Exercise-induced pulmonary hemorrhage is common in racing Thoroughbreds undergoing strenuous exercise, with a reported prevalence of 43% to 75.4%.1,2,a No precise mechanism has been identified that can account for the site of hemorrhage and progression of EIPH within the lungs; however, pulmonary hypertension with secondary stress failure of pulmonary capillaries has been implicated.3 Exercise-induced pulmonary hemorrhage is definitively diagnosed by use of postexercise endoscopic examination of the pharynx, larynx, trachea, or mainstem bronchi for the presence and severity of hemorrhage. Examination of tracheal aspirates may reveal RBCs and hemosiderophages, whereas examination of bronchoalveolar lavage fluid may be used to quantify EIPH by measurement of the RBC concentration.
Pulmonary inflammation is often detected in horses with EIPH.4 This may be attributable to preexisting disease of the small airways5 or because of blood in the airways.6
Furthermore, the local response to tissue injury following stress failure of the pulmonary capillaries may involve the production of cytokines at the site of inflammation, which may be accompanied by a systemic acute-phase response. Because airway inflammation involves the production of such inflammatory mediators,7 we hypothesized that racing Thoroughbreds with more severe grades of EIPH would have greater systemic expression of cytokine mRNA.
Although, to our knowledge, proinflammatory responses have not been reported before in horses with EIPH, information exists on increased mRNA expression of IL-1β, IL-8, and TNF-α in the bronchoalveolar lavage fluid of horses with recurrent airway obstruction8; increased mucosal IL-4 and IL-10 expression associated with Cyathostominae larvae in the wall of the equine large colon9; and increased IL-1β, IL-8, and TNF-α expression in leukocytes isolated from blood of horses following infection with Anaplasma phagocytophilia.10 We chose to study proinflammatory cytokines IL-1, IL-6, and TNF-α, which are cytokines responsible for the induction of fever, neutrophil recruitment, tissue remodeling, and immune activation, and INF-γ, which is a pleotropic cytokine with proinflammatory properties that augments TNF activity.11 Interleukin-10 was assessed for its potent anti-inflammatory activity because it may suppress proinflammatory cytokines, such as IL-1 and TNF-α.
Because the determination of an association between EIPH and inflammation at a molecular level may assist in the development of preventive strategies aimed at reducing the prevalence and severity of EIPH, the purpose of the study reported here was to measure IL-1, IL-6, IL-10, INF-γ, and TNF-α gene expression in a population of horses with EIPH immediately after racing at sea level and at a high altitude in a racing jurisdiction that did not permit administration of furosemide nor use of nasal dilator strips on race day.
Materials and Methods
Animals—Thoroughbreds of either sex that raced on turf or sand on flat racecourses were enrolled in the study between August and December 2005. The Thoroughbreds competed at 2 racecourses located at a high altitude (> 1,400 m above sea level; Turffontein Race Course [Gauteng Province] and Vaal Race Course [Free State Province]) and at 3 racecourses located at sea level (Clairwood and Greyville Turf Club [Kwazulu-Natal Province] and Kenilworth Race Course [Western Cape Province]) in South Africa. Administration of medications (such as furosemide) was not allowed on race day, and drug testing was strictly enforced by the National Horse Racing Authority through screening of urine and blood samples for the detection of prohibited and therapeutic substances. Lists of available horses that were accepted to race were obtained from the National Horse Racing Authority. Eligible horses were then identified, trainers were contacted, and permission was requested to examine the horses and collect blood samples. Only horses enrolled prior to race day were entered into the cross-sectional study to avoid a potential enrollment bias. The study was approved by the Animal Use and Care Committee and Veterinary Research Committee of the University of Pretoria.
Tracheobronchoscopy and sample collection—Tracheobronchoscopic evaluations were performed to detect evidence of EIPH on 97 unsedated horses within 2 hours after the horses had completed a race. Horses ranged from 3 to 8 years of age (median, 4 years) and had completed 0 to 81 lifetime starts (median, 11 lifetime starts). Tracheobronchoscopic evaluations were performed by use of an endoscopeb that was passed through one of the nares, the nasopharynx, and the larynx to the level of the tracheal bifurcation. Severity of EIPH was immediately graded by one of the investigators (MNS), who used an established grading system.12 Grades were assigned from 0 to 4 as follows: grade 0 = no blood in the pharynx, larynx, trachea, or mainstem bronchi; grade 1 = 1 or more flecks of blood or ≤ 2 short (< 25% of the length of the trachea), narrow (< 10% of the tracheal surface area) streams of blood in the trachea or mainstem bronchi; grade 2 = 1 long (> 50% of the length of the trachea) or > 2 short streams of blood covering < 33% of the tracheal circumference; grade 3 = multiple distinct streams of blood covering > 33% of the tracheal circumference without blood pooling at the thoracic inlet; and grade 4 = multiple coalescing streams of blood covering > 90% of the tracheal surface with blood pooling at the thoracic inlet.
