Food allergy mostly affecting the gastrointestinal tract and the skin is a serious problem in modern society and in various species. In children suspected to have atopic dermatitis, it is estimated that the prevalence of eczema in combination with intestinal manifestations is 35% to 40%.1–3 The prevalence of food allergy resulting in cutaneous symptoms without intestinal manifestations is unknown in humans, whereas 70% to 80% of dogs with food allergy have only skin problems.4 Because the pathogenesis of adverse food reactions in dogs has not yet been fully elucidated, we prefer to use the more general term, food hypersensitivity. In dogs and humans, food hypersensitivity commonly has a juvenile onset. From 33% to 52% of dogs with food hypersensitivity have clinical signs while < 1 year of age,5,6 and likewise, most cases of food allergy in humans occur in infants or children.7 Because the distribution of clinical signs is also comparable5 and dogs and humans share the same environmental conditions, dogs with spontaneous food hypersensitivity may be a good model to investigate the pathogenesis of this disease.
In humans, the healthy intestine is associated with a Th1 or tolerant environment8–10; however, the intestinal immune environment in food-allergic individuals has only been investigated sparsely. Recently, it was found that children with multiple food allergies (immediate and delayed type) had decreased TGF-β1 expression in duodenal lymphocytes in the epithelial and lamina propria compartments,11 suggesting a failure in oral tolerance with allergy as the outcome.
The cellular constitution of the healthy canine intestine is similar to that of humans.12–17 In addition, it has been found that the cytokine environment in the intestine of healthy dogs reflects a Th1 (cytokines IFN-γ and IL-18) or tolerant profile (cytokines TGF-β and IL-10).18 Cytokines have an important regulatory function in immune responsiveness, both in polarization of T cells toward Th1 or Th2 cells and in maintenance of tolerance (Treg cells). Differential expression of transcriptions factors that regulate cytokine gene expression reflects the type of immune response induced: Th1 (IFN-γ, IL-18, T-bet, and STAT-4), Th2 (IL-4, IL-13, GATA3, and STAT-6), or Treg (TGF-β, IL-10, and Foxp3). As an example, IL-4 activates STAT-6 and GATA-3 through binding to its receptor on Th2 cells, leading to transcription of additional IL-4 and other Th2 cytokines, and at the same time production of IFN-γ is inhibited.19–22 Although the role of transcription factors has not yet been elucidated in food allergy, in individuals with atopic asthma, STAT-6 (a Th2-related transcription factor) is overexpressed, GATA-3 (Th2 related) mRNA expression is increased, and T-bet (Th1 related) is reduced in lung tissue.23–26 The influence and role of transcription factors in T-cell responses have been reviewed by Wahl et al.27
Whereas the intestine is the first site of contact with food allergens, we hypothesized that the intestinal immune reactivity and accompanying transcription factor expression of dogs with CFH may be associated with a Th2 profile or a diminished expression of genes involved in oral tolerance. The purpose of the study reported here was to determine whether skin manifestations in CFH coincide with immune reactivity in the intestine in dogs by evaluation of T-cell phenotypes and cytokine and transcription factor expression in duodenal biopsy specimens of dogs with CFH after administration of a provocation diet and an elimination diet.
Materials and Methods
Animals and experimental design—Eleven adult client-owned dogs with CFH without intestinal clinical signs (5 females and 6 males; age, 10 months to 8 years [median, 4 years]) referred to the Utrecht University Faculty of Veterinary Medicine and 8 adult healthy control dogs (3 females and 5 males; age, 3 to 10 years [median, 8 years]) were included in the study. None of the client-owned or control dogs had feces of abnormal consistency or other gastrointestinal clinical signs for at least 6 months before entering the study. The CFH group consisted of 4 Labrador Retrievers and 1 dog of each of the following breeds: Shorthaired Dachshund, Beagle, mixed-breed, English Bulldog, English Cocker Spaniel, West Highland White Terrier, and German Shepherd Dog. The healthy control dogs were 4 Beagles and 4 mixed-breed dogs, owned by the University and housed in open kennels. Their regular food consisted of commercially available diets similar to those fed to pet dogs. The study was performed according to the guidelines of the Utrecht University Animal Experiments Committee. A diagnosis of CFH was confirmed by means of dietary testing: first, a minimum of 80% reduction in pruritus and associated clinical signs had to be achieved after a food trial that used a novel protein home-cooked diet of at least 8 weeks' duration; second, a provocation test with the original food had to result in reappearance of the clinical signs; and third, after a second elimination diet, the clinical signs had to resolve for a second time. The control dogs underwent a similar dietary regimen for 8, 2, and 2 weeks, which were the mean periods required for elimination, provocation, and second elimination test results, respectively. Prior to this dietary testing, the presence of intestinal parasites was evaluated by means of a fecal flotation test and microscopy. Moreover, all dogs were treated with paraciticidals before inclusion in the study.
