• View in gallery

    Bands for PCR-based characterization of SGI1 in Salmonella enterica serotype Choleraesuis (C) and S enterica serotype Dublin (D). Genes evaluated were SO133,6, tnpR (resolvase), aadA2 (spectinomycin-streptomycin resistance), floR-tetR (junction between floR [florfenicol resistance] and tetR [regulator of tetracycline resistance]), and pse-1 (carbenicillinase). Predicted amplicon sizes are 800 bp (SO13), 172 bp (tnpR), 250 bp (aadA2), 280 bp (floR-tetR), and 231 bp (pse-1). M = DNA ladder.

  • View in gallery

    Protozoa-mediated effects on the invasion of HEp-2 cells (black bars) and Acanthamoeba castellanii cells (white bars) by SGI1-bearing isolates of Salmonella Choleraesuis (Sch) and Salmonella Dublin (Sdub). Mean ± SEM values for invasion percentage were determined after recovery from HEp-2 or A castellanii cells. Control isolates included SGI1-bearing S enterica serotype Typhimurium DT104, Salmonella Typhimurium TH11 (ie, SGI1-free Salmonella Typhimurium DT104), and Salmonella CholeraesuisSARB and Salmonella DublinSARB (both of which lack SGI1). Invasion percentage was calculated as follows: 100 × (CFUs recovered from the HEp-2 cells/CFUs added to the HEp-2 cells). *Within an isolate, value differs significantly (P < 0.05) from the value for the HEp-2 cells.

  • View in gallery

    Evaluation of the protozoal-mediated effects on time-dependent systemic infectivity of Salmonella Typhimurium DT104 in pigs (SW) or calves. Data represent the mean ± SEM number of CFUs of Salmonella Typhimurium DT104 or Salmonella Typhimurium TH11 (ie, the SGI1-free version of Salmonella Typhimurium DT104) recovered from calves or pigs inoculated with protozoa (Pz) that contained Salmonella spp or with HEp-2 cells (no Pz) that contained Salmonella spp; values were calculated for 3 or 6 samples, each of which was assayed in triplicate. The last data points (48 hours after inoculation for Salmonella Typhimurium DT104-inoculated calves and 96 hours after inoculation for pigs and Salmonella Typhimurium TH11-infected calves) represent cumulative data for samples of blood and spleen. *Within a time point, value differs significantly (P < 0.05) from the relevant control treatment (eg, Salmonella Typhimurium DT104 vs Salmonella Typhimurium TH11 or Pz vs no Pz).

  • View in gallery

    Protozoal-mediated effects on time-dependent systemic infectivity of SGI1-bearing host-adapted Salmonella spp in pigs (A) or calves (B). Data represent mean ± SEM number of CFUs of Salmonella organisms recovered from pigs or calves noculated with protozoa (Pz) that contained Salmonella spp or with HEp-2 cells (no Pz) bearing Salmonella spp; values were calculated for 3 samples, each of which was assayed in triplicate See Figure 3 for remainder of key.

  • 1

    Carlson SAStoffregen WC, Bolìn SR. Abomasitis due to multiple antibiotic resistant Salmonella enterica serotype Typhimurium phagetype DT104. Vet Microbiol 2002;85:233240.

    • Search Google Scholar
    • Export Citation
  • 2

    Wall PGMorgan DLamden K, et al. A case control study of infection with an epidemic strain of multiresistant Salmonella typhimurium DT104 in England and Wales. Commun Dis Rep CDR Rev 1994;4:R130R135.

    • Search Google Scholar
    • Export Citation
  • 3

    Boyd DPeters GCloeckaert A, et al. Complete nucleotide sequence of a 43-kilobase genomic island associated with the multidrug resistance region of Salmonella enterica serovar Typhimurium DT104 and its identification in phage type DT120 and serovar Agona. J Bacteriol 2001;183:57255732.

    • Search Google Scholar
    • Export Citation
  • 4

    Briggs CEFratamico PM. Molecular characterization of an antibiotic resistance gene cluster of Salmonella typhimurium DTI04. Antimicrob Agents Chemother 1999;43:846849.

