Transcriptional changes associated with recurrent airway obstruction in affected and unaffected horses

Changaram S. Venugopal Equine Health Studies Program, Department of Veterinary Clinical Sciences, School of Veterinary Medicine, Louisiana State University, Baton Rouge, LA 70803.

Search for other papers by Changaram S. Venugopal in
Current site
Google Scholar
PubMed
Close
 BVSc, PhD
,
Luiz Claudio N. Mendes Department of Clinics, Surgery and Animal Reproduction, Sao Paulo State University, UNESP, R Clovis Pestana 793, Aracatuba, SP 16050-680, Brazil.

Search for other papers by Luiz Claudio N. Mendes in
Current site
Google Scholar
PubMed
Close
 DVM, PhD
,
Juliana R. Peiró Department of Clinics, Surgery and Animal Reproduction, Sao Paulo State University, UNESP, R Clovis Pestana 793, Aracatuba, SP 16050-680, Brazil.

Search for other papers by Juliana R. Peiró in
Current site
Google Scholar
PubMed
Close
 DVM, PhD
,
Susan S. Laborde Equine Health Studies Program, Department of Veterinary Clinical Sciences, School of Veterinary Medicine, Louisiana State University, Baton Rouge, LA 70803.

Search for other papers by Susan S. Laborde in
Current site
Google Scholar
PubMed
Close
 MS
,
Ashley M. Stokes Equine Health Studies Program, Department of Veterinary Clinical Sciences, School of Veterinary Medicine, Louisiana State University, Baton Rouge, LA 70803.

Search for other papers by Ashley M. Stokes in
Current site
Google Scholar
PubMed
Close
 DVM, PhD
, and
Rustin M. Moore Department of Veterinary Clinical Sciences, College of Veterinary Medicine, The Ohio State University, Columbus, OH 43210-1089.

Search for other papers by Rustin M. Moore in
Current site
Google Scholar
PubMed
Close
 DVM, PhD

Click on author name to view affiliation information

Abstract

Objective—To identify differentially expressed genes in pulmonary tissues of horses affected with summer pasture-associated obstructive pulmonary disease (SPAOPD), which is a form of recurrent airway obstruction (RAO), compared with those of unaffected horses.

Animals—6 horses with SPAOPD-RAO and 6 unaffected (healthy) horses.

Procedures—Horses were assigned to 2 groups on the basis of medical history, clinical score, and transpleural pressure. Total RNA from each of the 5 lung lobes of each of the 6 SPAOPD-RAO–affected horses was extracted and pooled. Similarly, total RNA from unaffected horses was pooled. Differential display (DD) PCR assay was performed, and differentially expressed bands were purified and cloned into a plasmid vector. Plasmids were extracted from recombinant colonies, and purified DNA was sequenced. Genes of interest for RAO pathogenesis were identified. Real-time PCR assay was performed to confirm findings for the DD PCR assay.

Results—18 differentially expressed genes (17 upregulated and 1 downregulated) were identified. Three genes of particular interest were found to be altered (2 upregulated and 1 downregulated) in horses with SPAOPD-RAO by use of real-time PCR assay, and these findings matched the differential expression found by use of the DD PCR assay.

Conclusions and Clinical Relevance—SPAOPD-RAO in horses is a multifactorial, complex disease involving several genes. Upregulated genes, particularly β2-microglobulin, and the downregulated secretoglobin gene can serve as marker genes that may help to identify SPAOPD-RAO at an early age.

Abstract

Objective—To identify differentially expressed genes in pulmonary tissues of horses affected with summer pasture-associated obstructive pulmonary disease (SPAOPD), which is a form of recurrent airway obstruction (RAO), compared with those of unaffected horses.

Animals—6 horses with SPAOPD-RAO and 6 unaffected (healthy) horses.

Procedures—Horses were assigned to 2 groups on the basis of medical history, clinical score, and transpleural pressure. Total RNA from each of the 5 lung lobes of each of the 6 SPAOPD-RAO–affected horses was extracted and pooled. Similarly, total RNA from unaffected horses was pooled. Differential display (DD) PCR assay was performed, and differentially expressed bands were purified and cloned into a plasmid vector. Plasmids were extracted from recombinant colonies, and purified DNA was sequenced. Genes of interest for RAO pathogenesis were identified. Real-time PCR assay was performed to confirm findings for the DD PCR assay.

Results—18 differentially expressed genes (17 upregulated and 1 downregulated) were identified. Three genes of particular interest were found to be altered (2 upregulated and 1 downregulated) in horses with SPAOPD-RAO by use of real-time PCR assay, and these findings matched the differential expression found by use of the DD PCR assay.

Conclusions and Clinical Relevance—SPAOPD-RAO in horses is a multifactorial, complex disease involving several genes. Upregulated genes, particularly β2-microglobulin, and the downregulated secretoglobin gene can serve as marker genes that may help to identify SPAOPD-RAO at an early age.