To allow greater sample distribution, identifying a horse with grade 3 or 4 EIPH initiated a specific sample collection routine. Venous blood samples (2.5 mL) were collected by use of routine jugular venipuncture from horses with grade 3 EIPH (followed by 1 horse each with grade 0, 1, and 2 EIPH) and grade 4 EIPH (followed by 1 horse each with grade 0, 1, 2, and 3 EIPH). Blood samples were collected directly into RNA collection tubesc within 2 hours after racing. The sample collection routine was repeated until samples were obtained from 10 horses in each EIPH grade classification (0 to 4) at both a high altitude and at sea level, except for horses with grade 4 EIPH at a high altitude for which only 7 horses were identified. Immediately after blood samples were collected, each tube was inverted 10 times to prevent coagulation that would hinder future RNA extraction. The tubes were maintained at 25°C overnight and then stored at −20°C until RNA extraction was performed.
RNA extraction and cDNA synthesis—Samples were thawed. Cell pellets were obtained by centrifugation at 2,500 × g, and RNA was extracted in accordance with the manufacturer's protocol,d with slight modifications. Briefly, cell pellets were treated with cell lysis buffer containing proteinase K for 5 minutes at 25°C. Samples then were heated at 55°C for 10 minutes, which was followed by centrifugation at 16,000 × g for 10 minutes. Total RNA was eluted in 40 μL of RNase-free water and stored at −80°C. The cDNA was synthesized in accordance with the manufacturer's protocol.d
Real-time PCR assay—Real-time PCR assay was performed by use of an automated system.e The realtime PCR reaction mixtures had a final volume of 10 μL/well, which consisted of 4.5 μL of the synthesized cDNA strand, 5 μL of Taq polymerase,f and 0.5 μL of primers and probes.g Water was included in wells on each plate as a negative control sample. Amplification conditions were maintained constant for all samples as follows: 10 minutes at 95°C, 15 seconds at 95°C, and 1 minute at 60°C, with a primer extension temperature of 60°C (1 min/cycle). The 5 genes of interest in the study were those for IL-1, IL-6, IL-10, TNF-α and IFN-γ. Primer and probe sequences for the cytokines were provided in a kith that contained both the designed primer and probe in solution (Appendix). To allow for potential variability in sample processing, expression of the genes of interest was initially compared with expression of β-glucuronidase. This control gene has the lowest variability, compared with that of glyceraldehyde-3-phosphate dehydrogenase.13 Additionally, relative quantitation of gene expression was performed in accordance with the method of Livak and Schmittgen,14 in which the internal calibrator used was the mean of the value for grade 0 EIPH samples. Each cDNA sample was amplified in duplicate, and all reaction solutions and samples were added to the plate via a robotic pipetting machinei to ensure that study samples were most accurately and reproducibly pipetted. The end point threshold cycle (ie, CT) was defined as the PCR cycle number that crossed the signal threshold; it ranged from 0 (no product) to 40.
Statistical analysis—Nonparametric tests were used to compare overall differences in target gene expression within grades of EIPH (Spearman rank-order correlation) because the data were not normally distributed, with post hoc analyses performed by use of the Holm-Sidak t test. Linear regression was used for comparisons between location (high altitude vs sea level) and EIPH grade. Significance was set at values of P < 0.05. Statistical tests were conducted by use of commercially available computer software.j
Results
Cytokine mRNA expression was determined in 10 horses that raced at a high altitude for each EIPH grade classification, except for grade 4 EIPH in which only 7 horses were identified. This represented 4.7% (10/211), 8.3% (10/120), 22.7% (10/44), 38.5% (10/26), and 100% (7/7) of the horses with an EIPH grade of 0, 1, 2, 3, and 4, respectively. Cytokine mRNA expression was determined in 10 horses that raced at sea level for each EIPH grade, which represented 4.0% (10/251), 5.4% (10/186), 14.1% (10/71), 16.4% (10/61), and 35.7% (10/28) of the horses with an EIPH grade of 0 through 4, respectively. Mean expression of IL-1, IL-6, IL-10, INF-γ and TNF-α mRNA was determined (Figures 1–5).