Duodenal biopsy specimens were collected within 10 days after the onset of clinical signs caused by the dietary provocation (time 0) and after the disappearance of clinical signs as a result of the second elimination diet (time 1). Food was withheld for 14 to 18 hours before gastroduodenoscopy. Several duodenal biopsy specimens (2.3- to 4-mm diameter) were taken endoscopically by use of general anesthesia. Biopsy specimens were snap frozen in liquid nitrogen and stored at −70°C until processing. Additional biopsy specimens were fixed in neutral-buffered 4% formaldehydea for histopathologic evaluation (H&E staining).
RNA isolation—Frozen duodenal biopsy specimens were immersed in a phenol-guanidine isothiocyanate solutionb at 4°C and homogenized by use of a disperser.c Total RNA was isolated according to the manufacturer's instructions with the modification that an additional phenol-chloroform-isoamylalcohol (125:24:1; pH, 4.0) purification step was performed after the phenol and chloroform separation in the original protocol. The RNA was dissolved in 30 μL of RNase-free water, and the RNA concentration was determined via spectrophotometry.d The presence of genomic DNA was evaluated by use of quantitative PCR assay on the isolated RNA samples directly. Subsequently, 3 μg of RNA was transcribed into cDNA by use of an I-script cDNA synthesis kite according to the manufacturer's instructions. The cDNA was diluted 1:2 in RNAse-free water, aliquoted, and stored at −20°C until use in a quantitative PCR assay.
Primer design and quantitative PCR assay—Oligonucleotide primersf were designed for Th1-related genes (IL-12p40, IL-12p35, IL-18, IFN-γ, T-bet, STAT-4, and SOCS-5), Th2-related genes (IL-4, GATA-3, STAT-6, SOCS-3, and IL-13), and tolerance-related genes (IL-10, TGF-β, and Foxp3) and for IL-2, TNF-α, B7.1, and B7.2 on the basis of the sequences as described in projectg and sequence analysish software. The primer pairs were designed in such a way that they spanned an intron as an extra precaution to prevent the transcription of residual genomic DNA in the sample, except those for IFN-γ and SOCS-5. Each primer pair was tested for the optimum annealing temperature and PCR reaction efficiency. Primer sequences, intron overlap, and optimum annealing temperatures were tabulated (Appendix). All PCR products had sizes from 100 to 150 bp, and sequences were verifiedi before quantitative PCR analyses were started. The genes HPRT, RPS19, and RPS 5 were used as reference genes.28
For each quantitative PCR reaction, 1.5 μL of cDNA was used in a reaction volume of 25 μL containing 12.5 μL of commercial PCR mix containing cyanine dyej and 20 pmol of forward and reverse primers. Each PCR test was performed in triplicate in 96-well quantitative PCR plates.e Each plate contained an internal standard, which was generated by use of 4-fold dilutions of pooled cDNA from a mixture of canine concanavalin A–stimulated and unstimulated peripheral blood mononuclear cells, duodenal biopsy specimens, and lesional skin biopsy specimens. The internal standard was used to check the PCR reaction efficacy and intertest differences. All quantitative PCR assays were performed in a spectrofluorometric thermal cyclere with a 5-minute polymerase activation step and continued with 40 cycles containing a denaturing step at 95°C for 30 seconds, an annealing step for 30 seconds, and an elongation step at 72°C for 30 seconds with a final extension for 2 minutes at 72°C, followed by a melt-curve procedure. All PCR reaction efficiencies were from 95% to 105%, product melting curves revealed 1 product, and negative controls yielded negative results.