Recurrent airway obstruction in horses is a common asthma-like pulmonary disease that primarily affects the peripheral respiratory (bronchioles) system of mature horses in all parts of the world.1–3 There are 2 forms of RAO.1 One form is chronic obstructive pulmonary disease that develops in horses housed in stables and fed hay during winter months.3 This form is seen most often in northern regions of the United States. The other form is SPAOPD that primarily develops during the summer months in grazing horses in the southeastern United States.4,5 The pathophysiologic changes for these 2 forms of the disease are similar.6,7 Recurrent airway obstruction can be induced by allergens, such as fungal spores, and proinflammatory agents, such as dust-derived bacterial endotoxins.8,9 Once the disease is initiated, it progresses through various stages, which are often episodic, recurrent, and progressive, and are determined by the host's response until the affected animal eventually recovers (remission) or reaches advanced stages that lead to death or require the animal to be euthanized. The disease is severely debilitating and devastating and is often a career-ending or life-threatening condition.

The causes and pathogenesis of RAO are not clearly understood. The condition is characterized by airway inflammation, neutrophilia in bronchoalveolar fluid, frequent bronchoconstriction and spasm, hypersecretion of mucus, chronic coughing, exercise intolerance, and dyspnea.3,5 Current therapeutic measures for RAO are avoidance of potential causative agents, immunotherapy if an allergic component is identified, and control of the disease by palliative treatments.

During periods of airway obstruction, horses develop airway hyperreactivity (hyperresponsiveness and hypersensitivity) to inflammatory mediators released locally into the airway lumen and across bronchial smooth muscle.1,2 These mediators are responsible for bronchial smooth muscle contraction, increased vascular permeability, increased mucus secretion, and damage to the airway epithelium.1 A positive correlation exists between the intensity of airway hyperreactivity and the quantity of chemical mediators released locally in the lungs.2 Commonly accepted inflammatory mediators involved in airway disease include histamine, bradykinin, prostaglandins, leukotrienes, platelet-activating factor, endothelin-1, and neurokinin-A.1,10 It has been suggested1 that a wide range of factors, such as charged particles, various forms of dust, fumes, and irritating agents, can induce airway hyperreactivity through overexpression or underexpression of genes for several endogenous chemical mediators. However, there is a paucity of information regarding changes in pulmonary gene expression for this disease.

Techniques designed to identify DEGs in cells for various physiologic stages or experimental conditions have become pivotal in modern biological investigations.11 The DEG technique is an improvement over the DD PCR assay for isolating DEGs because it yields PCR products that can be detected on agarose gels.12

The purpose of the study reported here was to identify DEGs in pulmonary tissues obtained from horses with naturally acquired SPAOPD-RAO and from healthy horses. The objective of the study was to use DD PCR methods to determine whether any genes would be upregulated or downregulated in pulmonary tissues of SPAOPD-RAO–affected horses, compared with gene expression for unaffected horses.

Materials and Methods

Animals—Twelve horses (6 clinically unaffected [healthy] horses and 6 horses affected with SPAOPDRAO) were used in the study. All horses were acquired by donation. The 6 healthy horses (2 mares, 3 stallions, and 1 gelding) consisted of 3 Thoroughbreds, 2 Quarter Horses, and 1 mixed-breed horse. The 6 SPAOPDRAO–affected horses (3 mares, 2 stallions, and 1 gelding) consisted of 4 Thoroughbreds, 1 Quarter Horse, and 1 mixed-breed horse. Both groups of horses ranged from 10 to 20 years of age. Mean ± SD age of the healthy horses was 15.5 ± 4.3 years, whereas mean age of the SPAOPD-RAO–affected horses was 14.3 ± 3.9 years. The study was approved by the Louisiana State University Institutional Animal Care and Use Committee.

Horses were assigned to the respective groups on the basis of medical history, clinical score, and transpleural pressure. The SPAOPD-RAO–affected horses had a history of recurring signs of obstructive pulmonary disease that developed after exposure to pasture during summer months. None of these horses received medications within 7 days prior to assessment, and none had signs of respiratory tract disease other than SPAOPD-RAO.

Transpleural pressure was measured indirectly by use of an esophageal balloon secured over the end of a catheter connected to a pressure transducer interfaced with a polygraph. A 10-cm-long, 3.5-cm-circumference balloon was placed over the end of a 2-m-long, 2-mm (internal diameter) cannula. The balloon was inserted through a lubricated nasogastric tube that was passed into the rostral portion of the esophagus. Once the esophageal balloon was located between the heart and diaphragm, the nasogastric tube was retracted. The balloon was inflated with 1.5 mL of saline (0.9% NaCl) solution, and a measurement was obtained during a 3-minute period. Changes in esophageal pressure (peak inspiratory pressure minus peak expiratory pressure) during tidal breathing measured with this system reflected changes in pleural pressure.

