Effects of glucocorticoids and interleukin-1β on expression and activity of aggrecanases in equine chondrocytes

Evita Busschers Department of Clinical Studies, New Bolton Center, School of Veterinary Medicine, University of Pennsylvania, Kennett Square, PA 19348.

Search for other papers by Evita Busschers in
Current site
Google Scholar
PubMed
Close
 DVM
,
Jeff P. Holt Department of Clinical Studies, New Bolton Center, School of Veterinary Medicine, University of Pennsylvania, Kennett Square, PA 19348.

Search for other papers by Jeff P. Holt in
Current site
Google Scholar
PubMed
Close
 BS
, and
Dean W. Richardson Department of Clinical Studies, New Bolton Center, School of Veterinary Medicine, University of Pennsylvania, Kennett Square, PA 19348.

Search for other papers by Dean W. Richardson in
Current site
Google Scholar
PubMed
Close
 DVM

Click on author name to view affiliation information

Abstract

Objective—To determine effects of interleukin (IL)-1β and glucocorticoids on total glycosaminoglycan (GAG) loss and aggrecanase-mediated matrix degradation in equine cartilage.

Sample Population—Cartilage from 24 equine cadavers free of sepsis and musculoskeletal disease.

Procedures—Effects of IL-1β, IL-1β with glucocorticoids (dexamethasone and triamcinolone, 10−6 and 10−7M), and glucocorticoids alone on degradation of equine articular and nasal cartilage explants were assessed by measuring GAG release in media and GAG content in cartilage. Aggrecanase-mediated cleavage within the interglobular domain at Glu373-Ala374 was evaluated via western blot analysis and ELISAs. Steady-state mRNA concentrations of matrix metalloproteinase (MMP)-3, MMP-13, a disintegrin and metalloproteinase with thrombospondin motifs (ADAMTS)4, and ADAMTS5 were assessed by use of real-time reverse transcriptase PCR assay (cartilage explants) and northern blot analysis (cell culture).

Results—IL-1β increased GAG release and aggrecanase activity (11-fold). The MMP-3, MMP-13, and ADAMTS4 mRNA were upregulated with IL-1β, whereas ADAMTS5 mRNA was increased (13-fold), but significantly less than ADAMTS4 mRNA (27-fold), suggesting a role for both ADAMTS4 and ADAMTS5 in degradation of cytokine-stimulated cartilage. Despite downregulation of MMP-3 and MMP-13 mRNA, glucocorticoids did not alter GAG degradation. A further increase in aggrecanase activity was detected with ELISAs and western blot analysis, whereas ADAMTS4 mRNA was downregulated and ADAMTS5 mRNA was maintained or upregulated.

Conclusions and Clinical Relevance—MMP-3, MMP-13, and ADAMTS4 were regulated differently than ADAMTS5. Glucocorticoids increased aggrecanase activity despite down-regulation of ADAMTS4 mRNA, suggesting a major role of ADAMTS5. Effects of glucocorticoids on aggrecanase activity have important implications in terms of treatment.

Abstract

Objective—To determine effects of interleukin (IL)-1β and glucocorticoids on total glycosaminoglycan (GAG) loss and aggrecanase-mediated matrix degradation in equine cartilage.

Sample Population—Cartilage from 24 equine cadavers free of sepsis and musculoskeletal disease.

Procedures—Effects of IL-1β, IL-1β with glucocorticoids (dexamethasone and triamcinolone, 10−6 and 10−7M), and glucocorticoids alone on degradation of equine articular and nasal cartilage explants were assessed by measuring GAG release in media and GAG content in cartilage. Aggrecanase-mediated cleavage within the interglobular domain at Glu373-Ala374 was evaluated via western blot analysis and ELISAs. Steady-state mRNA concentrations of matrix metalloproteinase (MMP)-3, MMP-13, a disintegrin and metalloproteinase with thrombospondin motifs (ADAMTS)4, and ADAMTS5 were assessed by use of real-time reverse transcriptase PCR assay (cartilage explants) and northern blot analysis (cell culture).

Results—IL-1β increased GAG release and aggrecanase activity (11-fold). The MMP-3, MMP-13, and ADAMTS4 mRNA were upregulated with IL-1β, whereas ADAMTS5 mRNA was increased (13-fold), but significantly less than ADAMTS4 mRNA (27-fold), suggesting a role for both ADAMTS4 and ADAMTS5 in degradation of cytokine-stimulated cartilage. Despite downregulation of MMP-3 and MMP-13 mRNA, glucocorticoids did not alter GAG degradation. A further increase in aggrecanase activity was detected with ELISAs and western blot analysis, whereas ADAMTS4 mRNA was downregulated and ADAMTS5 mRNA was maintained or upregulated.

Conclusions and Clinical Relevance—MMP-3, MMP-13, and ADAMTS4 were regulated differently than ADAMTS5. Glucocorticoids increased aggrecanase activity despite down-regulation of ADAMTS4 mRNA, suggesting a major role of ADAMTS5. Effects of glucocorticoids on aggrecanase activity have important implications in terms of treatment.

Glucocorticoids are commonly used as intra-articular medications in the management of arthritis. Despite the clinical success often evident after intraarticular administration of glucocorticoids, there is concern that their beneficial effects are outweighed by deleterious effects on articular cartilage. A major component of degradation of cartilage is loss of proteoglycan, especially aggrecan. Proteolytic cleavage of aggrecan within the IGD may be caused by MMP activity, but aggrecanases appear to be more important in this process than are MMPs.1–7 The first major aggrecanase identified was found to be a member of the ADAMTS family of proteins.8 The first aggrecanase identified was ADAMTS4, which was followed by ADAMTS5 (initially termed ADAMTS11).9

Given the importance of aggrecanases ADAMTS4 and ADAMTS5, information about modulation of their activity is essential. Several studies have revealed a diversity of regulatory mechanisms, including those attributable to substrate structure (glycosylation),10,11 endogenous inhibitors,12–14 posttranslational processing,15–18 and transcriptional regulation.19–25 The exact contribution of each aggrecanase to the proteolysis of aggrecan in diseased cartilage is unknown. Studies25–28 in transgenic mice have indicated that elimination of ADAMTS5 markedly diminishes cartilage matrix degradation, whereas mice without ADAMTS4 activity still lose matrix proteoglycan.29 Analysis of the results of these studies indicates the importance of ADAMTS5 in degradation of cartilage, but other reports5,30 indicate that the role of MMPs and ADAMTS4 should not be discounted. Understanding the regulation of both ADAMTS4 and ADAMTS5 will be critical in advancing the ability of clinicians to manage arthritis. The study reported here was conducted to determine the effects of IL-1β and glucocorticoids on total GAG loss and aggrecanase-mediated matrix degradation in cartilage explants and to determine the effects on steady-state mRNA concentrations of ADAMTS4 and ADAMTS5 in cultured, isolated chondrocytes and chondrocytes in explant culture. It was hypothesized that ADAMTS4 and ADAMTS5 would be regulated differently by cytokines and glucocorticoids. It was also hypothesized that IL-1β would increase the aggrecanase activity in cartilage explants and that glucocorticoids would further increase this activity. Finally, we hypothesized that the increase in aggrecanase activity would primarily be attributable to ADAMTS5 and not to ADAMTS4.

Materials and Methods

Sample population—Articular cartilage from grossly normal joints and nasal septum cartilage were aseptically harvested from 24 equine cadavers within 12 hours after the horses were euthanized. The horses comprised 6 foals (< 12 months old), 6 yearlings (12 to 24 months old), and 12 adults (2 to 5 years old). Horses did not have evidence of sepsis or musculoskeletal disease.