Immunohistochemical staining—Biopsy specimens were mounted,k and 6-μm cryostat sections were placed on positively charged slides,l dried, and stored at −70°C until use. After thawing, the tissue sections were fixed in cold 100% acetone for 10 minutes at 21°C. Endogenous peroxidase was eliminated by 20 minutes' incubation in Tris-buffered saline solution (0.05M Tris-HCl; 0.15M NaCl; pH, 7.5) supplemented with 0.3% hydrogen peroxidase, followed by washing in Tris-buffered saline solution. Sections were incubated for 25 minutes in blocking reagent (Tris-buffered saline solution with 10% inactivated normal horse serum) and subsequently incubated for 1 hour at 21°C with primary canine-specific antibodies diluted in 1% blocking reagent (CD3 [CA17.2A12,m 1:100], CD4 [CA13.1E4,m 1:20], CD8 [CA9.JD3,m 1:10], MHC-IIm [CA2.1C12, 1:60], γδ TCRn [1:50], and CD1cn [1:20]). After washing, sections were incubated for 45 minutes with horse anti-mouse biotin-labeled antibody, washed, and incubated for 45 minutes with peroxidase-labeled avidin-biotin complex.o Staining was developed with 3-amino-9-ethyl-carbazole, resulting in a red-brownish color, and sections were counterstained with hematoxylin. Stained cells in the epithelium and in the lamina propria of 3 randomly chosen villi in each tissue section were counted via light microscopy. Means of the number of stained cells (per square millimeter) were used for statistical analysis.
Statistical analysis—Because the cDNA input may vary among samples, results of quantitative PCR analysis of each sample were normalized to the mean quantities of gene expression measured via PCR assay for the endogenous reference genes (HPRT, RPS19, and RPS5)29 and expressed as relative gene expression, which was used in the statistical tests. The data were normally distributed (Kolmogorov-Smirnov test), as indicated by the combination of residues of the 1-way ANOVA test of the 2 independent groups of dogs (ie, healthy dogs and dogs with CFH). All variances were homogeneous as indicated by results of the Levene test. A repeated-measures ANOVA was used because there were 2 independent groups of dogs and 2 dependent groups of data (T0 after food challenge and T1 after the second elimination diet). Multiple comparisons were evaluated by use of the Bonferroni correction, which resulted in P ≤ 0.001 being considered significant.
The original immunohistochemical results were recorded as discontinuous values, so nonparametric statistical tests were used. For comparison between dogs with CFH and healthy dogs at time 0, the Mann-Whitney test was used; for comparison between time 0 and time 1, the Wilcoxon signed ranks test was used for both the absolute cell numbers and their ratios. Statistical softwarep was used for all analyses. A value of P ≤ 0.05 was considered significant.
Results
Analysis of the mRNA expression of grouped Th1-related genes (IL-18, SOCS-5, IL-12, STAT-4, T-bet, TNF-α and IFN-γ), Th2-related genes (IL-4, IL-13, GATA-3, STAT-6, and SOCS-3), and tolerance-related genes (Foxp3, TGF-β and IL-10) did not reveal differences in expression between dogs with CFH and healthy dogs. Expression was not affected by the elimination diet (Figure 1).
Mean ± SD expression of grouped Th1-, Th2-, and Treg-related mRNA in duodenal biopsy specimens of dogs after use of a provocation diet (T0) and an elimination diet (T1). Values represent ratios of mRNA expression in each group, compared with control dogs at T0. Black bars = Control T0 group. White bars = Control T1 group. Vertically striped bars = CFH T0 group. Horizontally striped bars = CFH T1 group.
Citation: American Journal of Veterinary Research 71, 4; 10.2460/ajvr.71.4.441
Mean ± SD expression of grouped Th1-, Th2-, and Treg-related mRNA in duodenal biopsy specimens of dogs after use of a provocation diet (T0) and an elimination diet (T1). Values represent ratios of mRNA expression in each group, compared with control dogs at T0. Black bars = Control T0 group. White bars = Control T1 group. Vertically striped bars = CFH T0 group. Horizontally striped bars = CFH T1 group.
Citation: American Journal of Veterinary Research 71, 4; 10.2460/ajvr.71.4.441
Mean ± SD expression of grouped Th1-, Th2-, and Treg-related mRNA in duodenal biopsy specimens of dogs after use of a provocation diet (T0) and an elimination diet (T1). Values represent ratios of mRNA expression in each group, compared with control dogs at T0. Black bars = Control T0 group. White bars = Control T1 group. Vertically striped bars = CFH T0 group. Horizontally striped bars = CFH T1 group.
Citation: American Journal of Veterinary Research 71, 4; 10.2460/ajvr.71.4.441
Analysis of mRNA expression of the individual Th1-, Th2-, tolerance-related, and IL-2, B7.1, and B7.2 genes in duodenal tissue revealed that the expression was not altered in the CFH group after the elimination diet, and differences were not seen in gene expression between dogs with CFH and control dogs after provocation (time 0).