During the initial assessment, SPAOPD-RAO–affected horses were assigned a clinical score determined by use of the following equation9,13:

article image

Each of the variables in the equation was scored on a scale of 0 to 4; thus, the maximum clinical score was 8. For nostril flare, a score of 0 indicated the nostril had little movement, whereas a score of 4 indicated the nostril remained maximally flared throughout the respiratory cycle. For abdominal lift, a score of 0 indicated that the ventral aspect of the flank had little or no movement, whereas a score of 4 indicated the abdominal lift resulted in a visible groove (heave line) that extended cranially to the fifth intercostal space attributable to hypertrophy of the external abdominal oblique muscles resulting from an enhanced abdominal component of expiration.

To be included in the SPAOPD-RAO–affected group, it was required that a horse have a history of RAO disease following exposure to summer pasture, a clinical score ≥ 5, and a change in pleural pressure > 15 cm H2O. Healthy horses had changes in pleural pressure < 10 cm H2O and a clinical score ≤ 4.14

Tissue collection—The horses were euthanized the day after pulmonary function tests were performed and clinical scores were assigned. Horses were euthanized by administration of an overdose of pentobarbital sodium (90 mg/kg, IV). Gross postmortem evaluation of the lungs was conducted during their removal from the thoracic cavity to verify and confirm that the health status of the horses and group assignments were accurate. Pulmonary tissue samples were collected immediately after the horses were euthanized. Tissue samples were obtained from the central area of each lung lobe (respiratory zone) in each horse. Tissue samples were snap frozen with liquid nitrogen and stored at −80°C for later use.

DD PCR assay—Samples were thawed prior to use but were kept on ice during RNA extraction. One sample from each lobe was used for RNA extraction. Standard extraction techniques with a reagenta were used to isolate total RNA from frozen-thawed lung tissue. Total RNA from each of the 5 lobes of each of the 6 SPAOPD-RAO–affected horses was pooled, and total RNA from each of the 5 lobes of each of the 6 healthy horses was pooled (ie, 1 pool/group). Total RNA concentration was determined by use of spectrophotometry and was analyzed for quality by use of agarose gel electrophoresis. The DD PCR assay was performed with a commercially available DEG kitb in accordance with the manufacturer's instructions. Briefly, first-strand cDNA was synthesized with reagents provided in the DEG kit.b The DD PCR assay was performed by use of 50 ng of cDNA with the annealing control primer paired with 1 of the 80 arbitrary primers. The PCR reaction was performed by use of the following program: 3 minutes at 94°C; followed by 50°C for 3 minutes and 1 minute at 72°C; followed by 40 cycles at 94°C for 40 seconds, 54°C for 40 seconds, and 72°C for 40 seconds; followed by a final extension at 72°C for 5 minutes. The PCR amplicons were analyzed on 2% agarose gels and developed by use of ethidium bromide. Differentially expressed bands were excised from the gel and purified with a DNA purification kitc performed in accordance with the manufacturer's instructions.

Purified PCR products were cloned by use of a cloning kit.d At least 3 colonies resulting from the transformation were analyzed for recombinant plasmids by use of a PCR assay with universal primers. The PCR amplicons were analyzed on 1.2% agarose gels and developed by use of ethidium bromide. Plasmids were extracted from the recombinant colonies by use of a commercially available kit.e Purified DNA was sequenced. To confirm the findings of the DD PCR assay, a real-time PCR assay was performed via a real-time PCR system.f Primers and probes were designed by use of softwareg (Appendix). We used β-glucoronidase as the endogenous control gene.

A standard curve was constructed from results for equine lung tissues to define the relationship between input cDNA concentration and CT values. To examine genes of interest, cDNA generated in the same manner as described previously for the 6 healthy horses and 6 SPAOPD-RAO–affected horses was used separately. Real-time PCR assay was performed in duplicate reactions (20 μL/reaction) in a 384-well plate. Amplification was performed as follows: 1 cycle at 50°C for 2 minutes and 95°C for 10 minutes and 40 cycles at 95°C for 15 seconds and 60°C for 1 minute. Fold differences between the groups were calculated by use of the ΔΔCT method.

The protocol can be summarized as follows: from the pooled pulmonary tissue RNA of each group, first-strand cDNA was synthesized by reverse transcription by use of dT-ACP1. The DEGs were amplified with arbitrary ACP and dT-ACP2. The PCR products with differential expression were removed from the agarose gel, and their sequences were identified by use of a BLAST. Real-time PCR assay was performed on selected sequences.