Cell culture—Articular cartilage obtained from 11 of the equine cadavers was minced with a scalpel and digested overnight in basal digestion media (70mM NaCl, 30mM KCl, 3mM K2HPO4, 1mM CaCl2, 10mM NaHCO3, 60mM sorbitol, 5 mg of dextrose/mL, and 1 mg of albumin/mL in 25mM HEPESa [pH, 7.2] supplemented with 30μM tosyl-lysyl-chloromethanea) and 0.5% collagenase-D.b After digestion, the isolated chondrocytes were rinsed with PBS solution and counted. Viability was assessed by use of trypan blue staining, and an experiment was continued only when the proportion of viable cells was > 95%. Isolated chondrocytes (10 × 106) were distributed in 30-mm culture dishes treated with poly-2-hydroxyethyl methacrylateb to prevent cell adhesion and maintain cartilage phenotype.31 The suspension cultures were maintained at 37°C with 5% carbon dioxide at saturated humidity in high-glucose Dulbecco modified Eagle media, 10% fetal calf serum, gentamicin (50 μg/mL), amphotericin B (0.25 μg/mL), and ascorbic acid (50 μg/mL). After incubation for 24 hours, the cells were washed twice with serum-free media, which was followed by incubation in serum-free media containing the various treatments. The cells were treated with human recombinant IL-1βc (5 ng/mL) alone, dexamethasone (10−6 or 10−7M) or triamcinolone (10−6 or 10−7M) alone, and IL-1β and dexamethasone (10−6 or 10−7M) or triamcinolone (10−6 or 10−7M). After incubation with the treatment for 24 hours, cells and spent media were harvested.

Explants of nasal septum cartilage—Explants of nasal septum cartilage were obtained from 18 of the equine cadavers. After the skull of each equine cadaver was sectioned longitudinally, the septum was removed and the mucosal surfaces were washed extensively with 2% chlorhexidine solution and rinsed with sterile PBS solution. The mucous membrane was removed, and a 6-mm biopsy punch was used to harvest cartilage disks. The disks were washed 3 times in PBS solution that contained antimicrobials. Viability was assessed via ethidium homodimer–calcein staining,d and > 90% viable cells was required for further processing of the remaining disks.

The disks were maintained under the same culture conditions as those described for the aforementioned articular cell culture. After 48 hours in culture, the disks were washed twice with serum-free media; they then were incubated in fresh serum-free media containing the various treatments, similar to procedures used for the articular cell cultures. After incubation with the respective treatments for 72 hours, the disks and spent media were harvested. Each disk was blotted dry by use of a standard technique (3 s/side on a fresh paper towel), weighed, and minced. The explants were extracted by incubation for 3 to 5 days in a solution consisting of 1.2 mL of 4M guanidinium HCl and 0.05M sodium acetate (pH, 6.8) that contained protease inhibitors (0.01M EDTA and 0.1M 6-amino hexanoic acid), 0.005M benzamidine HCl, and 0.01M n-ethylmaleimide. Duplicates of explants from 8 equine cadavers were stored in liquid nitrogen at −80°C for RT PCR analysis.

Articular cartilage explants—Articular cartilage explants were obtained from grossly normal stifle joints of 7 equine cadavers. The explants were obtained aseptically with a 6-mm biopsy punch, after which the cartilage was separated from the subchondral bone. Processing, viability assessment, culture conditions, treatments, harvesting, and extraction of GAG were similar to those for nasal septum cartilage explants. Duplicates were obtained and stored in liquid nitrogen at −80°C for RT PCR analysis.

Quantitation of GAG—The GAG content of media and cartilage extracts was measured by use of a dimethylmethylene blue assay. Chondroitin sulfate-C from shark cartilage was used as a standard.32

Northern blot analysis—Cells were solubilized in monophasic acid phenol.e Total RNA was extracted, quantitated in a UV spectrophotometer, and separated in 1% denaturing agarose gels (10 μg/lane). The gels were capillary blotted to charged nylon membranesf and UV cross-linked. Random primed [32P] deoxycytidine triphosphate–labeled probes were prepared by use of cDNA for MMP-3, MMP-13, ADAMTS4, ADAMTS5, and the housekeeping gene EF1. A commercial bufferg was used for prehybridization and hybridization at 65°C for 30 minutes and 12 hours, respectively; membranes were then washed twice for 20 minutes at 55°C with 0.5X and 0.25X sodium citrate solution with 0.1% SDS. Membranes were exposed in phosphor-storage cassettes,h and images were quantified by use of imaging software.i

Real-time RT PCR assay—Frozen cartilage explants were pulverized with a freezer millj and solubilized in monophasic acid phenol,e and then RNA was extracted. Real-time RT PCR assayk was performed. The PCR products were detected with a probe formatl on the basis of fluorescence resonance energy transfer by use of 2 sequence-specific probes labeled with different dyes. Primers and probes (Appendix) were designed by use of softwarem on the basis of equine ADAMTS4 and ADAMTS5 previously cloned by one of the authors (DWR). Primers and probes for the housekeeping gene equine EF1a were designed from a sequence obtained from the National Center for Biotechnology Information database (accession No. AY237113). Data were quantified by use of a calibrator-normalized, relative quantification methodn that resulted in a normalized ratio for expression of the target gene to the housekeeping gene for each sample.

Western blot analysis—The western blot analysis was conducted as described elsewhere.33 Briefly, spent media were stored at −20°C after addition of the protease inhibitor phenylmethylsulphonyl fluoride (100mM). Media from the cartilage explants were lyophilized, dissolved in 500 μL of 100mM Tris-acetate (pH, 6.5), and deglycosylated with chondroitinase ABCb (0.01 U/10 μg of GAG), keratanaseo (0.01 U/10 μg of GAG), and keratanase IIo (0.0001 U/10 μg of GAG) for 2 hours at 37°C. Samples were dialyzed exhaustively against water by use of 12,000 to 14,000 molecular weight dialysis tubing and lyophilized. After reconstitution in loading buffer with 10% β-mercaptoethanol, samples were heated at 100°C for 5 minutes, and gels were loaded on an equal GAG basis (4 μg of GAG/lane; determined by use of dimethylmethylene blue assays). Samples were separated in a 4% to 12% gradient polyacrylamide gel (assayed at 70 mA) and electroblotted overnight at 21 V to polyvinylidene difluoride membranes.p Membranes were washed in TBSTW and blocked by incubation in 0.1% TBSTW with 5% nonfat milk for 1 hour at 21°C. After 3 washes in TBSTW, the membranes were incubated with primary antibody (mouse monoclonal antibody BC-3q at a dilution of 1:100) for 2 hours at 21°C. The BC-3 antibody recognizes the new N-terminal sequence ARGSVIL, which is formed after cleavage of aggrecan within the IGD (Glu373-Ala374 site) by aggrecanase.31 After 3 washes with TBSTW, secondary antibody (horseradish peroxidase–conjugated goat anti-mouse IgGr at a dilution of 1:10,000) was added and membranes were incubated for 1 hour at 21°C. Development conjugate dilution buffer was added, and the chemiluminescent procedure as described for a commercially available systems was used. Chemifluorescent detection was performed thereafter with fluorescent scanning on an imager.h

ELISA for measurement of aggrecanase activity—Spent media were stored at −80°C after addition of the protease inhibitor leupeptin hemisulfate (10mM). A sensitive aggrecanase activity ELISAt was used in accordance with the manufacturer's instructions. Duplicate samples (5 μL) of spent media were incubated with a human recombinant aggrecan substrate for 15 minutes at 37°C in a 96-well plate containing a monoclonal antibody that recognized the new N-terminal sequence ARGSVIL; proteolytic reactions were stopped by the addition of 150 μL of EDTA dilution buffer, and samples then were incubated for 90 minutes at 25°C. Wells were emptied, washed 3 times with wash buffer, and incubated with a secondary antibody (antibody peroxidase conjugate) for an additional 90 minutes at 25°C. Wells were emptied and washed 5 times; 100 mL of detection solutionu was added, and wells were incubated in the dark at 21°C for 30 minutes. Peroxidase reactions were stopped by the addition of 100 μL of sulfuric acid. Absorbance measurements were determined in a microplate reader at a wavelength of 450 nm, and the amount of N-terminus peptide was calculated from a standard curve34 and compared with the amount for the control treatment.