As revealed via immunohistochemical staining, the numbers of CD3+, CD8+, CD4+, CD1c+, γδ T-cell receptor+, and major histocompatability complex II+ cells in duodenal epithelium and lamina propria were similar in dogs with CFH and healthy dogs (Figures 2 and 3). The dietary changes had no influence on these absolute cell numbers or their ratios. Histologic examination (H&E staining) revealed normal epithelium on the villi and in the crypts with a low number of intraepithelial lymphocytes. The lamina propria had a typical amount of plasma cells and lymphocytes with occasionally one or a few eosinophilic granulocytes in the control dogs and the dogs with only cutaneous manifestations of adverse reactions. The results were similar at both time points.
Mean ± SD cell counts in a 0.1-mm2 area of duodenal epithelium of control dogs and dogs with CFH determined after use of a provocation diet (T0) and an elimination diet (T1). TCR = T-cell receptor. MHC = Major histocompatibility complex. See Figure 1 for key.
Citation: American Journal of Veterinary Research 71, 4; 10.2460/ajvr.71.4.441
Mean ± SD cell counts in a 0.1-mm2 area of duodenal epithelium of control dogs and dogs with CFH determined after use of a provocation diet (T0) and an elimination diet (T1). TCR = T-cell receptor. MHC = Major histocompatibility complex. See Figure 1 for key.
Citation: American Journal of Veterinary Research 71, 4; 10.2460/ajvr.71.4.441
Mean ± SD cell counts in a 0.1-mm2 area of duodenal epithelium of control dogs and dogs with CFH determined after use of a provocation diet (T0) and an elimination diet (T1). TCR = T-cell receptor. MHC = Major histocompatibility complex. See Figure 1 for key.
Citation: American Journal of Veterinary Research 71, 4; 10.2460/ajvr.71.4.441
Mean ± SD cell counts in a 0.1-mm2 area of duodenal lamina propria of control dogs and dogs with CFH determined after use of a provocation diet (T0) and an elimination diet (T1). See Figures 1 and 2 for key.
Citation: American Journal of Veterinary Research 71, 4; 10.2460/ajvr.71.4.441
Mean ± SD cell counts in a 0.1-mm2 area of duodenal lamina propria of control dogs and dogs with CFH determined after use of a provocation diet (T0) and an elimination diet (T1). See Figures 1 and 2 for key.
Citation: American Journal of Veterinary Research 71, 4; 10.2460/ajvr.71.4.441
Mean ± SD cell counts in a 0.1-mm2 area of duodenal lamina propria of control dogs and dogs with CFH determined after use of a provocation diet (T0) and an elimination diet (T1). See Figures 1 and 2 for key.
Citation: American Journal of Veterinary Research 71, 4; 10.2460/ajvr.71.4.441
Discussion
To the authors' knowledge, the present study was the first to investigate the cellular infiltrates and mRNA expression of Th1-, Th2-, and Treg-related genes in duodenal biopsy specimens of dogs with food hypersensitivity with cutaneous clinical signs only. Although the dogs with CFH were selected on the basis of absence of intestinal clinical signs, an immune response was still expected to have occurred in the intestine where the first contact with the allergens takes place. The duodenum, rather than ileum or jejunum, was chosen as sampling site because it is the initial place of digestion and absorption of food constituents, including allergens. In addition, from a practical point of view, the duodenum may be readily approached via gastroduodenoscopy. The duodenal biopsy specimens were taken after the cutaneous clinical signs were observed and again after the clinical signs disappeared because of the dietary changes. Consequently, in dogs with CFH, we expected a higher expression of the Th2-associated genes responsible for the presence of clinical signs of food hypersensitivity and a decreased Th2 mRNA expression or increased immune-tolerance–related gene expression when the clinical signs disappeared. In contrast to these expectations, expression of the Th1 and Th2 genes did not differ between dogs with CFH and healthy dogs at the time the clinical signs were observed, and the elimination diet did not influence the duodenal expression of these genes in the dogs with CFH.
Because dogs with CFH are characterized by cutaneous clinical signs only, the lack of intestinal signs may be explained by a more tolerant intestinal environment, compared with the healthy dogs. This hypothesis was not supported by our findings because the CFH group did not have greater expression of tolerance-related genes (Foxp3, TGF-β and IL10), indicating that, from the perspective of T-cell regulation, dogs with CFH did not differ from healthy dogs.