Mean ± SD relative expression of IL-1 mRNA in 97 Thoroughbreds with grade 0 to 4 EIPH after racing at racecourses located at a high altitude (> 1,400 m above sea level [black bars]) and at sea level (white bars). Grades were assigned from 0 to 4 as follows: grade 0 = no blood in the pharynx, larynx, trachea, or mainstem bronchi; grade 1 = 1 or more flecks of blood or ≤ 2 short (< 25% of the length of the trachea), narrow (< 10% of the tracheal surface area) streams of blood in the trachea or mainstem bronchi; grade 2 = 1 long (> 50% of the length of the trachea) or > 2 short streams of blood covering < 33% of the tracheal circumference; grade 3 = multiple distinct streams of blood covering > 33% of the tracheal circumference without blood pooling at the thoracic inlet; and grade 4 = multiple coalescing streams of blood covering > 90% of the tracheal surface with blood pooling at the thoracic inlet. Expression of IL-1 mRNA did not differ significantly (P ≥ 0.05) among EIPH grades or between locations.
Citation: American Journal of Veterinary Research 71, 4; 10.2460/ajvr.71.4.447
Mean ± SD relative expression of IL-6 mRNA in 97 Thoroughbreds with grade 0 to 4 EIPH after racing at racecourses located at a high altitude and at sea level. Expression of IL-6 mRNA in horses racing at sea level differed significantly (P < 0.05) from expression in horses racing at a high altitude. *Expression of IL-6 mRNA in horses with grade 4 EIPH differed significantly (P < 0.05) from expression for horses with grade 0, 1, or 2 EIPH. See Figure 1 for remainder of key.
Citation: American Journal of Veterinary Research 71, 4; 10.2460/ajvr.71.4.447
Mean ± SD relative expression of IL-10 mRNA in 97 Thoroughbreds with grade 0 to 4 EIPH after racing at racecourses located at a high altitude and at sea level. *Expression of IL-10 mRNA in horses with grade 3 EIPH differed significantly (P < 0.05) from expression for horses with grade 0 or 2 EIPH. See Figure 1 for remainder of key.
Citation: American Journal of Veterinary Research 71, 4; 10.2460/ajvr.71.4.447
Mean ± SD relative expression of IFN-γ mRNA in 97 Thoroughbreds with grade 0 to 4 EIPH after racing at racecourses located at a high altitude and at sea level. Expression of IFN-γ did not differ significantly (P ≥ 0.05) among EIPH grades or between locations. See Figure 1 for remainder of key.
Citation: American Journal of Veterinary Research 71, 4; 10.2460/ajvr.71.4.447
Mean ± SD relative expression of TNF-α mRNA in 97 Thoroughbreds with grade 0 to 4 EIPH after racing at racecourses located at a high altitude and at sea level. Expression of TNF-α mRNA in horses racing at high altitude differed significantly (P < 0.05) from expression of horses racing at sea level. See Figure 1 for remainder of key.
Citation: American Journal of Veterinary Research 71, 4; 10.2460/ajvr.71.4.447
Neither location of the racecourse nor EIPH grade significantly affected expression of IL-1 or INF-γ, although there was a slight increase in expression with severe hemorrhage in both cytokines for horses that raced at sea level (Figures 1 and 4). There was significantly (P = 0.01) greater overall expression of IL-6 mRNA in horses that raced at sea level than in horses that raced at a high altitude, with significantly (P = 0.01) more IL-6 expressed in racehorses with grade 4 EIPH, compared with IL-6 expression in horses with grade 0, 1, and 2 EIPH (Figure 2). The IL-6 expression did not differ significantly (P = 0.05) among the various grades of EIPH for horses that raced at a high altitude. There was significantly (P = 0.01) greater overall expression of TNF-α mRNA for horses that raced at a high altitude, compared with expression for horses that raced at sea level; however, TNF-α expression did not differ significantly (P = 0.06) among the various grades of EIPH (Figure 5). Expression of IL-10 was significantly (P = 0.02) affected by grade of EIPH because horses with grade 3 EIPH expressed more IL-10 mRNA than did horses with grade 0 or 2 EIPH; however, expression of IL-10 mRNA was not significantly (P = 0.27) affected by location of the racecourse (Figure 3).