Statistical analysis—Data were analyzed by use of a mixed-model ANOVA.v Cartilage type (articular or nasal), gene (MMP-3, MMP-13, ADAMTS4, ADAMTS5, or EF1), and treatment (IL-1β, IL-1β with 10−6 or 10−7M dexamethasone, IL-1β with 10−6 or 10−7M triamcinolone, 10−6 or 10−7M dexamethasone, or 10−6 or 10−7M triamcinolone) were the class variables. Dependent variables were micrograms of GAG in media per milligrams of ww cartilage; micrograms of GAG per milligrams of ww cartilage; ARGSVIL (ie, aggrecanasegenerated epitope) peptide per milligrams of ww cartilage (compared with results for the control treatment); and expression ratios of ADAMTS4 to EF1, ADAMTS5 to EF1, MMP-3 to EF1, and MMP-13 to EF1 (compared with results for the control treatment). A plot of the residual versus predicted values was used to test for equality of variance and normal distribution of the data. When there was an increase in variance with higher values, data were normalized via logarithmic transformation (natural logarithm [base e]) and reanalyzed. Back transformation of data was performed, and values were reported as mean ± SD. When the association between outcome and treatment was significant, individual treatments were compared by use of the F-protected least significance difference method. Significance was defined as values of P < 0.05.

Results

Cartilage specimens—Cartilage (nasal, articular, or both) was obtained from 24 equine cadavers. Mean ± SD weight of the nasal explants was 0.071 ± 0.022 g of ww cartilage, and mean weight of the articular explants was 0.068 ± 0.017 g of ww cartilage.

Quantitative analysis of GAG content in spent media and cartilage—The GAG content of spent media, nasal cartilage explants, and articular cartilage explants was measured in samples obtained from 24 (19 nasal and 8 articular), 18, and 6 equine cadavers, respectively (Figures 1 and 2). Treatment with IL-1β significantly increased the GAG content in the spent media for both cartilage types, compared with the GAG content for the control treatment; there was a concurrent decrease of GAG content in the cartilage explants. Addition of glucocorticoids to IL-1β–treated cartilage did not significantly change GAG content in media or cartilage. Glucocorticoids alone significantly increased GAG release in spent media from both cartilage types, but the release was still significantly (P < 0.001) less than the GAG release after IL-1β treatment. Glucocorticoids alone did not significantly alter the GAG content in cartilage. Articular and nasal cartilage responded similarly to treatment, but the loss of GAG content in articular cartilage was not as pronounced, probably because of uneven guanidinium HCl extraction, and no significant difference was detected. There was no significant association between type or dose of glucocorticoid with GAG content in spent media or cartilage.

Figure 1—
Figure 1—

Mean ± SD GAG content in spent media for articular (light gray bars) and nasal (dark gray bars) cartilage explants treated with IL-1β alone, IL-1β and glucocorticoids, or glucocorticoids alone for 72 hours. Data reported represent results for 27 experiments performed on samples obtained from 24 equine cadavers. Nasal cartilage explants had a more pronounced response to treatment with IL-1β, compared with the response for articular cartilage; therefore, results were analyzed for each cartilage type separately. Treatment with IL-1β resulted in a significant (P < 0.001) increase in GAG content in the media, compared with that for the control treatment, which was not significantly altered by addition of glucocorticoids. Treatment with glucocorticoids alone resulted in an increase in GAG content in the media, which was significantly (P < 0.001) more than the value for the control treatment but significantly (P < 0.001) less than the increase after treatment with IL-1β. Both nasal and articular cartilage explants responded similarly to treatment. a–cWithin nasal cartilage explants, values with different letters differed significantly (P < 0.001). A–CWithin articular cartilage explants, values with different letters differed significantly (P < 0.001). Dex = Dexamethasone. Tri = Triamcinolone.

Citation: American Journal of Veterinary Research 71, 2; 10.2460/ajvr.71.2.176

Figure 2—
Figure 2—

Mean ± SD GAG content in articular and nasal cartilage explants in response to treatment with IL-1β alone, IL-1β with glucocorticoids, and glucocorticoids alone for 72 hours. Data represent results of 18 nasal and 6 articular cartilage experiments performed on samples obtained from 24 equine cadavers. Nasal and articular cartilage explants were analyzed separately. Treatment with IL-1β resulted in a decrease in GAG content in nasal cartilage, compared with that for the control treatment, which was not significantly altered by addition of glucocorticoids. The GAG content in cartilage after treatment with glucocorticoids alone was not significantly altered, compared with GAG content for the control treatment. Articular and nasal cartilage had a similar response to treatment, but the response to treatment with IL-1β was significantly (P < 0.001) different only for nasal cartilage. See Figure 1 for remainder of key.

Citation: American Journal of Veterinary Research 71, 2; 10.2460/ajvr.71.2.176

Northern blot analysis—A total of 47 northern blots were performed with RNA obtained from 11 equine cadavers (Figure 3). There was a significant (all values, P < 0.01) association between treatment and expression of MMP-3, MMP-13, ADAMTS4, and ADAMTS5. Treatment with IL-1β for 24 hours resulted in significant upregulation of MMP-3, MMP-13, and ADAMTS4 mRNA (Figure 4). Treatment with IL-1β did not increase ADAMTS5 mRNA. Addition of glucocorticoids to IL-1β–treated chondrocytes decreased the expression of MMP-3 and MMP-13 mRNA, independent of type and concentration of glucocorticoid. Expression of ADAMTS4 was low in normal cartilage, which made it difficult to detect differences for the northern blots. Quantification and statistical analysis performed on control- and IL-1β–treated chondrocytes revealed that ADAMTS4 expression was significantly (P = 0.04) increased with IL-1β. Addition of glucocorticoids to IL-1β–treated chondrocytes resulted in a significant upregulation of ADAMTS5 mRNA, compared with upregulation for IL-1β treatment alone. Treatment with glucocorticoids alone resulted in a significant increase in ADAMTS5 mRNA and downregulation of MMP-3 and MMP-13 mRNA. We did not detect a significant difference between type or dose of glucocorticoid and gene expression.

Figure 3—
Figure 3—

Gene expression of MMP-13, MMP-3, ADAMTS4, and ADAMTS5 detected by use of northern blot analysis of chondrocytes in cell cultures treated with IL-1β alone, IL-1β with glucocorticoids, or glucocorticoids alone for 24 hours. Northern blot analysis of MMP-3 was performed in 15 experiments (n = 8 equine cadavers), MMP-13 analysis was performed in 10 experiments (8), ADAMTS4 analysis was performed in 9 experiments (7), and ADAMTS5 analysis was performed in 15 experiments (9). Retinoic acid was used as a positive control sample, but data were not included in the final analysis. Expression of MMP-13, MMP-3, and ADAMTS4 was increased significantly (P < 0.044) after treatment with IL-1β, whereas ADAMTS5 expression was unchanged. Addition of glucocorticoids significantly (P < 0.003) downregulated MMP-13 and MMP-3 expression, whereas ADAMTS5 expression was significantly (P = 0.004) upregulated. Treatment with glucocorticoids alone significantly (P < 0.001) decreased expression of MMP-13 and MMP-3 and caused significant (P < 0.02) upregulation of ADAMTS5 expression. Baseline gene expression of ADAMTS4 was low, which made it more difficult to interpret the northern blots. kb = Kilobase.