No distinct cellular infiltrate or Th1-, Th2-, or Treg-related gene expression patterns or an influence by the elimination diet were observed in dogs with CFH, compared with the healthy dogs, despite cutaneous clinical signs of CFH. Recently, it was determined in corn-allergic dogs with cutaneous clinical signs only that despite relapse or disappearance of cutaneous clinical signs, no changes in blood CD4+CCR4+, corn-activated CD4+ cells, or IgE occurred,30 supporting the idea that the immunologic changes are focused in the skin. One reason for that finding may be the time at which the duodenal biopsy specimens were taken. For practical reasons, endoscopy was done from 4 to 10 days after pruritis reappeared (as determined via a provocation test) and after it was reduced for > 80% (via an elimination diet) according to the dog owners' information. Although substantial changes may have occurred between relapse or disappearance of clinical signs and endoscopy, we consider this scenario highly unlikely. In contrast, we expect these changes to persist in this chronic exposure setup, rather than fluctuate or disappear, as long as food exposure is unchanged during such a period.
The change in cutaneous clinical signs without a measurable mucosal immune response suggests that an intrinsic reaction occurs independently of the mucosal allergen exposure or that exposure occurs at a location other than the place where the mucosal biopsy specimens were taken. In the present study, duodenal biopsy specimens were taken, carefully circumventing the Peyer's patches, because we were mainly interested in the effector T cells residing in the mucosa and their reactivity at the end of the elimination diet. The possible pathways of antigen entry into the intestine and antigen presentation to naive T cells or systemic distribution are not fully elucidated.31 However, there is increasing evidence in mice that antigen is taken up by the enterocytes and dendritic cells in the mucosa32–34 and lamina propria dendritic cells migrate to the mesenteric lymph nodes.35,36 Worbs et al37 suggest that oral tolerance is regulated solely in the mesenteric lymph nodes and that induction of oral tolerance relies on the lymph that is drained from the intestine, which likely contains antigen transported via lamina propria dendritic cells. Their suggestion implies that allergen recognition occurs in the mesenteric lymph nodes and not in the mucosa, which supports absence of distinct Th1, Th2, or Treg changes in intestinal tissue observed in our study. The allergens or T cells may be distributed throughout the body from the mesenteric lymph nodes via blood or lymph and cause the cutaneous clinical signs.
Results of the present study, which evaluated factors before and after administration of the elimination diet, did not indicate a role for Th subsets in the duodenal tissue in immune regulation or dysregulation in dogs with CFH with only cutaneous signs. We hypothesize that the immune mechanism in cutaneous food allergy at the mucosal level is different from the patterns that are seen in human intestinal food allergy.11,38–43 It has been determined that circulating cells in animals with atopic dermatitis and allergic asthma do not express typical Th1 or Th2 genes despite being primed to home to the skin and express genes involved in activation or proliferation. Upon culture of these cells in the presence of allergen, the cells produced Th2- or Th1-related mRNA.44–46 When immune cells are only primed, but do not develop to Th1, Th2, or Treg/Th3 in vivo as suggested for peripheral blood mononuclear cells in atopic dermatitis,45 this may explain the lack of a reaction by intestinal T cells, which normally are memory T cells47 in a Th1-like and immunosuppressive environment. Additionally, neither significant differences in the expression of Treg-related genes nor differences in cellular infiltrate were found in the present study, supporting the idea that the primed intestinal cells might not develop into Th1, Th2, or Treg cells in the mucosa upon allergen stimulation. Another possible explanation of the lack of changes at the level of T cells might be that differences in the humoral immune system in dogs with CFH are involved in this clinical phenotype. Further research on the role of the humoral immune system in dogs with CFH is therefore justified.
The present study revealed no change in T-cell presence or a clear Th1, Th2, or Treg profile at the duodenal mucosal level in dogs with CFH after dietary provocation, and this profile did not change after administration of the elimination diet despite the disappearance of clinical skin signs. Results suggested that the intestinal mucosa is not the primary site of T-cell activation that eventually leads to cutaneous food hypersensitivity.
ABBREVIATIONS
| CFH | Cutaneous food hypersensitivity |
| Foxp3 | Forkhead box P3 |
| GATA3 | GATA binding protein 3 |
| IFN | Interferon |
| IL | Interleukin |
| SOCS | Suppressor of cytokine signaling |
| STAT | Signal transducer and activator of transcription |
| T-bet | T-box transcription factor 21, T-box expressed in T cells |
| TGF | Transforming growth factor |
| Th | T helper |
| TNF | Tumor necrosis factor |
| Treg | T regulatory |
Klinipath BV, Duiven, The Netherlands.
TRIzol, Invitrogen Corp, Carlsbad, Calif.
T8 Ultra-turrax, IKA Labortechnik GmBH, Staufen, Germany.
ND-1000, NanoDrop, Wilmington, Del.
BioRad, Veenendaal, The Netherlands.
Eurogentec, Maastricht, The Netherlands.
