubulin. Most adherent stellate cells were GFAP positive, although CNPase-positive cells were noted in a number of areas.
Photomicrographs of neurospheres under nondifferentiating conditions. Neurospheres have been fixed and immunostained for Nestin, GFAP, or neuronal class III β-tubulin (Tuj1) with 4′, 6-diamidino-2-phenylindole (DAPI) counterstaining. Nestin and GFAP were both widely expressed (A), whereas neuronal class III β-tubulin (Tuj1) was restricted to only a few cells (B). Immunohistochemical staining; bar = 100 μm (A and B).
Citation: American Journal of Veterinary Research 73, 12; 10.2460/ajvr.73.12.1963
Photomicrographs of neurospheres under differentiating conditions, 7 to 13 days after the withdrawal of growth factors and the addition of 1% FBS. Neurospheres have been fixed and immunostained for Nestin, GFAP, CNPase, or neuronal class III β-tubulin (Tuj1) with 4′, 6-diamidino-2-phenylindole counterstaining. A—Photomicrograph revealing long GFAP-positive, nestin-negative cellular processes extending from a neurosphere (arrows) with adjacent flattened and adherent GFAP-positive cells (arrowheads). B—Photomicrograph of GFAP-positive, Nestin-negative cellular processes extending from a neurosphere. Notice nestin-positive cells within neurosphere. C—Photomicrograph of flattened GFAP-positive and CNPase-positive cells that have migrated out of the neurospheres. D—Photomicrograph of long cellular processes expressing GFAP, neuronal class III β-tubulin, or a combination of both markers. Immunohistochecmical staining; bar = 200 μm (A) and 100μm (B–D).
Citation: American Journal of Veterinary Research 73, 12; 10.2460/ajvr.73.12.1963
Discussion
In the present study, isolation of NPCs from both the SVZ and SGZ regions of mature dogs between 1 and 5 years of age was accomplished. These NPCs formed neurospheres, which expressed SOX2, nestin, GFAP, neuronal class III β-tubulin, and NCAM and gave rise to GFAP-positive, neuronal class III β-tubulin–positive, and CNPase-positive progeny. Serial passages suggested some ability to self-renew, although the generation of new spheres was impaired after the fifth passage.
Morphological characteristics of the neurospheres were similar to those of spheres generated from neonatal dogs, rodents, and pigs under similar conditions.5,31 The spheres appeared after a longer period of time in culture than did those isolated from rodents (2 to 4 days) but were similar to those of neonatal dogs (6 to 18 days) and adult pigs (8 to 10 days).5,15,21 The total number of primary neurospheres collected from the SVZ was about 4 times that of the SGZ. This higher yield from the SVZ, compared with other brain regions, has also been noted in rodents by other investigators.32 In an in vitro study,19,21 neurospheres from early postnatal canine olfactory bulb–derived NPCs were expanded up to 28 generations and SVZ NPCs were passaged up to 10 times. In the present study, NPCs from adult canine SVZ and SGZ could not be expanded past the fifth generation under similar conditions, which likely reflects a greater representation of NPCs within the neurospheres, rather than bona fide stem cells.32,33 Recent studies34,35 have found a marked reduction in neurogenesis in the SGZ of aged dogs, compared with young dogs. Those studies34,35 used immunohistochemical evaluation of doublecortin, a marker expressed in recently born neurons, to identify neurogenesis.
Alternatively, it is possible that the failure of these NPCs to expand past the fifth generation is an artifactual phenomenon related to our specific cell culture conditions. Similarly impaired expansion of neurosphere cultures has been noted by other investigators, even in cultures obtained from fetal tissues.36,37 Mechanical dissociation of neurosphere cultures during passage may lead to cellular death or senescence due to trauma, stress, or disruption of cell-cell contact.38 True NSCs are rare, relatively quiescent, and found within intricate, tightly controlled niches within the CNS.39,40 Survival and proliferation within this environment depend in part on contact of NSCs with other cells and extracellular matrix, which is lost in most cell culture systems.38–40 Other factors, such as telomerase depletion, may also lead to the senescence of cells in culture over time.41,42 There is also evidence of a substantial species difference in the proliferative ability of neurosphere cultures. Many initial studies37,41,42 that found extensive expansion used murine tissue, whereas cultures from rat and human sources have substantially less proliferative ability, explainable in part by differences in telomerase expression. Canine tissue appears to behave similarly to rat and human tissue in this respect.