Citation: American Journal of Veterinary Research 71, 2; 10.2460/ajvr.71.2.176

Figure 4—
Figure 4—

Mean ± SD expression of MMP-3 (15 experiments [n = 8 equine cadavers]; A), MMP-13 (10 experiments [8]; B), and ADAMTS5 (15 experiments [9]; C) determined by use of northern blot analysis performed on chondrocytes in cell culture after treatment with IL-1β alone, IL-1β with glucocorticoids, or glucocorticoids alone for 24 hours. Values reported represent the fold increase, compared with expression for the control treatment. Treatment with IL-1β resulted in a significant (P < 0.044) upregulation of MMP-3 (A) and MMP-13 (B) expression, compared with results for the control treatment, whereas ADAMTS5 expression was unchanged (C). Addition of glucocorticoids significantly (P < 0.003) decreased the expression of MMP-3 (A) and MMP-13 (B) and resulted in significant (P = 0.004) upregulation of ADAMTS5 expression (C), compared with results for IL-1β alone. Treatment with glucocorticoids alone resulted in significant (P < 0.001) downregulation of MMP-3 (A) and MMP13 (B) expression, whereas ADAMTS5 expression was significantly (P < 0.02) upregulated (C). There was no significant association between gene expression and type or dose of glucocorticoid. a–eWithin a gene, values with different superscript letters differ significantly (P < 0.02). See Figure 1 for remainder of key.

Citation: American Journal of Veterinary Research 71, 2; 10.2460/ajvr.71.2.176

Real-time RT PCR assay—Real-time RT PCR assay of ADAMTS4 (Figure 5) and ADAMTS5 (Figure 6) was performed on 8 nasal and 7 articular cartilage explants; all explants had a similar response to treatment. Expression of ADAMTS4 was low, whereas ADAMTS5 was constitutively expressed. Treatment with IL-1β resulted in significant (P < 0.001) upregulation of ADAMTS4 and ADAMTS5 mRNA. The increase of ADAMTS4 mRNA was significantly (P = 0.008) higher than the increase of ADAMTS5 mRNA. Addition of glucocorticoids to IL1β–treated explants resulted in significant (P = 0.002) downregulation of ADAMTS4 mRNA, but gene expression remained significantly (P < 0.001) higher than values for the control treatment. In contrast to ADAMTS4 expression, ADAMTS5 expression was not diminished by the addition of glucocorticoids to IL-1β–treated cartilage. Treatment with glucocorticoids alone did not significantly alter gene expression of ADAMTS4, whereas ADAMTS5 mRNA was significantly increased. Although ADAMTS5 mRNA concentrations were increased by glucocorticoids alone, the values remained significantly lower than those for cartilage treated with IL-1β. There was no significant association between expression of ADAMTS4 or ADAMTS5 and type or dose of glucocorticoid.

Figure 5—
Figure 5—

Mean ± SD expression of ADAMTS4, determined by use of a real-time RT PCR assay, in articular and nasal cartilage explants following treatment with IL-1β alone, IL-1β with glucocorticoids, or glucocorticoids alone for 72 hours. Data represent results of 7 articular cartilage experiments (n = 7 equine cadavers) and 8 nasal cartilage experiments (8). Treatment with IL-1β resulted in a significant (P < 0.001) increase in expression of ADAMTS4, compared with the response for the control treatment. Addition of glucocorticoids resulted in a significant (P < 0.001) downregulation, but expression was still significantly (P < 0.001) higher than values for the control treatment. Treatment with glucocorticoids alone did not significantly alter ADAMTS4 gene expression. †Nasal and articular cartilage had a similar response to treatment; therefore, a single letter represents significant differences for both cartilage types for a specific treatment. a–cValues with different superscript letters differ significantly (P < 0.001). See Figure 1 for remainder of key.

Citation: American Journal of Veterinary Research 71, 2; 10.2460/ajvr.71.2.176

Figure 6—
Figure 6—

Mean ± SD expression of ADAMTS5, determined by use of a real-time RT PCR assay, in articular and nasal cartilage explants following treatment with IL-1β alone, IL-1β with glucocorticoids, or glucocorticoids alone for 72 hours. Data represent results of 7 articular cartilage experiments (n = 7 equine cadavers) and 8 nasal cartilage experiments (8). Treatment with IL-1β significantly (P < 0.001) increased expression of ADAMTS5, compared with values for the control treatment. Addition of glucocorticoids did not significantly alter the expression of ADAMTS5, but treatment with glucocorticoids alone significantly (P < 0.001) increased the expression of ADAMTS5, compared with values for the control treatment. Expression of ADAMTS5 after treatment with glucocorticoids alone was still significantly (P < 0.001) less than the expression after IL-1β treatment. See Figures 1 and 5 for remainder of key.

Citation: American Journal of Veterinary Research 71, 2; 10.2460/ajvr.71.2.176

Western blot analysis—Western blot analysis with monoclonal antibody BC-3 was performed on spent media of nasal and articular cartilage (Figure 7). Gels were loaded on an equal GAG basis to identify changes in cleavage patterns of the fragments released. The band at 62 to 70 kDa is C-terminally truncated, ADAMTS-cleaved aggrecan released in both control and treated cultures. Treatment with IL-1β increased the fragments with larger molecular weight (less C-terminally truncated and therefore more important in cartilage degradation). Combined with an increase in GAG release in the media caused by IL-1β, these results were indicative of an increase in aggrecanase-mediated cleavage within the IGD. Addition of glucocorticoids in IL-1β–treated cartilage caused no change (articular) or a small increase (nasal) in density of bands, which indicated no change (articular) or an increase (nasal) in aggrecanase activity. However, the high density of bands evident after IL-1β treatment may have prevented detection of a further increase in articular cartilage. With glucocorticoids alone, the density of mainly large molecular size bands increased in both cartilage types, which indicated an increase in aggrecanase activity, compared with results for the control treatment.

Figure 7—
Figure 7—

Aggrecanase-generated IGD metabolites detected by use of western blot analysis in nasal (A) and articular (B) cartilage explants after treatment with IL-1β alone, IL-1β with glucocorticoids, or glucocorticoids alone for 72 hours. Western blot analysis was performed in 7 nasal cartilage experiments (n = 7 equine cadavers) and 2 articular cartilage experiments (2). Retinoic acid was used as a positive control sample, but this treatment was not performed in all experiments; therefore, data were not included in the final analysis. Gels were loaded on an equal GAG basis to identify a change in the cleavage pattern of the fragments released; results were interpreted in combination with GAG data. The pronounced band at 62 to 70 kDa is C-terminally truncated, ADAMTS-cleaved aggrecan released in both control and treated cultures. A heterogeneous population of aggrecan exists in cartilage because of C-terminal truncation, which after cleavage of aggrecan, results in catabolites of different molecular sizes (45 to 250 kDa). Treatment with IL-1β increased the fragments with larger molecular weight (less C-terminally truncated and therefore more important in cartilage degradation). In combination with an increase in GAG release in the media caused by IL-1β, these results were indicative of an increase in aggrecanase-mediated cleavage within the IGD to cause the GAG release. Addition of glucocorticoids revealed that BC-3 catabolites were mildly increased (A) or not diminished (B). Glucocorticoids alone resulted in a distinct increase of BC-3–positive fragments, which indicated an increase in aggrecanase activity. Articular and nasal cartilage had a similar response to treatment. Values reported represent the number of kilodaltons. MWM = Molecular weight marker. See Figure 1 for remainder of key.