Ensembl, version 32, European Bioinformatics Institute and Wellcome Trust Sanger Institute, Cambridge, England. Available at: www.ensembl.org/. Accessed April 1, 2005.
Primer-3, Howard Hughes Medical Institute, Chevy Chase, Md.
ABI PRISM 3100 Genetic Analyser, Applied Biosystems, Foster City, Calif.
iQ SYBR Green Supermix, BioRad, Veenendaal, The Netherlands.
Tissue-Tek OCT Compound, Sakura Finetek Europe BV, Zoeterwoude, The Netherlands.
Superfrost Plus, Menzel-Glaser, Braunschweig, Germany.
Serotec Ltd, Oxford, England.
Kindly provided by Peter F. Moore, University of California-Davis, Davis, Calif.
Vectastain ABC systems, Vector Laboratories, Burlingame, Calif.
SPSS software, Benelux, Gorinchem, The Netherlands.
References
- 1.
Burks AW, James JM, Hiegel A, et al.Atopic dermatitis and food hypersensitivity reactions. J Pediatr 1998;132:132–136.
- 2.
Eigenmann PA, Sicherer SH, Borkowski TA, et al.Prevalence of IgE-mediated food allergy among children with atopic dermatitis. Pediatrics 1998;101:e8.
- 3.
Pourpak Z, Farhoudi A, Mahmoudi M, et al.The role of cow milk allergy in increasing the severity of atopic dermatitis. Immunol Invest 2004;33:69–79.
- 4.↑
Hillier A, Griffin CE. The ACVD task force on canine atopic dermatitis (X): is there a relationship between canine atopic dermatitis and cutaneous adverse food reactions? Vet Immunol Immunopathol 2001;81:227–231.
- 5.↑
Scott DW, Miller WH, Griffin CE. Skin immune system and allergic skin diseases. In: Scott DW, Miller WH, Griffin CE, eds. Muller and Kirk's small animal dermatology. 6th ed. Philadelphia: WB Saunders Co, 2001;615–624.
- 6.
Picco F, Zinit E, Nett C, et al.A prospective study on canine atopic dermatitis and food-induced allergic dermatitis in Switzerland. Vet Dermatol 2008;19:150–155.
- 8.
Braunstein J, Qiao L, Autschbach F, et al.T cells of the human intestinal lamina propria are high producers of interleukin-10. Gut 1997;41:215–220.
- 9.
Carol M, Lambrechts A, Van Gossum A, et al.Spontaneous secretion of interferon gamma and interleukin 4 by human intraepithelial and lamina propria gut lymphocytes. Gut 1998;42:643–649.
- 10.
Makita S, Kanai T, Oshima S, et al.CD4+CD25bright T cells in human intestinal lamina propria as regulatory cells. J Immunol 2004;173:3119–3130.
- 11.↑
Pérez-Machado MA, Ashwood P, Thomson MA, et al.Reduced transforming growth factor-β1-producing T cells in the duodenal mucosa of children with food allergy. Eur J Immunol 2003;33:2307–2315.
- 12.
James SP. The gastrointestinal mucosal immune system. Dig Dis 1993;11:146–156.
- 13.
Lundqvist C, Baranov V, Hammarstrom S, et al.Intra-epithelial lymphocytes. Evidence for regional specialization and extrathymic T cell maturation in the human gut epithelium. Int Immunol 1995;7:1473–1487.
- 14.
German AJ, Hall EJ, Day MJ. Analysis of leucocyte subsets in the canine intestine. J Comp Pathol 1999;120:129–145.
- 15.
German AJ, Hall EJ, Moore PF, et al.The distribution of lymphocytes expressing αβ and γδ T-cell receptors, and the expression of mucosal addressin cell adhesion molecule-1 in the canine intestine. J Comp Pathol 1999;121:249–263.
- 16.
Sonea IM, Harkins K, Wannemuehler MJ, et al.Flow cytometric analysis of canine colonic mucosal lymphocytes from endoscopically obtained biopsy specimens. Am J Vet Res 1999;60:346–353.
- 17.
Sonea IM, Jergens AE, Sacco RE, et al.Flow cytometric analysis of colonic and small intestinal mucosal lymphocytes obtained by endoscopic biopsy in the healthy dog. Vet Immunol Immunopathol 2000;77:103–119.
- 18.↑
Peters IR, Helps CR, Calvert EL, et al.Cytokine mRNA quantification in histologically normal canine duodenal mucosa by realtime RT-PCR. Vet Immunol Immunopathol 2005;103:101–111.
- 19.