Discussion
Pulmonary inflammation in horses with more severe forms of EIPH is associated with histologic evidence of small airway disease4 and inflammation in bronchoalveolar lavage fluid and tracheal aspirates.15 Moreover, autologous intrapulmonary blood inoculation in horses causes prolonged airway inflammation.6 Whether inflammation is a direct consequence of EIPH or whether the inflammation predisposes a horse to EIPH is unknown. Nevertheless, stress failure of the pulmonary capillaries with resultant tissue injury may cause an intrapulmonary upregulation of proinflammatory cytokines, which may be accompanied systemically by an acute-phase response.
In the study reported here, expression of IL-1, IL-6, IL-10, INF-γ, and TNF-α was determined in a population of Thoroughbreds with various grades of EIPH that competed at racecourses located at different altitudes. Availability of monoclonal or polyclonal antibodies for those cytokines would have made comparison of mRNA and protein concentrations possible, although we assumed that mRNA concentrations reflected those of the biologically active cytokines. Furthermore, several studies16–18 have revealed a good correlation between inflammatory cytokine gene expression and disease conditions in horses. An increase in mRNA expression of IL-4, TNF-α and IL-10 mRNA was detected in leukocytes isolated from blood 6 hours after lipopolysaccharide inhalation,18 whereas there were no change in IL-4, IL-5, IL-13, and IFN-γ mRNA expression in lymphocytes isolated from blood and bronchoalveolar lavage fluid of horses with recurrent airway obstruction.17
In another studya conducted by our laboratory group, we described the effect of altitude on the prevalence and severity of EIPH in racing Thoroughbreds in South Africa as determined via tracheobronchoscopy and concluded that EIPH is more prevalent and more severe in horses that race at sea level. This is certainly surprising because plausible reasons exist as to why there may be a greater prevalence and increased severity of EIPH in horses that race at a high altitude. Strenuously exercised racing horses often have exercised-induced arterial hypoxemia19 and develop pulmonary arterial hypertension20 that leads to pulmonary capillary stress failure.21 High altitude–induced hypoxic vasoconstriction may worsen the degree of exercise-induced arterial hypoxemia,22 which may directly cause EIPH or may worsen preexisting EIPH. Further research is clearly needed to establish the reason that the prevalence and severity of EIPH are greater in horses that race at sea level.
Exercise-induced pulmonary hemorrhage may be quickly and easily assessed by use of tracheobronchoscopic examination because this technique is minimally invasive and allows immediate grading of racing horses with EIPH, without laborious, time-consuming processing of samples in a laboratory. Although the repeatability of the tracheobronchoscopic grading system used in the present study has been established,23 the relationship between the volume of blood in the airways and actual hemorrhage is not known. In the study reported here, the authors speculated that horses with higher grades of EIPH may have had more hemorrhage.
Although no significant effect of exercise on IL-4, IL-12, and IFN-γ mRNA expression was detected in another study,24 the study reported here is, to the authors' knowledge, the first in which an association between mRNA expression and EIPH has been reported. It is tempting to speculate that racing horses with a higher grade of EIPH and more blood loss had greater antiinflammatory IL-6 mRNA expression, which may suggest the activation of an anti-inflammatory mechanism to restrict the magnitude of the inflammatory response. Location of the racecourse appeared to affect overall mRNA expression because more IL-6 was expressed in horses that raced at sea level, whereas greater TNF-α expression was evident in horses that raced at a high altitude.