Results

Gene expression differed in pulmonary tissues obtained from the SPAOPD-RAO–affected and healthy horses; 88 genes were differentially expressed. Of the 88 genes, 18 were identified by use of a BLAST on sequences contained in the National Center for Biotechnology Information database as potentially important in SPAOPD-RAO (Table 1); the other 70 unknown nucleotide sequences were eliminated from the study. Of the 18 genes identified, 17 were considered upregulated and 1 gene was considered downregulated. The DD PCR gel had strong bands for uridine phophorylase 1 and insulin-like growth factor-2 genes and a faint band for the secretoglobin gene (Figure 1).

Table 1—

Differential expression of genes in pulmonary tissues obtained from 6 horses affected with SPAOPD-RAO, compared with gene expression in pulmonary tissues obtained from 6 healthy horses.

CloneExpressionGeneGenBank accession No.No. of base pairs sequencedHomology (%)
25AUpregulatedUridine phosphorylase 1XM_59296840787.8
28A3UpregulatedCystatin CDQ66104771684.2
36AUpregulatedTranslation elongation factor 1XM_85480554193.0
37A1UpregulatedPleckstrin homology domain-containing proteinXM_84749154794.4 and 90.6*
41A2UpregulatedSolute carrierXM_53284452193.0
45CDownregulatedSecretoglobinAY88556247697.8 and 98.7*
46AUpregulatedFerritin light chainAB17561771299.6
53AUpregulatedInsulin-like growth factor-2ECILGF22287100
61AUpregulatedAnnexin A2BC01384366596.2 and 87.6*
63AUpregulatedEukaryotic translation initiation factor 1ABC00871064088.0
69BUpregulatedMajor histocompatibility complexNM_00212454987.8 and 88.6*
72CUpregulatedFUSE-binding protein–interacting repressorXM_85194744293.1
75AUpregulatedβ2-microglobulinX6908396798.9
76BUpregulatedCold shock domain-containing E1XM_85174335597.8
77BUpregulatedThymosin β-4NM_00100288553293.8 and 100*
78AUpregulatedKelch-like ECH–associated protein 1XM_59283825999.2
83FUpregulatedGlucose-6-phosphate isomeraseXM_84876599089.8
92FUpregulatedGalactoside-binding lectinNM_00230522794.0

Represents results for percentage homology based on the number of identical nucleotides at a site.

Figure 1—
Figure 1—

Agarose gels with results of DD PCR assay performed on pulmonary samples obtained from 6 unaffected (healthy) horses and 6 horses affected with SPAOPD-RAO. Gene expression was upregulated for uridine phosphorylase 1 (clone 25A) and insulin-like growth factor-2 (clone 53A) and downregulated for secretoglobin (clone 45C) in SPAOPDRAO–affected horses, compared with gene expression in healthy horses.

Citation: American Journal of Veterinary Research 71, 4; 10.2460/ajvr.71.4.476

Real-time PCR assay was performed for selected genes, such as uridine phophorylase 1 (1.3-fold increase), annexin A2 (1.2-fold increase), β2-microglobulin (1.2-fold increase), and thymosin β-4 (1.3-fold increase), because of the potential importance of these genes during RAO. The major histocompatability gene primers and probe set did not yield good results. All identified genes were classified categorically on the basis of their potential involvement at various stages of development of SPAOPD-RAO (Table 2). The products of these genes are believed to be involved in protection, defense, mediation of proinflammatory responses, promotion of oxidative stress, protection from oxidative stress, mediation of anti-inflammatory responses, recovery (repair and airway remodeling), protection from mitogenesis, and control of mitogenesis.

Table 2—

Classification of each identified gene on the basis of its proposed role in SPAOPD-RAO in affected horses.

Proposed functional roleGeneExpression*
ProtectionSecretoglobinDownregulated
Defenseβ2-microglobulinUpregulated
Proinflammatory responseAnnexin A2, glucose-6-phosphate isomeraseUpregulated
Promotion of oxidative stressKelch-like ECH–associated protein 1Upregulated
Protection from oxidative stressFerritin light chainUpregulated
Anti-inflammatory responseMajor histocompatibility complexUpregulated
Recovery (repair and cell proliferation in airway remodeling)Uridine phosphorylase 1, translation elongation factor 1, pleckstrin homology domain-containing protein, solute carrier, insulin-like growth factor-2, eukaryotic translation initiation factor 1A, thymosin β-4, and galactoside-binding lectinUpregulated
Protection during mitogenesisCold shock domain-containing E1Upregulated
Control of mitogenesisFUSE-binding protein–interacting repressor and cystatin CUpregulated

Represents gene expression for pulmonary samples obtained from 6 SPAOPD-RAO–affected horses, compared with gene expression for pulmonary samples obtained from 6 healthy horses.