Kaplan MH, Schindler U, Smiley ST, et al.Stat6 is required for mediating responses to IL-4 and for development of Th2 cells. Immunity 1996;4:313–319.
- 20.
Shimoda K, van Deursen J, Sangster MY, et al.Lack of IL-4-induced Th2 response and IgE class switching in mice with disrupted Stat6 gene. Nature 1996;380:630–633.
- 21.
Zheng W, Flavell RA. The transcription factor GATA-3 is necessary and sufficient for Th2 cytokine gene expression in CD4 T cells. Cell 1997;89:587–596.
- 22.
Ouyang W, Ranganath SH, Weindel K, et al.Inhibition of Th1 development mediated by GATA-3 through an IL-4-independent mechanism. Immunity 1998;9:745–755.
- 23.
Nakamura Y, Ghaffar O, Olivenstein R, et al.Gene expression of the GATA-3 transcription factor is increased in atopic asthma. J Allergy Clin Immunol 1999;103:215–222.
- 24.
Christodoulopoulos P, Cameron L, Nakamura Y, et al.TH2 cytokine-associated transcription factors in atopic and nonatopic asthma: evidence for differential signal transducer and activator of transcription 6 expression. J Allergy Clin Immunol 2001;107:586–591.
- 25.
Mullings RE, Wilson SJ, Puddicombe SM, et al.Signal transducer and activator of transcription 6 (STAT-6) expression and function in asthmatic bronchial epithelium. J Allergy Clin Immunol 2001;108:832–838.
- 26.
Finotto S, Neurath MF, Glickman JN, et al.Development of spontaneous airway changes consistent with human asthma in mice lacking T-bet. Science 2002;295:336–338.
- 27.↑
Wahl SM, Vazquez N, Chen W. Regulatory T cells and transcription factors: gatekeepers in allergic inflammation. Curr Opin Immunol 2004;16:768–774.
- 28.↑
Brinkhof B, Spee B, Rothuizen J, et al.Development and evaluation of canine reference genes for accurate quantification of gene expression. Anal Biochem 2006;356:36–43.
- 29.↑
Vandesompele J, De Preter K, Pattyn F, et al.Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol 2002;3 (7):RESEARCH0034.
- 30.↑
Olivry T, Kurata K, Paps JS, et al.A blinded randomized controlled trial evaluating the usefulness of a novel diet (Aminoprotect Care) in dogs with spontaneous food allergy. J Vet Med Sci 2007;69:1025–1031.
- 31.↑
Mowat AM. Anatomical basis of tolerance and immunity to intestinal antigens. Nat Rev Immunol 2003;3:331–341.
- 32.
Chirdo FG, Millington OR, Beacock-Sharp H, et al.Immunomodulatory dendritic cells in intestinal lamina propria. Eur J Immunol 2005;35:1831–1840.
- 33.
Niess JH, Brand S, Gu X, et al.CX3CR1-mediated dendritic cell access to the intestinal lumen and bacterial clearance. Science 2005;307:254–258.
- 34.
Rescigno M, Urbano M, Valzasina B, et al.Dendritic cells express tight junction proteins and penetrate gut epithelial monolayers to sample bacteria. Nat Immunol 2001;2:361–367.
- 35.
Huang FP, Platt N, Wykes M, et al.A discrete subpopulation of dendritic cells transports apoptotic intestinal epithelial cells to T cell areas of mesenteric lymph nodes. J Exp Med 2000;191:435–444.
- 36.
Jang MH, Sougawa N, Tanaka T, et al.CCR7 is critically important for migration of dendritic cells in intestinal lamina propria to mesenteric lymph nodes. J Immunol 2006;176:803–810.
- 37.↑
Worbs T, Bode U, Yan S, et al.Oral tolerance originates in the intestinal immune system and relies on antigen carriage by dendritic cells. J Exp Med 2006;203:519–527.
- 38.
Schade RP, Van Ieperen-Van Dijk AG, Van Reijsen FC, et al.Differences in antigen-specific T-cell responses between infants with atopic dermatitis with and without cow's milk allergy: relevance of TH2 cytokines. J Allergy Clin Immunol 2000;106:1155–1162.
- 39.
Turcanu V, Maleki SJ, Lack G. Characterization of lymphocyte responses to peanuts in normal children, peanut-allergic children, and allergic children who acquired tolerance to peanuts. J Clin Invest 2003;111:1065–1072.
- 40.
Rautava S, Isolauri E. Cow's milk allergy in infants with atopic eczema is associated with aberrant production of interleukin-4 during oral cow's milk challenge. J Pediatr Gastroenterol Nutr 2004;39:529–535.