Stressors such as hypoxia or exercise may initiate an immune and inflammatory response25 characterized by increased expression of IL-6 and TNF-α. In humans, exercise following acute exposure to high altitude is associated with an increase in IL-6 expression but not an increase in TNF-α expression,26,27 whereas TNF-α expression is elevated after prolonged and intense exercise at sea level.28 The study reported here differs from those other studies26–28 because IL-6 expression was increased in horses that raced at sea level and TNF-α expression was greater in horses that raced at a high altitude. Because horses raced over shorter distances at sea level,a it is possible that overexertion may have further increased transmural pressures of pulmonary capillaries and led to a more profound increase in IL-6 expression, which was counterbalanced by upregulation of anti-inflammatory IL-10 expression in horses with more severe grades of EIPH. Moreover, at a high altitude, horses competing over longer distances may have expressed more TNF-α mRNA, which is similar to results found in human athletes.28
Altitude and EIPH grade had no effect on IL-1 or INF-γ mRNA expression. Studies29,30 in humans have also found only minor or no change in IL-1 mRNA expression after exercise; this may be attributable to rapid systemic clearance because IL-1 mRNA was found in muscle biopsy specimens collected after strenuous exercise without an increase in systemic IL-1 concentrations31 and because of IL-1 concentrations in the urine of runners.29 Furthermore, INF-γ assists in immunomodulation as well as in recruitment and activation of lymphocytes and also has antipathogen activity.32 Because an infectious cause has not been implicated in the pathogenesis of EIPH, it is not surprising that INF-γ affecting cell-mediated cytotoxicosis consistently had low expression in the racing horses, regardless of EIPH grade or racecourse location. However, despite a lack of significant differences, racing horses with more severe grades of EIPH typically expressed more IL-1 and INF-γ mRNA; therefore, collection of additional samples may have yielded additional significant results.
Although we did not report the origin or cell type involved for the present study, it has been reported elsewhere6 that intrapulmonary blood inoculation in horses initially causes a local neutrophilic infiltration, which is followed by macrophages and, to lesser degree, lymphocytes. Equine neutrophils can produce proinflammatory IL-1, IL-6, IL-8, and TNF-α mRNA instead of IL-4, IL-5, and INF-γ mRNA, which is mainly produced by lymphocytes.33 On the basis of this information, analysis of the results suggested that after EIPH-induced pulmonary neutrophilia, there may be an association between the observed systemic inflammation and neutrophils of pulmonary origin. However, because the origin of cytokines in horses with EIPH is unclear and may include alveolar macrophages, epithelium, endothelium, or stromal fibroblasts (and possibly other cells), this finding is speculative.
The mRNA expression of cytokines in a population of racing Thoroughbreds reported here may assist in determining the immunopathogenesis of EIPH. Gene linkage studies may prove useful in determining the susceptibility of horses to EIPH by allowing investigators to evaluate the balance of expression of proinflammatory and anti-inflammatory cytokines. Further research on therapeutic strategies, such as neutralizing antibodies, receptor antagonists, soluble receptors, and inhibitors of proteases, may be warranted.34 Use of these therapeutic strategies may interrupt the cascade of proinflammatory cytokines and reduce the prevalence and severity of EIPH.
Analysis of results of the study reported here indicate that increased production of IL-6 mRNA is associated with more severe forms of EIPH in horses that race at sea level and that altitude may affect proinflammatory (particularly TNF-α) and anti-inflammatory (particularly IL-6) cytokine expression. However, because a cause-and-effect relationship was not established by this study, the pathophysiologic importance of these findings remains to be explained. Further research is required to evaluate more cytokines and protein expressions of cytokines and whether the inflammatory response observed in this study was attributable to preexisting pulmonary inflammation or was a direct consequence of pulmonary bleeding.
ABBREVIATIONS
| EIPH | Exercise-induced pulmonary hemorrhage |
| IL | Interleukin |
| INF | Interferon |
| TNF | Tumor necrosis factor |
Saulez MN, Guthrie AJ, Hinchcliff KW, et al. Altitude may affect the incidence and severity of exercise-induced pulmonary haemorrhage in Thoroughbred racehorses (abstr), in Proceedings. 24th Annu Meet Am Coll Vet Intern Med 2006;739.
Pentax Corp, Tokyo, Japan.
PAXgene RNA collection tubes, Qiagen, Valencia, Calif.
7500 sequence detection system, Applied Biosystems, Foster City, Calif.
Fast Taq polymerase, Applied Biosystems, Biosystems, Foster City, Calif.
Applied Biosystems, Foster City, Calif.
Assay-by-Design kit, Applied Biosystems, Foster City, Calif.
EpMotion 5070, Eppendorf, Westbury, NY.
SYSTAT Software Inc, Chicago, Ill.
References
- 1.
Pascoe JR, Ferraro GL, Cannon JH, et al.Exercise-induced pulmonary hemorrhage in racing thoroughbreds: a preliminary study. Am J Vet Res 1981;42:703–707.
- 2.
Raphel CF, Soma LR. Exercise-induced pulmonary hemorrhage in Thoroughbreds after racing and breezing. Am J Vet Res 1982;43:1123–1127.