    • Search Google Scholar
    • Export Citation
  • 5

    Rasmussen MACarlson SAFranklin SK, et al. Exposure to rumen protozoa leads to enhancement of invasion and pathogenicity for multiple antibiotic resistant Salmonella bearing SGI-1. Infect Immun 2005;73:46684675.

    • Search Google Scholar
    • Export Citation
  • 6

    Carlson SASharma VKMcCuddin ZP, et al. Involvement of a Salmonella genomic island 1 gene in the rumen protozoan-mediated enhancement of invasion for multiple-antibiotic-resistant Salmonella enterica serovar Typhimurium. Infect Immun 2007;75:792800.

    • Search Google Scholar
    • Export Citation
  • 7

    McCuddin ZPCarlson SASharma VK. Experimental reproduction of bovine Salmonella encephalopathy using a norepinephrine-based stress model. Vet J 2008;175:8288.

    • Search Google Scholar
    • Export Citation
  • 8

    Carlson SABolton LFBriggs CE, et al. Detection of Salmonella typhimurium DT104 using multiplex and fluorogenic PCR. Mol Cell Probes 1999;13:213222.

    • Search Google Scholar
    • Export Citation
  • 9

    Carlson SMeyerholz DStabel T, et al. Secretion of a putative cytotoxin in multiple antibiotic resistant Salmonella enterica serotype Typhimurium phagetype DT104. Microb Pathog 2002;31:201204.

    • Search Google Scholar
    • Export Citation
  • 10

    Wu MTCarlson SAMeyerholz DK. Cytopathic effects observed upon expression of a repressed collagenase gene present in Salmonella and related pathogens: mimicry of a cytotoxin from multiple antibiotic-resistant Salmonella enterica serotype Typhimurium phagetype DT104. Microb Pathog 2002;32:279287.

    • Search Google Scholar
    • Export Citation
  • 11

    Carlson SAMcCuddin ZPWu MT, et al. SlyA partially regulates the collagenase-mediated cytopathic phenotype specific for multiresistant Salmonella. Microb Pathog 2005;38:181187.

    • Search Google Scholar
    • Export Citation
  • 12

    Pabbaraju KMiller WSanderson K. Distribution of intervening sequences in the genes for 23S rRNA and rRNA fragmentation among strains of Salmonella Reference Collection B (SARB) and SARC sets. J Bacteriol 2000;182:19231929.

    • Search Google Scholar
    • Export Citation
  • 13

    Frana TSCarlson SAGriffith RW. Relative distribution and conservation of genes encoding aminoglycoside-modifying enzymes in Salmonella enterica serotype typhimurium phage type DT104. Appl Environ Microbiol 2001;67:445448.

    • Search Google Scholar
    • Export Citation
  • 14

    Guerra BSoto SHelmuth R, et al. Characterization of a self-transferable plasmid from Salmonella enterica serotype typhimurium clinical isolates carrying two integron-borne gene cassettes together with virulence and drug resistance genes. Antimicrob Agents Chemother 2002;46:29772981.

    • Search Google Scholar
    • Export Citation

Advertisement

Evaluation of the pathogenicity and virulence of three strains of Salmonella organisms in calves and pigs

View More View Less
  • 1 Department of Biomedical Sciences, College of Veterinary Medicine, Iowa State University Ames, IA 50011.

Abstract

Objective—To assess in pigs the pathogenicity and virulence of 3 strains of Salmonella spp capable of causing atypical salmonellosis in cattle.

Animals—36 Holstein calves and 72 pigs experimentally infected with Salmonella spp

Procedures—Representative Salmonella strains associated with 3 new disease phenotypes (protozoa-mediated hypervirulence, multisystemic cytopathicity, and encephalopathy) that have been characterized in cattle during the past 10 years were orally inoculated into pigs. Clinical manifestations were compared with those observed in cattle. Samples were collected from various tissues, and the presence of Salmonella organisms was assessed qualitatively and quantitatively by use of Salmonella-selective media

Results—Of the 3 unique Salmonella disease phenotypes observed in cattle, only protozoa-mediated hypervirulence was observed in pigs. Hypervirulence was related to a more rapid onset of disease and higher pathogen burden in pigs than in cattle. This phenotype was observed in pigs inoculated with multiresistant Salmonella enterica serotypes Typhimurium or Choleraesuis bearing the Salmonella genomic island 1 (SGI1) integron.