Discussion

Analysis of results for the study reported here revealed alterations in the expression (upregulation or downregulation) of 18 genes associated with SPAOPDRAO in horses. The genes identified in this study encode proteins that have established biological functions. On the basis of this information, the genes were categorized into groups with specific functions during various stages in the course of SPAOPD-RAO, including initiation, progression, and finally recovery (remission). Long before an affected horse develops signs of disease, it is likely that there are alterations in gene expression in pulmonary tissues of that animal. These alterations presumably continue as the disease progresses and are carefully controlled via appropriate gene expression by the host's defense system. Therefore, we expected gene expression to principally reflect the current stage of the disease. Frequent exacerbation of seasonal episodes of disease with intermittent seasonal remission characterizes horses with SPAOPD-RAO.1 During remission after each episode, the horse may appear to be clinically normal, although intermittent recurrent episodes can induce chronic airway changes. These chronic changes include repair of airway damage (primarily in the epithelium) with subsequent airway remodeling (primarily in the airway smooth muscle) characterized by proliferation of airway smooth muscle (mitogenic activity) that leads to peribronchial fibrosis and inflammation. All these changes lead to progressive and intractable airway obstruction. With each episode, acute components of the disease will be active, such as a release of mediators that leads to a cascade of events, which includes inflammation and severe bronchoconstriction. In this study, all affected horses had a history of SPAOPD-RAO and chronic changes (including airway remodeling) were expected. Gene expression in these horses supported this expectation. The affected horses had signs of airway obstruction as indicated on the basis of the clinical scores and transpulmonary pressure changes.

The speculated functional roles of the genes with altered expression in horses with SPAOPD-RAO include protection, defense, mediation of inflammatory responses, promotion of oxidative stress, protection from oxidative stress, mediation of anti-inflammatory responses, recovery, protection during mitogenesis, and control of mitogenesis.

Although exposure to inhalant allergens is the triggering mechanism for SPAOPD-RAO,15 all exposed horses do not develop SPAOPD-RAO. The genetic composition predisposes each horse to development of SPAOPD-RAO. Clinically normal horses are protected from development of airway inflammation and obstruction by several proteins secreted by airway epithelium. In the study reported here, the gene encoding secretoglobin was downregulated in SPAOPD-RAO horses. Secretoglobin (ie, CCSP) consists of CC10, CC16, uteroglobin, and uteroglobin-related protein-1; they block activation of phospholipase A2 that triggers release of arachidonic acid from cell membrane phospholipids and leads to production of arachidonic acid metabolites, such as leukotrienes and prostaglandins.16,17 Horses predisposed to inflammatory diseases of the airways are believed to have low concentrations of CCSP, which thus makes it a marker for detecting animals with a predisposition to airway inflammation.16,18 It has been suggested in studies19,20 in humans that exogenous administration of CCSP suppresses airway inflammation.

When allergens gain access to the body, gene expression of the host increases to encode proteins (eg, β2-microglobulin) that can combine with the antigen to facilitate recognition by T cells or B cells.21 This protein is also a mitogen that plays a role in repair and airway remodeling. It is synthesized by all nucleated cells and serves as a marker for airway inflammation.21

Proinflammatory genes that encode annexin A2 and glucose-6-phosphate isomerase were upregulated in the SPAOPD-RAO–affected horses in this study. Annexin A2 stimulates synthesis of cytokines and activates macrophages by enhancing activity of mitogen-activated protein kinase and facilitating translocation of transcription factor nuclear factor κB into the nucleus of cells22 for initiation and propagation of inflammation as a response to airway injury. It also stimulates synthesis of tumor necrosis factor-α, interleukin-1, and interleukin-6. Glucose-6-phosphate isomerase induces B-cell–dependent chronic inflammation23 and promotes expression of proangiogenesis genes to prepare tissues for proliferative changes during airway remodeling.24

Oxidative stress, a hallmark of RAO, is caused by an imbalance between the generation of reactive oxygen species (ie, superoxide, hydroxyl, and peroxide radicals) and scavenging by endogenous antioxidants. Excess amounts of reactive oxygen species cause extensive cellular damage, which includes damage to DNA, lipids, and proteins and is associated with the aging process.25 Incidentally, RAO is common in older horses. Inflammatory mediators, such as endothelin-1, are released during RAO-induced oxidative stress. The gene that encodes kelch-like ECH–associated protein-1, which is a suppressor of the host's antioxidant protector of oxidative stress (ie, nuclear factor erythroid-2),26 was upregulated in affected horses of the study reported here.