Since adult neurogenesis was first documented, debate has centered on the identity of the adult NSCs, with 2 main camps emerging. Although there is some evidence supporting an ependymal origin, most neuroscientists support an astrocytic lineage for the NSCs.2,4,13,43,44 The SOX2 is a transcription factor expressed in embryonic stem cells, which, along with NANOG and OCT4, serves to maintain pluripotency.45 The SOX2 is also expressed by neuroepithelial cells during development.46 Studies4,47 have indicated that adult NSCs are SOX2-positive, nestin-positive cells that also express the astrocytic marker GFAP. Most reports conclude that OCT4 and NANOG are not expressed in adult NSCs,48 although some investigators have detected NANOG at low concentrations.49 Our data are consistent with this prior work and suggest the presence of SOX2-positive, nestin-positive, GFAP-positive, OCT4-negative, NANOG-negative NSCs in specific niches of the mature canine brain.
It has also been suggested that adult stem cells express markers associated with differentiated cells in mature tissue.50 In the study reported here, neurospheres isolated from adult canine SVZ and SGZ expressed not only SOX2, nestin, and GFAP at the mRNA level but also NCAM and neuronal class III β-tubulin, which are markers of neuronal differentiation. However, neuronal class III β-tubulin was only rarely detected in undifferentiated neurospheres via immunohistochemical staining. These findings are similar to those of studies5,19,21 of neurospheres isolated from the SVZ in adult pigs and olfactory bulb in neonatal dogs, which had robust expression of GFAP and nestin and lower numbers of cells expressing neuronal markers.
Neural progenitor cells can be induced to differentiate in culture by withdrawal of both bFGF and rhEGF and the addition of 1% FBS.19,21,27 In the study reported here, such treatment resulted in the formation of long cellular processes that migrated out of the neurospheres and cells that became flattened and stellate in shape after migration. By use of double immunostaining, cells remaining in the neurospheres were often nestin positive, but migrating cells and their processes were nestin negative and GFAP positive or neuronal class III β-tubulin positive 7 days after differentiation. In addition, GFAP-positive cells that were morphologically consistent with astrocytes were seen at the same time periods. Finally, a subset of cells expressed CNPase, an oligodendroglial cell marker. Results suggested that the multistage process of neurogenesis was recapitulated in vitro after differentiation of the neurospheres.
In conclusion, neurospheres were generated from the SVZ and SGZ of mature (age, 1 to 5 years) dogs and had characteristics similar to those reported in mice, pigs, and embryonic and early postnatal dogs. Genetic and immunocytochemical studies suggested the persistence of SOX2-positive, nestin-positive, GFAP-positive, OCT4-negative, NANOG-negative NPCs within these regions of the mature canine brain. However, the expansion and self-renewal capacity of the cells in the present study were lower than those in other studies that used fetal and neonatal canine tissue, suggesting a predominance of NPCs in this system, as opposed to true NSCs. Nonetheless, this is the first study of the persistence of a population of cells with progenitor or stem cell–like properties in mature canine brain tissue and may serve as a basis for future studies investigating the role of these cells in various disease processes or for regenerative purposes.
ABBREVIATIONS
| bFGF | Basic fibroblast growth factor |
| CNPase | 2′, 3′-cyclic nucleotide 3′-phosphodiesterase |
| FBS | Fetal bovine serum |
| GFAP | Glial fibrillary acidic protein |
| NCAM | Neural cell adhesion molecule |
| NPC | Neural progenitor cell |
| NSC | Neural stem cell |
| rhEGF | Recombinant human epidermal growth factor |
| RT | Reverse transcriptase |
| SGZ | Subgranular zone |
| SVZ | Subventricular zone |
Hank's buffered salt solution, Cellgro, Mediatech Inc, Manassa, Va.