Citation: American Journal of Veterinary Research 71, 2; 10.2460/ajvr.71.2.176

ELISA—For further quantification of total production of aggrecanase-generated neoepitope unrelated to size, an ELISA was performed on 4 nasal and 5 articular cartilages. The amount of ARGSVIL-detected peptide was the combined product of residual aggrecanase activity in spent media and aggrecan neoepitopes generated by treatments, which represented overall aggrecanase activity. Both cartilage types responded similarly to treatments. Treatment with IL-1β significantly (P < 0.001) increased aggrecanase activity in both cartilage types, compared with results for the control treatment (Figure 8). Addition of triamcinolone to IL-1β–treated cartilage significantly (P = 0.03) increased aggrecanase activity, compared with results for IL-1β alone. Addition of dexamethasone to IL-1β–treated cartilage resulted in a mild (but not significant) increase in aggrecanase activity. Glucocorticoids alone did not result in a significant change in aggrecanase activity, nor was there any significant effect of type of cartilage, type of glucocorticoid, or dose.

Figure 8—
Figure 8—

Mean ± SD aggrecanase-generated ARGSVIL peptide production detected with an ELISA in spent media of articular and nasal cartilage explants after treatment with IL-1β alone, IL-1β with glucocorticoids, or glucocorticoids alone for 72 hours. Data represent results of 5 articular cartilage experiments (n = 5 equine cadavers) and 4 nasal cartilage experiments (4). Values reported represent the fold increase, compared with production for the control treatment. Response to treatment did not differ significantly between nasal and articular cartilage; therefore, results were analyzed for both cartilage types combined. Treatment with IL-1β significantly (P < 0.001) increased aggrecanase-generated peptide, compared with values for the control treatment. Treatment with IL-1β and glucocorticoids caused an increase in aggrecanase activity, compared with results for IL-1β treatment alone, but this was a significant (P < 0.03) difference for only triamcinolone. Treatment with glucocorticoids alone caused a mild increase in generated ARGSVIL peptide, but this was not significantly different from the value for the control treatment. a–dValues with different superscript letters differ significantly (P < 0.03) between treatments for both cartilage types combined. See Figure 1 for remainder of key.

Citation: American Journal of Veterinary Research 71, 2; 10.2460/ajvr.71.2.176

Discussion

Treatment with IL-1β resulted in an increase in GAG release in the media with a concurrent increase in aggrecanase activity determined by use of results of ELISA and western blot analysis, which is consistent with results in other reports.3,4,20 Even though aggrecanase activity has been reported to be a major contributor to GAG degradation,3,4,6,7 the exact contribution of MMPs and aggrecanases to GAG degradation is unknown. In the study reported here, transcription of both MMPs and aggrecanases was significantly upregulated by IL-1β. However, IL-1β treatment resulted in a greater increase in ADAMTS4 expression (mean, 27-fold increase) than in ADAMTS5 expression (mean, 13-fold increase), which indicated differences in transcriptional regulation. Results of studies20–25,35,36 in which investigators have reported the influence of IL-1 on gene expression of aggrecanases are inconsistent. Our results suggested that both ADAMTS4 and ADAMTS5 contribute to GAG degradation in IL-1β–treated cartilage. It has been proposed27–29 that ADAMTS5 is the major aggrecanase in osteoarthritis in vivo, but other studies have revealed that there can be aggrecanolysis in ADAMTS5-knockout mice25 and that ADAMTS4 contributes to aggrecan degradation.30–37 These results indicate that the exact role of each aggrecanase in cartilage degradation remains to be determined.

Glucocorticoids have the potential to alter the rate of proteoglycan synthesis and degradation.38–47 Content of GAGs increases in synovial fluid of normal joints after administration of glucocorticoids, which indicates an increase in aggrecan turnover,38,39 but the effects in normal and abnormal joints differ.41,42 Aggrecan turnover may be influenced by proteoglycan degradation and proteoglycan synthesis. Several studies40,42–44 have revealed a decrease in proteoglycan synthesis after glucocorticoid treatment, but no change or an increase in synthesis has also been reported.39,45,46 The effects of glucocorticoids on proteoglycan degradation are also inconsistent.44,47 Minimal differences between types of glucocorticoids have been reported,47 but results are not consistent48 and comparative studies are lacking.

Analysis of our results revealed that addition of glucocorticoids to cytokine-stimulated cartilage did not counteract the negative effects of IL-1β on GAG degradation, and treatment with glucocorticoids alone increased GAG release in the media. There was no significant difference on the basis of type of glucocorticoid (dexamethasone vs triamcinolone). Treatments with glucocorticoids resulted in a decrease in MMP expression similar to that described in another report,48 whereas aggrecanase activity determined by use of an ELISA and western blot analysis was increased. Degradation of GAG was unchanged (with IL-1β) or increased (without IL-1β), which indicated a change in relative contribution of MMPs and aggrecanases. Although changes at a transcriptional level do not necessarily reflect similar changes at the protein level, the increase in aggrecanase activity combined with a decrease in transcription of ADAMTS4 are suggestive of a major role of ADAMTS5. Treatment with glucocorticoids alone resulted in an increase in aggrecanase activity (determined by use of western blot analysis), whereas ADAMTS4 mRNA was unchanged and ADAMTS5 mRNA was upregulated, which further substantiated a major role of ADAMTS5.

Potential mechanisms of action of glucocorticoids on aggrecanases include a difference in regulation through transcription factor NF-κB. Regulation of transcription of several MMPs is dependent on NF-κB,49,50 but information about involvement of NF-κB on transcription of ADAMTS4 and ADAMTS5 is limited. A report19 for human synovial fibroblasts indicates that ADAMTS4 expression is dependent on NF-κB, whereas ADAMTS5 expression is not. Glucocorticoids can inhibit NF-κB activity by direct and indirect mechanisms.51–54 This could cause inhibition of gene expression of MMPs and ADAMTS4, whereas ADAMTS5 expression is unaffected. In contrast, inhibition of NF-κB in bovine cartilage explants did not alter expression of either ADAMTS4 or ADAMTS5,24 and the authors of that study proposed a potential role of NF-κB in ADAMTS5 activity. It is evident that further investigation of the role of NF-κB is necessary to determine its influence on expression and activity of ADAMTS4 and ADAMTS5.

Another possible mechanism of influence of glucocorticoids on aggrecanase activity is the influence of Mt4-MMP (a glycosylphosphatidylinositol-anchored MMP) and possibly other MMPs on activation of ADAMTS4. Aggrecanases contain a zinc catalytic domain followed by a disintegrin domain, a thrombospondin domain, a cysteine-rich domain, and a spacer domain (in ADAMTS5, a second thrombospondin domain follows the spacer domain). Noncatalytic ancillary domains play a role in regulating enzyme activity, and deletion of the spacer domain results in an increase in activity of ADAMTS4.15 Increased activity of ADAMTS4 has been reported17,55 after Mt4-MMP–mediated processing, which results in an ADAMTS4 protein of similar molecular size as that for a C-terminal spacer domain deletion mutant. The spacer domain does play a role in ADAMTS5 activity, but deletion of the cysteine-rich domain causes the main change in activity.16 In addition, a study26 in transgenic mice revealed that ADAMTS5 activity is not controlled by Mt4-MMP. The effect of glucocorticoids on Mt4-MMP is unknown, but our results and the results from other studies48,56 indicate that most MMPs are downregulated with glucocorticoids. A possible decrease in Mt4-MMP with glucocorticoids can result in a decrease in ADAMTS4 activity, whereas ADAMTS5 activity is not affected.