- 3.↑
West JB, Mathieu-Costello O, Jones JH, et al.Stress failure of pulmonary capillaries in racehorses with exercise-induced pulmonary hemorrhage. J Appl Physiol 1993;75:1097–1109.
- 4.↑
O'Callaghan MW, Pascoe JR, Tyler WS, et al.Exercise-induced pulmonary haemorrhage in the horse: results of a detailed clinical, post mortem and imaging study. V. Microscopic observations. Equine Vet J 1987;19:411–418.
- 5.↑
MacNamara B, Bauer S, Iafe J. Endoscopic evaluation of exercise-induced pulmonary hemorrhage and chronic obstructive pulmonary disease in association with poor performance in racing Standardbreds. J Am Vet Med Assoc 1990;196:443–455.
- 6.↑
McKane SA, Slocombe RF. Sequential changes in bronchoalveolar cytology after autologous blood inoculation. Equine Vet J Suppl 1999;30:126–130.
- 7.↑
Robinson NE. Pathogenesis and management of airway disease, in Proceedings. 43rd Annu Conv Am Assoc Equine Pract 1997;106–115.
- 8.↑
Giguère S, Viel L, Lee E, et al.Cytokine induction in pulmonary airways of horses with heaves and effect of therapy with inhaled fluticasone propionate. Vet Immunol Immunopathol 2002;85:147–158.
- 9.↑
Davidson AJ, Hodgkinson JE, Proudman CJ, et al.Cytokine responses to Cyathostominae larvae in the equine large intestinal wall. Res Vet Sci 2005;78:169–176.
- 10.↑
Kim HY, Mott J, Zhi N, et al.Cytokine gene expression by peripheral blood leukocytes in horses experimentally infected with Anaplasma phagocytophilila. Clin Diagn Lab Immunol 2002;9:1079–1084.
- 12.↑
Hinchcliff KW, Jackson MA, Morley PS, et al.Association between exercise-induced pulmonary hemorrhage and performance in Thoroughbred racehorses. J Am Vet Med Assoc 2005;227:768–774.
- 13.↑
Aerts JL, Gonzales MI, Topalian SL. Selection of appropriate control genes to assess expression of tumor antigens using realtime RT-PCR. Biotechniques 2004;36:84–91.
- 14.↑
Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(−Delta Delta C(T)) method. Methods 2001;25:402–408.
- 15.↑
Newton JR, Wood JL. Evidence of an association between inflammatory airway disease and EIPH in young Thoroughbreds during training. Equine Vet J Suppl 2002;(34):417–424.
- 16.
Fumuso E, Giguère S, Wade J, et al.Endometrial IL-1beta, IL-6 and TNF-alpha, mRNA expression in mares resistant or susceptible to post-breeding endometritis. Effects of estrous cycle, artificial insemination and immunomodulation. Vet Immunol Immunopathol 2003;96:31–41.
- 17.↑
Kleiber C, McGorum BC, Horohov DW, et al.Cytokine profiles of peripheral blood and airway CD4 and CD8 T lymphocytes in horses with recurrent airway obstruction. Vet Immunol Immunopathol 2005;104:91–97.
- 18.↑
van den Hoven R, Duvigneau JC, Hartl RT, et al.Clenbuterol affects the expression of messenger RNA for interleukin 10 in peripheral leukocytes from horses challenged intrabronchially with lipopolysaccharides. Vet Res Commun 2006;30:921–928.
- 19.↑
Wagner PD, Gillespie JR, Landgren GL, et al.Mechanism of exercise-induced hypoxemia in horses. J Appl Physiol 1989;66:1227–1233.
- 20.↑
Manohar M, Goetz TE. Pulmonary vascular pressures of exercising thoroughbred horses with and without endoscopic evidence of EIPH. J Appl Physiol 1996;81:1589–1593.
- 21.↑
Birks EK, Mathieu-Costello O, Fu Z, et al.Very high pressures are required to cause stress failure of pulmonary capillaries in thoroughbred racehorses. J Appl Physiol 1997;82:1584–1592.
- 22.↑
West JB. Obstructive diseases. In: West JB, ed. Pulmonary pathophysiology: the essentials. 6th ed. Philadelphia: Lippincott Williams & Williams, 2003;51–80.
- 23.↑
Hinchcliff KW, Jackson MA, Brown JA, et al.Tracheobronchoscopic assessment of exercise-induced pulmonary hemorrhage in horses. Am J Vet Res 2005;66:596–598.