Ultra low cluster 6-well plate Costar, Corning Inc, Corning, NY.
Neurobasal Medium, Gibco-BRL, Carlsbad, Calif.
B27, Gibco-BRL, Carlsbad, Calif.
N2, Gibco-BRL, Carlsbad, Calif.
Penicillin-streptomycin, Gibco-BRL, Carlsbad, Calif.
bFGF, Invitrogen, Carlsbad, Calif.
rhEGF, Invitrogen, Carlsbad, Calif.
Lab-tek Chamber Slides, Thermo Scientific, Rochester, NY.
FBS, Gibco-BRL, Carlsbad, Calif.
RNeasy Plus Mini kit, QIAGEN, Valencia, Calif.
Superscript III kit, Invitrogen, Carlsbad, Calif.
Phire Hot Start II DNA Polymerase, Thermo Scientific, Rockford, Ill.
Triton X-100, Sigma-Aldrich, St Louis, Mo.
Polyclonal rabbit anti-GFAP antibody, DAKO, Carpinteria, Calif.
Monoclonal mouse anti-βIII-tubulin antibody (Tuj1), Covance, Princeton, NJ.
Monoclonal mouse anti-CNPase antibody (11–5B), abcam, Cambridge, Mass.
Monoclonal mouse anti-human Nestin antibody (10C2), Millipore, Billerica, Mass.
Goat anti-rabbit Alexa 488 antibody, Invitrogen, Carlsbad, Calif.
Goat anti-mouse Cy3 antibody, Millipore, Billerica, Mass.
DAPI, Vector Laboratories, Burlingame, Calif.
AZ100 Macro/microscope, Nikon, Japan.
References
1. Kempermann G. Why new neurons? Possible functions for adult hippocampal neurogenesis. J Neurosci 2002;22:635–638.
2. Taupin P, Gage FH. Adult neurogenesis and neural stem cells of the central nervous system in mammals. J Neurosci Res 2002;69:745–749.
3. Ming GL, Song H. Adult neurogenesis in the mammalian central nervous system. Annu Rev Neurosci 2005;28:223–250.
4. Duan X, Kang E, Liu CY, et alDevelopment of neural stem cell in the adult brain. Curr Opin Neurobiol 2008;18:108–115.
5. Liard O, Segura S, Pascual A, et alIn vitro isolation of neural precursor cells from the adult pig subventricular zone. J Neurosci Methods 2009;182:172–179.
6. Zhao C, Deng W, Gage FH. Mechanisms and functional implications of adult neurogenesis. Cell 2008;132:645–660.
7. Ma DK, Bonaguidi MA, Ming GL, et alAdult neural stem cells in the mammalian central nervous system. Cell Res 2009;19:672–682.
8. Ghashghaei HT, Lai C, Anton ES. Neuronal migration in the adult brain: are we there yet? Nat Rev Neurosci 2007;8:141–151.
9. Magavi SS, Leavitt BR, Macklis JD. Induction of neurogenesis in the neocortex of adult mice. Nature 2000;22:951–955.
10. Faiz M, Acarin L, Villapol S, et alSubstantial migration of SVZ cells to the cortex results in the generation of new neurons in the excitotoxically damaged immature rat brain. Mol Cell Neurosci 2008;38:170–182.
11. Singh SK, Hawkins C, Clarke ID, et alIdentification of human brain tumour initiating cells. Nature 2004;432:396–401.
12. Piccirillo SG, Binda E, Fiocco R, et alBrain cancer stem cells. J Mol Med 2009;87:1087–1095.
13. Kriegstein A, Alvarez-Buylla A. The glial nature of embryonic and adult neural stem cells. Annu Rev Neurosci 2009;32:149–184.
14. Döbrössy M, Busse M, Piroth T, et alNeurorehabilitation with neural transplantation. Neurorehabil Neural Repair 2010;24:692–701.
15. Milward EA, Lundberg CG, Ge B, et alIsolation and transplantation of multipotential populations of epidermal growth factor-responsive, neural progenitor cells from the canine brain. J Neurosci Res 1997;50:862–871.