A third possibly relevant mechanism involves the interaction between fibronectin and ADAMTS4. Glucocorticoids can alter the expression of fibronectin,48,57 and binding of fibronectin to the spacer domain of ADAMTS4 results in inhibition of ADAMTS4 activity.14

Assays for aggrecanase activity used in the study reported here were based on detection of aggrecanase-generated epitopes within the IGD. The major aggrecanase in cleavage within the IGD is ADAMTS5,25 and the overall activity of ADAMTS5 has been reported to be 1,000-fold as high as that for ADAMTS416; therefore, results of our assays may be more representative for ADAMTS5 activity than for ADAMTS4 activity. This would illustrate the potential of glucocorticoids to increase ADAMTS5 activity. Results of the BC-3 western blot analysis and ELISA varied, but they were generally consistent. Western blot analysis revealed an increase primarily in the larger fragments after treatments, whereas the ELISA detected the total amount of generated fragments unrelated to size. The ELISA samples were not deglycosylated; therefore, it is possible that larger fragments (chondroitin-sulfate and keratan-sulfate rich) were not captured and that the results were more representative for an increase in smaller ARGSVIL aggrecan fragments. This could explain minor variations between results for the western blot analysis and ELISA, but further investigation and identification of detected fragments are required. Other explanations could include the difference in aggrecan substrate (equine native vs human recombinant), but results of another study58 indicate that subtle changes in aggrecan sequences between human and equine aggrecan do not result in loss of immunoreactivity. A third explanation could be differences in aggrecanase activity in situ versus in solution.

Differences were detected between results for northern blot analysis of cell cultures and real-time RT PCR assays of cartilage explants. The reason for these differences is unclear, but they were most likely attributable to a difference in culture and technique. Transcriptional changes in cartilage explants may be more representative of changes in vivo than are changes for isolated cell cultures, but the overall results clearly indicated that both IL-1β and glucocorticoids affected ADAMTS4 and ADAMTS5 differently.

One limitation of this study was the use of aggrecanase assays that only detected aggrecanase activity at the classic site within the IGD. Both aggrecanases have aggrecanolytic activities at sites within the chondroitinsulfate–rich domain of aggrecan,59,60 and additional assays with antibodies specific for these sites would have provided additional information. A second limitation was that the relative contribution of ADAMTS4 and ADAMTS5 in aggrecanase activity was suggested on the basis of changes at the transcriptional level; additional assays to determine protein concentrations would provide further information. Our attempts to use western blot analyses for the ADAMTS proteins were unsuccessful. A third potential limitation was the variation in age of horses used for the study. Glycosylation of aggrecan plays a role in aggrecanase activity,15,16,59 and glycosylation changes with age,61 which indicates that age may be a factor in aggrecanase-mediated cartilage degradation.10 Furthermore, the dose range of glucocorticoids used was too limited to detect a potential dose-dependent effect, which has been reported for other studies.40,44,48,56 These doses were selected because they are within the therapeutic range and preliminary experiments revealed effects on MMP and ADAMTS5 transcription.

Matrix metalloproteinase-3, MMP-13, and ADAMTS4 are regulated differently than ADAMTS5. Content of ADAMTS5 mRNA was increased by IL-1β, but significantly less than the increase for ADAMTS4 mRNA, which suggested a role for both ADAMTS4 and ADAMTS5 in degradation of cytokine-stimulated cartilage. Despite downregulation of MMP-3 and MMP-13 mRNA, glucocorticoids did not alter GAG degradation. Aggrecanase activity was increased with glucocorticoids, whereas ADAMTS4 mRNA was downregulated and ADAMTS5 gene expression was maintained or increased, which suggested a major role of ADAMTS5 in aggrecanase activity. The effect of glucocorticoids on aggrecanase activity has major implications in terms of treatment and helps to explain why degradation of matrix takes place despite inhibition of MMPs and ADAMTS4.

ABBREVIATIONS

ADAMTS

A disintegrin and metalloproteinase with thrombospondin motifs

BC-3

Aggrecan arginine antibody

EF1

Elongation factor 1

GAG

Glycosaminoglycan

IGD

Interglobular domain

IL

Interleukin

MMP

Matrix metalloproteinase

Mt4-MMP

Membrane type 4-matrix metalloproteinase

NF-κB

Nuclear factor-κB

RT

Reverse transcriptase

TBSTW

Tris-buffered saline–Tween 20

ww

Wet weight

a.

Sigma-Aldrich, St Louis, Mo.

b.

Roche Applied Science, Indianapolis, Ind.

c.

eBioscience, San Diego, Calif.

d.

Molecular probes, Eugene, Ore.

e.

TRIzol, Invitrogen, Carlsbad, Calif.

f.

Hybond-N+, Amersham Biosciences, Piscataway, NJ.

g.

Rapid-hyb Buffer, Amersham Biosciences, Piscataway, NJ.

h.

Storm Phosphor imager, Amersham Biosciences, Piscataway, NJ.

i.

Gel-Pro 4.5, Media Cybernetics, Silver Spring, Md.

j.

Spex CertiPrep P, Metuchen, NJ.

k.

LightCycler real-time PCR system, Sigma-Aldrich, St Louis, Mo.

l.

LightCycler HybProbe, Sigma-Aldrich, St Louis, Mo.

m.

LightCycler probe design software, version 2.0, Sigma-Aldrich, St Louis, Mo.

n.

LightCycler relative quantification software, Roche, Basal, Switzerland.

o.

Seikagaku, Chiyoda-ku, Tokyo, Japan.

p.

Hybond-P, Amersham Biosciences, Piscataway, NJ.

q.

Abcam, Cambridge, Mass.

r.

The Jackson Laboratory, Bar Harbor, Me.

s.

ECL-Plus system, Amersham Biosciences, Piscataway, NJ.

t.

MD Biosciences Inc, Saint Paul, Minn.

u.

Detection solution TMB, Amersham Biosciences, Piscataway, NJ.

v.

PROC MIXED, SAS, version 9.1, SAS Institute Inc, Cary, NC.

References

  • 1.

    Lark MW, Gordy JT, Weidner JR, et al. Cell-mediated catabolism of aggrecan. Evidence that cleavage at the “aggrecanase” site (Glu373-Ala374) is a primary event in proteolysis of the interglobular domain. J Biol Chem 1995;270:25502556.

    • Search Google Scholar
    • Export Citation
  • 2.

    Fosang AJ, Last K, Maciewicz RA. Aggrecan is degraded by matrix metalloproteinases in human arthritis. Evidence that matrix metalloproteinase and aggrecanase activities can be independent. J Clin Invest 1996;98:22922299.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 3.

    Arner EC, Hughes CE, Decicco CP, et al. Cytokine-induced cartilage proteoglycan degradation is mediated by aggrecanase. Osteoarthritis Cartilage 1998;6:214228.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 4.

    Little CB, Flannery CR, Hughes CE, et al. Aggrecanase versus matrix metalloproteinases in the catabolism of the interglobular domain of aggrecan in vitro. Biochem J 1999;344:6168.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 5.

    Struglics A, Larsson S, Pratta MA, et al. Human osteoarthritis synovial fluid and joint cartilage contain both aggrecanase- and matrix metalloproteinase-generated aggrecan fragments. Osteoarthritis Cartilage 2006;14:101113.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 6.

    Malfait AM, Liu RQ, Ijiri K, et al. Inhibition of ADAM-TS4 and ADAM-TS5 prevents aggrecan degradation in osteoarthritic cartilage. J Biol Chem 2002;277:2220122208.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 7.