- 41.
Thottingal TB, Stefura BP, Simons FE, et al.Human subjects without peanut allergy demonstrate T cell-dependent, TH2-biased, peanut-specific cytokine and chemokine responses independent of TH1 expression. J Allergy Clin Immunol 2006;118:905–914.
- 42.
Beyer K, Castro R, Birnbaum A, et al.Human milk-specific mucosal lymphocytes of the gastrointestinal tract display a TH2 cytokine profile. J Allergy Clin Immunol 2002;109:707–713.
- 43.
Tiemessen MM, Van Ieperen-Van Dijk AG, Bruijnzeel-Koomen CAFM, et al.Cow's milk-specific T-cell reactivity of children with and without persistent cow's milk allergy: key role for IL-10. J Allergy Clin Immunol 2004;113:932–939.
- 44.
Heishi M, Kagaya S, Katsunuma T, et al.High-density oligonucleotide array analysis of mRNA transcripts in peripheral blood cells of severe atopic dermatitis patients. Int Arch Allergy Immunol 2002;129:57–66.
- 45.↑
Hijnen D, Nijhuis E, Bruin-Weller M, et al.Differential expression of genes involved in skin homing, proliferation, and apoptosis in CD4+ T cells of patients with atopic dermatitis. J Invest Dermatol 2005;125:1149–1155.
- 46.
Matsumoto Y, Oshida T, Obayashi I, et al.Identification of highly expressed genes in peripheral blood T cells from patients with atopic dermatitis. Int Arch Allergy Immunol 2002;129:327–340.
Appendix
Quantitative PCR primer sequences and annealing temperatures used in a study of dogs with CFH.
| Gene | Primer sequence (5′–3′) | Annealing temperature (°C) |
|---|---|---|
| IL-4 | F: ccaaagaacacaagcgataaggaa | 61 |
| R: gtttgccatgctgctgaggtt | ||
| IL-10 | F: cccgggctgagaaccacgac | 63 |
| R: aaatgcgctcttcacctgctccac | ||
| IL-12p40 | F: ggacgtttcacatgctggt | 59 |
| R: ccactctgaccctctctgct | ||
| IL-12p35 | F: taatggatcccaagaggcag | 62.5 |
| R: tcaagggaggatttctgtgg | ||
| IL-2 | F: atgagaacccccaactctcc | 57 |
| R: gcacttcctccaggtttttg | ||
| IL-18 | F: gaggatatgcccgattctga | 56 |
| R: tccggaggactcatttctg | ||
| IFN-γ | F: agcgcaaggcgataaatg | 55.8 |
| R: gcggcctcgaaacagatt | ||
| TGF-β | F: caaggatctgggctggaagtgga | 65 |
| R: ccaggaccttgctgtactgcgtgt | ||
| GATA-3 | F: tacgtccccgaatacagctc | 64 |
| R: actccctgccttctgtgct | ||
| T-bet | F: aatcagcaccagacggagat | 61.2 |
| R: gtccacgaacatccggtaat | ||
| STAT-4 | F: actggaagaggcgacaacag | 59 |
| R: gccttctgagttggaacagg | ||
| STAT-6 | F: aactgcagcggctctatgtc | 64 |
| R: catgttgcagcagaaggtgt | ||
| SOCS-5 | F: tctgccgtgcagtaatctgt | 61 |
| R: gccttgactggttctcgttc | ||
| TNF-α | F: ccccgggctccagaaggtg | 64 |
| R: gcagcaggcagaagagtgtggtg | ||
| SOCS-3 | F: acaccagcctgcgcctcaagacct | 63 |
| R: cgcctcgccgcccgtca | ||
| IL-13 | F: gaggagctggtcaacatca | 59 |
| R: tgcagtcggagacattga | ||
| B7.1 | F: acagcgaagtggagaacacc | 61 |
| R: ctggatgatgcctgaacaga | ||
| B7.2 | F: ctgaagcaagcaatgtgagc | 59 |
| R: atcaggggtgggtttcgtat | ||
| HPRT | F: agcttgctggtgaaaaggac | 56 |
| R: ttatagtcaagggcatatcc | ||
| RPS19 | F: ccttcctcaaaaagtctggg | 61 |
| R: gttctcatcgtagggagcaag | ||
| RPS5 | F: tcactggtgagaaccccct | 62.5 |
| R: cctgattcacacggcgtag | ||
| Foxp3 | F: caaatggtgtctgcaagtgg | 59 |
| R: gtgctctgcccttctcatct |
F = Forward. R = Reverse.