16. Olby N, Harris T, Burr J, et alRecovery of pelvic limb function in dogs following acute intervertebral disc herniations. J Neurotrauma 2004;21:49–59.
17. Smith PM, Jeffery ND. Histological and ultrastructural analysis of white matter damage after naturally-occurring spinal cord injury. Brain Pathol 2006;16:99–109.
18. Thomas R, Duke SE, Wang HJ, et al‘Putting our heads together’: insights into genomic conservation between human and canine intracranial tumors. J Neurooncol 2009;94:333–349.
19. Walton RM, Wolfe JH. Abnormalities in neural progenitor cells in a dog model of lysosomal storage disease. J Neuropathol Exp Neurol 2007;66:760–769.
20. Awano T, Johnson GS, Wade CM, et alGenome-wide association analysis reveals a SOD1 mutation in canine degenerative myelopathy that resembles amyotrophic lateral sclerosis. Proc Natl Acad Sci U S A 2009;106:2794–2799.
21. Walton RM, Wolfe JH. In vitro growth and differentiation of canine olfactory bulb-derived neural progenitor cells under variable culture conditions. J Neurosci Methods 2008;169:158–167.
22. Stoica G, Lungu G, Martini-Stoica H, et alIdentification of cancer stem cells in dog glioblastoma. Vet Pathol 2009;46:391–406.
23. Reynolds BA, Weiss S. Generation of neurons and astrocytes from isolated cells of the adult mammalian central nervous system. Science 1992;255:1707–1710.
24. Eriksson PS, Perfilieva E, Björk-Eriksson T, et alNeurogenesis in the adult human hippocampus. Nat Med 1998;4:1313–1317.
25. Ghashghaei HT, Weimer JM, Schmid RS, et alReinduction of ErbB2 in astrocytes promotes radial glial progenitor identity in adult cerebral cortex. Genes Dev 2007;21:3258–3271.
26. Jacquet BV, Salinas-Mondragon R, Liang H, et alFoxJ1-dependent gene expression is required for differentiation of radial glia into ependymal cells and a subset of astrocytes in the postnatal brain. Development 2009;136:4021–4031.
27. Deleyrolle LP, Reynolds BA. Isolation, expansion, and differentiation of adult Mammalian neural stem and progenitor cells using the neurosphere assay. Methods Mol Biol 2009;549:91–101.
28. Vaags AK, Rosic-Kablar S, Gartley CJ, et alDerivation and characterization of canine embryonic stem cell lines with in vitro and in vivo differentiation potential. Stem Cells 2009;27:329–340.
29. Valenzuela MJ, Dean SK, Sachdev P, et alNeural precursors from canine skin: a new direction for testing autologous cell replacement in the brain. Stem Cells Dev 2008;17:1087–1094.
30. Hayes B, Fagerlie SR, Ramakrishnan A, et alDerivation, characterization, and in vitro differentiation of canine embryonic stem cells. Stem Cells 2008;26:465–473.
31. Singec I, Knoth R, Meyer RP, et alDefining the actual sensitivity and specificity of the neurosphere assay in stem cell biology. Nat Methods 2006;3:801–806.
32. Marshall GP II, Reynolds BA, Laywell ED. Using the neurosphere assay to quantify neural stem cells in vivo. Curr Pharm Biotechnol 2007;8:141–145.
33. Reynolds BA, Rietze RL. Neural stem cells and neurospheres—re-evaluating the relationship. Nat Methods 2005;2:333–336.
34. Pekcec A, Baumgärtner W, Bankstahl JP, et alEffect of aging on neurogenesis in the canine brain. Aging Cell 2008;7:368–374.
35. Siwak-Tapp CT, Head E, Muggenburg BA, et alNeurogenesis decreases with age in the canine hippocampus and correlates with cognitive function. Neurobiol Learn Mem 2007;88:249–259.
36. Svendsen CN, Caldwell MA, Shen J, et alLong-term survival of human central nervous system progenitor cells transplanted into a rat model of Parkinson's disease. Exp Neurol 1997;148:135–146.