When oxidative stress increases, the body responds with counteractive measures. In the present study, the gene that encodes ferritin light-chain protein (an antiapoptotic that acts by reducing peroxide concentrations) was upregulated.27,28

When there are inflammatory changes, homeostatic mechanisms of the host counteract the intensity of those changes. In the present study, the gene that encodes the protein major histocompatibilty complex was upregulated. In vertebrates, this protein plays an important role in the immune system and autoimmunity. The major histocompatability complex proteins are anti-inflammatory compounds and facilitate (directly or through the action of T cells) disintegration of antigens.29

Recovery includes repair and cell proliferation for airway remodeling. Genes involved in these processes encode uridine phosphorylase-1, translation elongation factor-1, pleckstrin homology domain-containing protein, solute carrier, insulin-like growth factor-2, eukaryotic translation initiation factor 1A, thymosin β-4, and galactoside-binding lectin. Their functions include synthesizing proteins during airway remodeling30; catalyzing critical steps in repair mechanisms31; building cytoskeleton components32; transporting nucleotide sugars to the Golgi apparatus33; modulating proliferation of cells in the lungs34,35; initiating protein synthesis36; modulating proliferation, migration, and differentiation of cells34; producing metalloproteinases for angiogenesis37; reducing inflammation38; and repairing ulcerated tissues.39 Upregulation of genes in the SPAOPD-RAO–affected horses of the study reported here indicated that the horses already had passed through an acute stage of disease and had fundamental structural changes, which would lead to airway repair and remodeling.

Homeostatic mechanisms of cell proliferation for repair and airway remodeling lead to cellular stress. During this time, there is upregulation of the cold shock domain-containing family of genes. The encoded proteins safeguard cells from stress that results during periods of proliferative activity, a function that has been clearly described during embryogenesis.40

The remaining 2 genes upregulated in the study were FUSE-binding protein–interacting repressor and cystatin C genes. These genes control excessive activity of airway remodeling and prevention of tumor growth. The FUSE-binding protein–interacting repressor gene encodes the Ro ribonucleoprotein–binding protein, which inhibits activation of transcription.41 The cystatin C gene encodes cystatin C protein, which is a cysteine proteinase inhibitor. Several airway-relevant cysteine proteases and antiproteases are reported42 to play a critical role in maintaining alveolar morphology.

In the study reported here, 18 genes were detected with altered expression in SPAOPD-RAO–affected horses; 1 gene was downregulated, and the remaining 17 were upregulated. On the basis of the existing knowledge of these genes, we propose a speculative role for these genes in the course of SPAOPD-RAO in horses. These genes are categorized functionally into 9 classes, including roles in protection, defense, mediation of inflammatory processes, promotion of oxidative stress, protection from oxidative stress, mediation of antiinflammatory processes, recovery, protection during mitogenesis, and control of mitogenesis. Hopefully, the information reported here will provide new avenues for selective breeding, better management, and improved treatment of horses with SPAOPD-RAO.

ABBREVIATIONS

BLAST

Basic local alignment search tool

CC

Clara cell

CCSP

Clara cell secretory protein

CT

Threshold cycle

DD

Differential display

DEG

Differentially expressed gene

FUSE

Far upstream element

RAO

Recurrent airway obstruction

SPAOPD

Summer pasture-associated obstructive pulmonary disease

a.

Tri-reagent, Ambion Inc, Austin, Tex.

b.

SeeGene Inc, Songpa-Gu, Seoul, Korea.

c.

UltraClean GelSpin DNA purification kit, MoBio Inc, Carlsbad, Calif.

d.

pTOPO TA cloning kit, Invitrogen Corp, Carlsbad, Calif.

e.

QiaPrep Spin Miniprep kit, Qiagen Inc, Valencia, Calif.

f.

7900HT Fast real-time PCR system, Applied Biosystems, Foster City, Calif.

g.

Primer express software, Applied Biosystems, Branchburg, NJ.

References

  • 1.

    Robinson NE. Recurrent airway obstruction. In: Equine respiratory diseases. Lekeux P, ed. Ithaca, NY: International Veterinary Information Service, 2001. Available at: www.ivis.org. Accessed Jun 28, 2006.

    • Search Google Scholar
    • Export Citation
  • 2.

    Buechner-Maxwell V. Airway hyperresponsiveness. Equine respiratory diseases. Compend Contin Educ Pract Vet 1993;15:13791389.

  • 3.

    Robinson NE, Derkson FJ, Olszewski MA. The pathogenesis of chronic obstructive pulmonary disease in horses. Br Vet J 1996;152:283306.

  • 4.

    Beadle RE. Summer pasture-associated obstructive pulmonary disease. In: Robinson NE, ed. Current therapy in equine medicine. Philadelphia: WB Saunders Co, 1983;512516.

    • Search Google Scholar
    • Export Citation
  • 5.

    Seahorn TL, Beadle RE. Summer pasture-associated obstructive pulmonary disease. Equine Pract 1994;16 (7):3941.

  • 6.

    Kaup FJ, Drommer W, Damsch S, et al.Ultrastructural findings in horses with chronic obstructive pulmonary disease (COPD). I: alterations of the larger conducting airways. Equine Vet J 1990;22:343348.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 7.