- 24.↑
Ainsworth DM, Appleton JA, Eicker SW, et al.The effect of strenuous exercise on mRNA concentrations of interleukin-12, interferon-gamma and interleukin-4 in equine pulmonary and peripheral blood mononuclear cells. Vet Immunol Immunopathol 2003;91:61–71.
- 25.↑
Lundby C, Steensberg A. Interleukin-6 response to exercise during acute and chronic hypoxia. Eur J Appl Physiol 2004;91:88–93.
- 26.
Hagobian TA, Jacobs KA, Subudhi AW, et al.Cytokine response at high altitude: effects of exercise and antioxidants at 4,300 m. Med Sci Sports Exerc 2006;38:276–285.
- 27.
Klausen T, Olsen NV, Poulsen TD, et al.Hypoxemia increases serum interleukin-6 in humans. Eur J Appl Physiol Occup Physiol 1997;76:480–482.
- 28.↑
Ostrowski K, Rohde T, Asp S, et al.Pro- and anti-inflammatory cytokine balance in strenuous exercise in humans. J Physiol 1999;515:287–291.
- 29.↑
Sprenger H, Jacobs C, Nain M, et al.Enhanced release of cytokines, interleukin-2 receptors, and neopterin after long-distance running. Clin Immunol Immunopathol 1992;63:188–195.
- 30.
Bruunsgaard H, Galbo H, Halkjaer-Kristensen J, et al.Exercise-induced increase in serum interleukin-6 in humans is related to muscle damage. J Physiol 1997;499:833–841.
- 31.↑
Ostrowski K, Rohde T, Zacho M, et al.Evidence that interleukin-6 is produced in human skeletal muscle during prolonged running. J Physiol 1998;508:949–953.
- 32.↑
Boehm U, Klamp T, Groot M, et al.Cellular responses to interferon-gamma. Annu Rev Immunol 1997;15:749–795.
- 33.↑
Joubert P, Silversides DW, Lavoie JP. Equine neutrophils express mRNA for tumour necrosis factor-alpha, interleukin (IL)-1beta, IL-6, IL-8, macrophage-inflammatory-protein-2 but not for IL-4, IL-5 and interferon-gamma. Equine Vet J 2001;33:730–733.
- 34.↑
Dinarello CA. Anti-cytokine therapies in response to systemic infection. J Invest Dermatol Symp Proc 2001;6:244–250.
Appendix
Nucleotide sequences of equine-specific primers used in a real-time PCR assay.
| Gene | Primers and probes (5′-3′)* | Product size (bp) | GenBank accession No. |
|---|---|---|---|
| IL-1β | Forward: CCGACACCAGTGACATGATGA | 64 | NM_001082526 |
| Reverse: TCCTCCTCAAAGAACAGGTCATTC | |||
| Probe: FAM ATTGCCGCTGCAGTAAG NFQ | |||
| IL-6 | Forward: GGATGCTTCCAATCTGGGTTCAAT | 65 | NM_001082496 |
| Reverse: TCCGAAAGACCAGTGGTGATTTT | |||
| Probe: FAM ATCAGGCAGGTCTCCTG NFQ | |||
| IL-10 | Forward: AGGACCAGCTGGACAACATG | 99 | NM_001082490 |
| Reverse: GGTAAAACTGGATCATCTCCGACAA | |||
| Probe: FAM CCAGGTAACCCTTAAAGTC NFQ | |||
| INF-γ | Forward: AGCAGCACCAGCAAGCT | 75 | NM_001081949 |
| Reverse: TTTGCGCTGGACCTTCAGA | |||
| Probe: FAM ATTCAGATTCCGGTAAATGA NFQ | |||
| TNF-α | Forward: TTACCGAATGCCTTCCAGTCAAT | 85 | NM_001081819 |
| Reverse: GGGCTACAGGCTTGTCACTT | |||
| Probe: FAM CCAGACACTCAGATCAT NFQ | |||
| β-Glucuronidase | Forward: GCTCATCTGGAACTTTGCTGATTTT | 85 | XM_001493514 |
| Reverse: CTGACGAGTGAAGATCCCCTTTT | |||
| Probe: FAM CTCTCTGCGGTGACTGG NFQ |
Each primer was used at a concentration of 18μM, and each probe was used at a concentration of 5μM.