37. Svendsen CN, Skepper J, Rosser AE, et alRestricted growth potential of rat neural precursors as compared to mouse. Brain Res Dev Brain Res 1997;99:253–258.
38. Svendsen CN, ter Borg MG, Armstrong RJ, et alA new method for the rapid and long term growth of human neural precursor cells. J Neurosci Methods 1998;85:141–152.
39. Scadden DT. The stem-cell niche as an entity of action. Nature 2006;441:1075–1079.
40. Singec I, Quinones-Hinojosa A. Neurospheres. In: Gage FH, Kempermann G, Song H, eds. Adult neurogenesis. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press, 2008;119–134.
41. Ostenfeld T, Caldwell MA, Prowse KR, et alHuman neural precursor cells express low levels of telomerase in vitro and show diminishing cell proliferation with extensive axonal outgrowth following transplantation. Exp Neurol 2000;164:215–226.
42. Wright LS, Prowse KR, Wallace K, et alHuman progenitor cells isolated from the developing cortex undergo decreased neurogenesis and eventual senescence following expansion in vitro. Exp Cell Res 2006;312:2107–2120.
43. Wang DD, Bordey A. The astrocyte odyssey. Prog Neurobiol 2008;86:342–367.
44. Doetsch F. The glial identity of neural stem cells. Nat Neurosci 2003;6:1127–1134.
45. Chambers I, Tomlinson SR. The transcriptional foundation of pluripotency. Development 2009;136:2311–2322.
46. Ferri AL, Cavallaro M, Braida D, et alSox2 deficiency causes neurodegeneration and impaired neurogenesis in the adult mouse brain. Development 2004;131:3805–3819.
47. Suh H, Consiglio A, Ray J, et alIn vivo fate analysis reveals the multipotent and self-renewal capacities of Sox2+ neural stem cells in the adult hippocampus. Cell Stem Cell 2007;1:515–528.
48. Kim JB, Zaehres H, Wu G, et alPluripotent stem cells induced from adult neural stem cells by reprogramming with two factors. Nature 2008;454:646–650.
49. Lee SH, Jeyapalan JN, Appleby V, et alDynamic methylation and expression of Oct4 in early neural stem cells. J Anat 2010;217:203–213.
50. Alvarez-Buylla A, Garcia-Verdugo JM, Tramontin AD. A unified hypothesis on the lineage of neural stem cells. Nat Rev Neurosci 2001;2:287–293.
Appendix
Canine specific RT-PCR primer sequences.
| Gene | Primers (5′-3′) | Expected amplicon size (bp) | Reference |
|---|---|---|---|
| Pluripotency markers | |||
| NANOG | F: CCTGCATCCTTGCCAATGTC | 100 | 28 |
| R: TCCGGGCTGTCCTGAGTAAG | |||
| OCT4 | F: GTCACCACTCTGGGCTCTCC | 118 | |
| R:TCCCCGAAACTCCCTGCCTC | |||
| SOX2 | F: GTCCCAGCACTACCAGAGCG | 150 | |
| R: CTTACTCTCCTCCCATTTCCCTCG | |||
| Neural progenitor markers | |||
| Nestin | F: GAGAACCAGGAGCAAGTGAA | 328 | 29 |
| R: TTTCCAGAGGCTTCAGTGTC | |||
| NCAM | F: AGGCAGAGCATAGTGAATGC | 343 | |
| R: AGGCTTCACAGGTCAGAGTG | |||
| Neuronal class III β-tubulin | F: GCACACTGCTCATCAACAAG | 539 | |
| R: TCTTGCTCTCCTTCATGGAC | |||
| GFAP | F: CGAGTTACCAGGAGGCACTA | 276 | |
| R: TCCACGGTCTTTACCACAAT | |||
| Housekeeping gene | |||
| β-actin | F: GATGACGATATCGCTGCGCTTGTG | 444 | 30 |
| R: CATCACGATGCCAGTGGTGCGG | |||
F = Forward. R = Reverse.