    Sandy JD, Verscharen C. Analysis of aggrecan in human knee cartilage and synovial fluid indicates that aggrecanase (ADAMTS) activity is responsible for the catabolic turnover and loss of whole aggrecan whereas other protease activity is required for C-terminal processing in vivo. Biochem J 2001;358:615626.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 8.

    Tortorella MD, Burn TC, Pratta MA, et al. Purification and cloning of aggrecanase-1: a member of the ADAMTS family of proteins. Science 1999;284:16641666.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 9.

    Abbaszade I, Liu RQ, Yang F, et al. Cloning and characterization of ADAMTS11, an aggrecanase from the ADAMTS family. J Biol Chem 1999;274:2344323450.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 10.

    Pratta MA, Tortorella MD, Arner EC. Age-related changes in aggrecan glycosylation affect cleavage by aggrecanase. J Biol Chem 2000;275:3909639102.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 11.

    Roughley PJ, Barnett J, Zuo F, et al. Variations in aggrecan structure modulate its susceptibility to aggrecanases. Biochem J 2003;375:183189.

  • 12.

    Tortorella MD, Arner EC, Hills R, et al. Alpha2-macroglobulin is a novel substrate for ADAMTS-4 and ADAMTS-5 and represents an endogenous inhibitor of these enzymes. J Biol Chem 2004;279:1755417561.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 13.

    Kashiwagi M, Tortorella M, Nagase H, et al. TIMP-3 is a potent inhibitor of aggrecanase 1 (ADAM-TS4) and aggrecanase 2 (ADAM-TS5). J Biol Chem 2001;276:1250112504.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 14.

    Hashimoto G, Shimoda M, Okada Y. ADAMTS4 (aggrecanase-1) interaction with the C-terminal domain of fibronectin inhibits proteolysis of aggrecan. J Biol Chem 2004;279:3248332491.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 15.

    Kashiwagi M, Enghild JJ, Gendron C, et al. Altered proteolytic activities of ADAMTS-4 expressed by C-terminal processing (Erratum published in J Biol Chem 2004;279:22786). J Biol Chem 2004;279:1010910119.

    • Search Google Scholar
    • Export Citation
  • 16.

    Gendron C, Kashiwagi M, Lim NH, et al. Proteolytic activities of human ADAMTS-5: comparative studies with ADAMTS-4. J Biol Chem 2007;282:1829418306.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 17.

    Gao G, Plaas A, Thompson VP, et al. ADAMTS4 (aggrecanase-1) activation on the cell surface involves C-terminal cleavage by glycosylphosphatidyl inositol-anchored membrane type 4-matrix metalloproteinase and binding of the activated proteinase to chondroitin sulfate and heparan sulfate on syndecan-1. J Biol Chem 2004;279:1004210051.

    • Search Google Scholar
    • Export Citation
  • 18.

    Gao G, Westling J, Thompson VP, et al. Activation of the proteolytic activity of ADAMTS4 (aggrecanase-1) by C-terminal truncation. J Biol Chem 2002;277:1103411041.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 19.

    Bondeson J, Lauder S, Wainwright S, et al. Adenoviral gene transfer of the endogenous inhibitor IkappaBalpha into human osteoarthritis synovial fibroblasts demonstrates that several matrix metalloproteinases and aggrecanases are nuclear factor-kappaB-dependent. J Rheumatol 2007;34:523533.

    • Search Google Scholar
    • Export Citation
  • 20.

    Tortorella MD, Malfait AM, Deccico C, et al. The role of ADAMTS4 (aggrecanase-1) and ADAM-TS5 (aggrecanase-2) in a model of cartilage degradation (Erratum published in Osteoarthritis Cartilage 2002;10:82). Osteoarthritis Cartilage 2001;9:539552.

    • Search Google Scholar
    • Export Citation
  • 21.

    Bau B, Gebhard PM, Haag J, et al. Relative messenger RNA expression profiling of collagenases and aggrecanases in human articular chondrocytes in vivo and in vitro. Arthritis Rheum 2002;46:26482657.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 22.

    Flannery CR, Little CB, Hughes CE, et al. Expression of ADAMTS homologues in articular cartilage. Biochem Biophys Res Commun 1999;260:318322.

  • 23.

    Koshy PJ, Lundy CJ, Rowan AD, et al. The modulation of matrix metalloproteinase and ADAM gene expression in human chondrocytes by interleukin-1 and oncostatin M: a time-course study using real-time quantitative reverse transcription-polymerase chain reaction. Arthritis Rheum 2002;46:961967.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 24.

    Pattoli MA, MacMaster JF, Gregor KR, et al. Collagen and aggrecan degradation is blocked in interleukin-1-treated cartilage explants by an inhibitor of IkappaB kinase through suppression of metalloproteinase expression. J Pharmacol Exp Ther 2005;315:382388.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 25.

    East CJ, Stanton H, Golub SB, et al. ADAMTS-5 deficiency does not block aggrecanolysis at preferred cleavage sites in the chondroitin sulfate-rich region of aggrecan. J Biol Chem 2007;282:86328640.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 26.

    Stewart MC, Fosang AJ, Bai Y, et al. ADAMTS5-mediated aggrecanolysis in murine epiphyseal chondrocyte cultures. Osteoarthritis Cartilage 2006;14:392402.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 27.

    Stanton H, Rogerson FM, East CJ, et al. ADAMTS5 is the major aggrecanase in mouse cartilage in vivo and in vitro. Nature 2005;434:648652.

  • 28.

    Glasson SS, Askew R, Sheppard B, et al. Deletion of active ADAMTS5 prevents cartilage degradation in a murine model of osteoarthritis (Erratum published in Nature 2007;446:102). Nature 2005;434:644648.

    • Search Google Scholar
    • Export Citation
  • 29.

    Glasson SS, Askew R, Sheppard B, et al. Characterization of and osteoarthritis susceptibility in ADAMTS-4-knockout mice. Arthritis Rheum 2004;50:25472558.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 30.

    Song RH, Tortorella MD, Malfait AM, et al. Aggrecan degradation in human articular cartilage explants is mediated by both ADAMTS-4 and ADAMTS-5. Arthritis Rheum 2007;56:575585.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 31.

    Reginato AM, Iozzo RV, Jimenez SA. Formation of nodular structures resembling mature articular cartilage in long-term primary cultures of human fetal epiphyseal chondrocytes on a hydrogel substrate. Arthritis Rheum 1994;37:13381349.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 32.

    Farndale RW, Sayers CA, Barrett AJ. A direct spectrophotometric microassay for sulfated glycosaminoglycans in cartilage cultures. Connect Tissue Res 1982;9:247248.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 33.

    Hughes CE, Little CB, Caterson B. Measurement of aggrecanase-generated interglobular domain catabolites in the medium and extracts of cartilage explants using Western blot analysis. Methods Mol Biol 2003;225:8998.

    • Search Google Scholar
    • Export Citation
  • 34.

    Will H, Dettloff M, Bendzko P, et al. A quantitative assay for aggrecanase activity. J Biomol Tech 2005;16:459472.

  • 35.

    Little CB, Hughes CE, Curtis CL, et al. Matrix metalloproteinases are involved in C-terminal and interglobular domain processing of cartilage aggrecan in late stage cartilage degradation. Matrix Biol 2002;21:271288.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 36.

    Pratta MA, Scherle PA, Yang G, et al. Induction of aggrecanase 1 (ADAM-TS4) by interleukin-1 occurs through activation of constitutively produced protein. Arthritis Rheum 2003;48:119133.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 37.

    Naito S, Shiomi T, Okada A, et al. Expression of ADAMTS4 (aggrecanase-1) in human osteoarthritic cartilage. Pathol Int 2007;57:703711.