    Naylor JM, Clark EG, Clayton HM. Chronic obstructive pulmonary disease: usefulness of clinical signs, bronchoalveolar lavage, and lung biopsy as diagnostic and prognostic aids. Can Vet J 1992;33:591598.

    • Search Google Scholar
    • Export Citation
  • 8.

    Laan TTJM, Bull S, Pirie S, et al.Evaluation of cytokine production by equine alveolar macrophages exposed to lipopolysaccharide, Aspergillus fumigatus, and a suspension of hay dust. Am J Vet Res 2005;66:15841589.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 9.

    Seahorn TL, Beadle RE, McGorum BC, et al.Quantification of antigen-specific antibody concentrations in tracheal lavage fluid of horses with summer pasture-associated obstructive pulmonary disease. Am J Vet Res 1997;58:14081411.

    • Search Google Scholar
    • Export Citation
  • 10.

    Venugopal CS, Moore RM, Holmes EP, et al.Comparative responses of bronchial rings to mediators of airway hyperreactivity in healthy horses and those affected with summer pasture-associated obstructive pulmonary disease. Am J Vet Res 2001;62:259263.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 11.

    Kim YJ, Kwak CI, Gu YY, et al.Annealing control primer system for identification of differentially expressed genes on agarose gels. Biotechniques 2004;36:424434.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 12.

    Lee MY, Shin KH, Kim YK, et al.Induction of thioredoxin is required for nodule development to reduce reactive oxygen species levels in soybean roots. Plant Physiol 2005;139:18811889.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 13.

    Costa LR, Seahorn TL, Moore RM, et al.Correlation of clinical score, intrapleural pressure, cytologic findings of bronchoalveolar fluid, and histopathologic lesions of pulmonary tissue in horses with summer pasture-associated obstructive pulmonary disease. Am J Vet Res 2000;61:167173.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 14.

    Venugopal CS, Polikepahad S, Holmes EP, et al.Endothelin receptor alterations in equine airway hyperreactivity. Can J Vet Res 2006;70:5057.

    • Search Google Scholar
    • Export Citation
  • 15.

    Verones B, Oortgiesen M. Neurogenic inflammation and particulate matter (PM) air pollutants. Neurotoxicology 2001;22:795810.

  • 16.

    Katavolos P, Ackerley CA, Viel L, et al.Clara cell secretary protein is reduced in equine recurrent airway obstruction. Vet Pathol 2009;46:604613.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 17.

    Yoshikawa S, Miyahara T, Reynolds SD, et al.Clara cell secretory protein and phospholipase A2 activity modulate acute ventilator-induced lung injury in mice. J Appl Physiol 2005;98:12641271.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 18.

    Ray R, Choi M, Zhang Z, et al.Uteroglobin suppresses SCCA gene expression associated with allergic asthma. J Biol Chem 2005;280:97619764.

  • 19.

    Mandal AK, Zhang Z, Ray R, et al.Uteroglobin represses allergen-induced inflammatory response by blocking PGD2 receptor mediated functions. J Exp Med 2003;199:13171330.

    • Search Google Scholar
    • Export Citation
  • 20.

    Reynolds SD, Reynolds PR, Pryhuber GS, et al.Secretoglobins SCGB3A1 and SCGB3A2 define secretory cell subsets in mouse and human airways. Am J Respir Crit Care Med 2002;166:14981509.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 21.

    Bethea M, Forman DT. Beta 2-microglobulin: its significance and clinical uses. Ann Clin Lab Sci 1990;20:163168.

  • 22.

    Swisher JFA, Khatri U, Feldman GM. Annexin A2 is a soluble mediator of macrophage activation. J Leukoc Biol 2007;82:11741184.

  • 23.

    Bockermann R, Schubert D, Kamradt T, et al.Induction of a B-cell dependent chronic arthritis with glucose-6-phosphate isomerase. Arthritis Res Ther 2005;7:R1316R1324.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 24.

    Banerjee SK, Young HWJ, Volmer JB, et al.Gene expression profiling in inflammatory airway disease associated with elevated adenosine. Am J Physiol Lung Cell Mol Physiol 2002;282:L169L182.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 25.

    Rice-Evans CA, Gopinathan V. Oxygen toxicity, free radicals and anti-oxidants in human disease: biochemical implications in atherosclerosis and the problems of premature neonates. Essays Biochem 1995;29:3963.

    • Search Google Scholar
    • Export Citation
  • 26.

    Itoh K, Wakabayashi N, Katoh Y, et al.Keap1 represses nuclear activation of antioxidant responsive elements by Nrf2 through binding to the amino-terminal Neh2 domain. Genes Dev 1999;13:7686.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 27.