  • 38.

    Celeste C, Ionescu M, Robin Poole A, et al. Repeated intraarticular injections of triamcinolone acetonide alter cartilage matrix metabolism measured by biomarkers in synovial fluid. J Orthop Res 2005;23:602610.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 39.

    Frisbie DD, Kawcak CE, Trotter GW, et al. Effects of triamcinolone acetonide on an in vivo equine osteochondral fragment exercise model. Equine Vet J 1997;29:349359.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 40.

    Todhunter RJ, Fubini SL, Wootton JA, et al. Effect of methylprednisolone acetate on proteoglycan and collagen metabolism of articular cartilage explants. J Rheumatol 1996;23:12071213.

    • Search Google Scholar
    • Export Citation
  • 41.

    MacLeod JN, Fubini SL, Gu DN, et al. Effect of synovitis and corticosteroids on transcription of cartilage matrix proteins. Am J Vet Res 1998;59:10211026.

    • Search Google Scholar
    • Export Citation
  • 42.

    Todhunter RJ, Fubini SL, Vernier-Singer M, et al. Acute synovitis and intra-articular methylprednisolone acetate in ponies. Osteoarthritis Cartilage 1998;6:94105.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 43.

    Frisbie DD, Nixon AJ. Insulin-like growth factor 1 and corticosteroid modulation of chondrocyte metabolic and mitogenic activities in interleukin 1-conditioned equine cartilage (Erratum published in Am J Vet Res 1997;58:701). Am J Vet Res 1997;58:524530.

    • Search Google Scholar
    • Export Citation
  • 44.

    Murphy DJ, Todhunter RJ, Fubini SL, et al. The effects of methylprednisolone on normal and monocyte-conditioned medium-treated articular cartilage from dogs and horses. Vet Surg 2000;29:546557.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 45.

    Verschure PJ, van der Kraan PM, Vitters EL, et al. Stimulation of proteoglycan synthesis by triamcinolone acetonide and insulin-like growth factor 1 in normal and arthritic murine articular cartilage. J Rheumatol 1994;21:920926.

    • Search Google Scholar
    • Export Citation
  • 46.

    van der Kraan PM, Vitters EL, Postma NS, et al. Maintenance of the synthesis of large proteoglycans in anatomically intact murine articular cartilage by steroids and insulin-like growth factor I. Ann Rheum Dis 1993;52:734741.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 47.

    Dechant JE, Baxter GM, Frisbie DD, et al. Effects of dosage titration of methylprednisolone acetate and triamcinolone acetonide on interleukin-1-conditioned equine articular cartilage explants in vitro. Equine Vet J 2003;35:444450.

    • Search Google Scholar
    • Export Citation
  • 48.

    Richardson DW, Dodge GR. Dose-dependent effects of corticosteroids on the expression of matrix-related genes in normal and cytokine-treated articular chondrocytes. Inflamm Res 2003;52:3949.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 49.

    Mengshol JA, Vincenti MP, Coon CI, et al. Interleukin-1 induction of collagenase 3 (matrix metalloproteinase 13) gene expression in chondrocytes requires p38, c-Jun N-terminal kinase, and nuclear factor kappaB: differential regulation of collagenase 1 and collagenase 3. Arthritis Rheum 2000;43:801811.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 50.

    Liacini A, Sylvester J, Li WQ, et al. Inhibition of interleukin-1-stimulated MAP kinases, activating protein-1 (AP-1) and nuclear factor kappa B (NF-kappa B) transcription factors downregulates matrix metalloproteinase gene expression in articular chondrocytes. Matrix Biol 2002;21:251262.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 51.

    Caldenhoven E, Liden J, Wissink S, et al. Negative cross-talk between RelA and the glucocorticoid receptor: a possible mechanism for the antiinflammatory action of glucocorticoids. Mol Endocrinol 1995;9:401412.

    • Search Google Scholar
    • Export Citation
  • 52.

    Scheinman RI, Gualberto A, Jewell CM, et al. Characterization of mechanisms involved in transrepression of NF-kappa B by activated glucocorticoid receptors. Mol Cell Biol 1995;15:943953.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 53.

    Auphan N, DiDonato JA, Rosette C, et al. Immunosuppression by glucocorticoids: inhibition of NF-kappa B activity through induction of I kappa B synthesis. Science 1995;270:286290.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 54.

    Scheinman RI, Cogswell PC, Lofquist AK, et al. Role of transcriptional activation of I kappa B alpha in mediation of immunosuppression by glucocorticoids. Science 1995;270:283286.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 55.

    Patwari P, Gao G, Lee JH, et al. Analysis of ADAMTS4 and MT4-MMP indicates that both are involved in aggrecanolysis in interleukin-1-treated bovine cartilage. Osteoarthritis Cartilage 2005;13:269277.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 56.

    Caron JP, Tardif G, Martel-Pelletier J, et al. Modulation of matrix metalloprotease 13 (collagenase 3) gene expression in equine chondrocytes by interleukin 1 and corticosteroids. Am J Vet Res 1996;57:16311634.

    • Search Google Scholar
    • Export Citation
  • 57.

    Fubini SL, Todhunter RJ, Burton-Wurster N, et al. Corticosteroids alter the differentiated phenotype of articular chondrocytes. J Orthop Res 2001;19:688695.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 58.

    Pratta MA, Su JL, Leesnitzer MA, et al. Development and characterization of a highly specific and sensitive sandwich ELISA for detection of aggrecanase-generated aggrecan fragments. Osteoarthritis Cartilage 2006;14:702713.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 59.

    Tortorella MD, Pratta M, Liu RQ, et al. Sites of aggrecan cleavage by recombinant human aggrecanase-1 (ADAMTS-4). J Biol Chem 2000;275:1856618573.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 60.

    Tortorella MD, Liu RQ, Burn T, et al. Characterization of human aggrecanase 2 (ADAM-TS5): substrate specificity studies and comparison with aggrecanase 1 (ADAM-TS4). Matrix Biol 2002;21:499511.

    • Crossref
    • Search Google Scholar
    • Export Citation
  • 61.

    Barry FP, Rosenberg LC, Gaw JU, et al. N- and O-linked keratan sulfate on the hyaluronan binding region of aggrecan from mature and immature bovine cartilage. J Biol Chem 1995;270:2051620524.

    • Crossref
    • Search Google Scholar
    • Export Citation

Appendix

Specific primers and probes used for real-time RT PCR assays to determine the effects of IL-1β and glucocorticoids on cartilage explants obtained from equine cadavers.

GenePrimer (5′-3′)Probe
ADAMTS-4Forward: CCATTCTGTTTACCCGTCAGGA1: TGGCTGATGTGGGCACTGTGTGTG-fluorescein
Reverse: GTTCATGAGCAGCAGTGAAGG2: LC Red 640-CCGGCTCGGAGCTGTGCTATTGTGGA-phosphate
ADAMTS-5Forward: GAGATGACCATGAGGAGCACTAC1: GACACCCTGGGAATGGCAGACG-fluorescein
Reverse: GGCCATCGTCTTCAATCACAG2: LC Red 640-GGGACCATATGTTCTCCAGAGCGCAGC-phosphate
EF1Forward: AACATGATTACAGGCACGTCTC1: TCGCTGCTGGTGTTGGTGAATTTGAAG-fluorescein
Reverse: AACAATTAGTTGTTTCACACCCAGT2: LC Red 705 GGTATCTCCAAGAATGGGCAGACCCGTGAG-phosphate
All Time Past Year Past 30 Days
Abstract Views 103 0 0
Full Text Views 794 595 150
PDF Downloads 174 82 15
Advertisement