    Ryan TP, Krzesicki RF, Blakeman DP, et al.Pulmonary ferritin: differential effects of hyperoxic lung injury on subunit mRNA levels. Free Radic Biol Med 1997;22:901908.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 28.

    Aung W, Hasegawa S, Furukawa T, et al.Potential role of ferritin heavy chain in oxidative stress and apoptosis in human mesothelial and mesothelioma cells: implications for asbestos-induced oncogenesis. Carcinogenesis 2007;28:20472052.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 29.

    Vambutas A, Bonagura VR, Steinberg BM. Altered expression of TAP-1 and major histocompatibility complex class I in laryngeal papillomatosis: correlation of TAP-1 with disease. Clin Diagn Lab Immunol 2000;7:7985.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 30.

    Pizzorno G, Cao D, Leffert JJ, et al.Homeostatic control of uridine and role of uridine phosphorylase: a biological and clinical update. Biochim Biophys Acta 2002;1587:133144.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 31.

    Hanbauer I, Boja ES, Moskovitz J. A homologue of elongation factor 1G regulates methionine sulfoxide reductase A gene expression in Saccharomyces cerevisiae. Proc Natl Acad Sci U S A 2003;100:81998204.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 32.

    Canton DA, Olsten MEK, Kim K, et al.The pleckstrin homology domain-containing protein CKIP-1 is involved in regulation of cell morphology and the actin cytoskeleton and interaction with actin capping protein. Mol Cell Biol 2005;25:35193534.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 33.

    Ashikov A, Routier F, Fuhlrott J, et al.The human solute carrier gene SLC35B4 encodes a bifunctional nucleotide sugar transporter with specificity for UDP-xylose and UDP-N-acetylglucosamine. J Biol Chem 2005;280:2723027235.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 34.

    Noveral JP, Bhala A, Hintz RL, et al.Insulin-like growth factor axis in airway smooth muscle cells. Am J Physiol 1994;267:L761L765.

  • 35.

    Yamashita N, Tashimo H, Ishida H, et al.Role of insulin-like growth factor-1 in allergen-induced airway inflammation and remodeling. Cell Immunol 2005;235:8591.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 36.

    Chaudhuri J, Si K, Maitra U. Function of eukaryotic translation initiation factor 1A (eIF1A) (formerly called eIF-4C) in initiation of protein synthesis. J Biol Chem 1997;272:78837891.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 37.

    Malinda KM, Goldstein AL, Kleinman HK. Thymosin beta 4 stimulates directional migration of human umbilical vein endothelial cells. FASEB J 1997;11:474481.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 38.

    Badamchian M, Fagarasan MO, Danner RL, et al.Thymosin beta (4) reduces lethality and down-regulates inflammatory mediators in endotoxin-induced septic shock. Int Immunopharmacol 2003;3:12251233.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 39.

    Goldstein AL, Hannappe E, Kleinman HK. Thymosin beta 4: actin-sequestering protein moonlights to repair injured tissues. Trends Mol Med 2005;11:421429.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 40.

    Lu ZH, Books JT, Ley TJ. Cold shock domain family members YB-1 and MSY4 share essential function during murine embryogenesis. Mol Cell Biol 2006;26:84108417.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 41.

    Matsushita K, Tomonaga T, Shimada H, et al.An essential role of alternative splicing of c-myc suppressor FUSE-binding protein-interacting repressor in carcinogenesis. Cancer Res 2006;66:14091417.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 42.

    Takeyabu K, Betsuyaku T, Nishimura M, et al.Cyteine proteinases and cystatin C in bronchoalveolar lavage fluid from subjects with subclinical emphysema. Eur Respir J 1998;12:10331039.

    • Crossref
    • Search Google Scholar
    • Export Citation

Appendix

Primers and probes used for the real-time PCR assay.

GeneProbe sequence (5′FAM–BHQ3′)Primer sequence (5′–3′)
25TCTCGGCGCCCGACGTCCForward GGCCACTTCATCAAGAAATGC
Reverse AACGCTCCCCTTTGAGGCT
61ACCACACAGGTACAGCAGCGCCTTCTForward GACAGGCTTCAGTCATCCCC
Reverse CAAGACACCAAGGGCGACTAC
69BAGGACACACAGGACTTCAGCCAACAGGForward 1 TCCACCGCAGGAACCAGA
Reverse 1 CGTCATCTACACTTCAACTCAGGAG
TGTCCCAGCTTCTCForward 2 TGACGACACTCAAAGAAGAACCTT
Reverse 2 CAAGCAGGAAACCTTTTCATGC
75ATCTCCTTGTTTGACCTGTGTGGGCAGForward TCTTTATAACTCTACTTTGGCCGCTAT
Reverse TGCCAGGATCTCCCTCTAG
All Time Past Year Past 30 Days
Abstract Views 21 0 0
Full Text Views 288 124 33
PDF Downloads 65 24 13
Advertisement