Conclusions and Clinical RelevanceSalmonella hypervirulence was identified in pigs noculated with SGI1-bearing strains exposed to free-living protozoa. Additionally, an SGI1-bearing strain of Salmonella Choleraesuis was detected that resulted in augmented virulence in pigs. Therefore, it appeared that protozoa-associated salmonellosis was analogous in pigs and cattle. Salmonella-mediated encephalopathy and multisystemic cytopathicity did not appear to be relevant diseases in pigs. (Am J Vet Res 2010;71:1170-1177)

During the past 10 years, 3 unique types of salmonellosis in cattle have been identified and characterized by our laboratory group. The first pathotype involved a strain of Salmonella enterica serotype Typhimurium in a multifocal outbreak of atypical salmonellosis in veal calves.1 Affected calves had a polysystemic disease characterized by abomasitis, peritonitis, and polyserositis, and the implicated strains could be isolated from tissues (eg, renal and testicular tissues) not usually associated with Salmonella infection. An in vivo technique was developed for this strain, and most of the clinical findings were reproduced.1 Past outbreaks were characterized by high morbidity and mortality rates,1 whereas current anecdotal reports of sporadic outbreaks (1 or 2 out-breaks/y) indicate a much lower morbidity.

The second pathotype involved Salmonella Typhimurium DT104. This strain gained attention in the 1990s as a multiresistant pathogen that had an ampicillin-chloramphenicol-streptomycin-sulfonamide-tetracycline antibiogram. Salmonella Typhimurium DT104 apparently has an enhanced ability to cause disease as underscored by a 13-fold increase in mortality rate in cattle, compared with the mortality rate for salmonellosis caused by antimicrobial-susceptible strains.2 Resistance of Salmonella Typhimurium DT104 to multiple antimicrobials is the result of acquiring a mobile DNA integron structure (subsequently designated as SGI13) that contains genes encoding resistance to 5 antimicrobials.4 More than 30 other genes, none of which contribute to antimicrobial resistance, are also contained in SGI1.3 A study5 conducted by our laboratory group implicated rumen protozoa (which are normal flora of the bovine rumen) as an environmental factor causing DT104 hypervirulence. The rumen protozoa-SGI1 interrelationship involves rumen protozoa engulfing DT104 and, with the aid of an SGI1 gene designated as SO13, hyperexpressing cellular invasion genes.6 The DT104-laden rumen protozoa then are lysed in the abomasum, thus enabling DT104 to safely reach the small intestine where the hyperactivated invasion genes facilitate a rapid progression to systemic salmonellosis.5 Salmonella Typhimurium DT104 continues to be anecdotally reported in field outbreaks of salmonellosis in cattle in which virulence appears to be increased.

The third pathotype involved 3 strains of Salmonella organisms capable of causing neurologic disease in cattle recently exposed to stressful situations, such as transportation or commingling. These strains included S enterica serotypes Saint-paul, Montevideo, and Enteriditis isolated from calves in Minnesota and Wisconsin.5 Affected calves had signs of moderate to severe neurologic disease ranging from excessive ear fluttering to seizures, and some affected calves had permanent neurologic deficits. The neurologic effects of these strains were reproduced in a laboratory setting by use of a norepinephrine-based stress-infection technique.5 These outbreaks of Salmonella encephalopathy are now extremely rare, but the potential for zoonotic transmission and the dramatic nature of the disease warrant further investigation in other food-producing animals.

Bovine-adapted S enterica serotype Dublin and porcine-adapted S enterica serotype Choleraesuis harbor SGI1 (unpublished observations). These findings prompted us to conduct the study reported here and investigate the protozoa-mediated virulence attributes of these strains in their respective hosts. Pigs and cattle were inoculated with protozoa containing various SGI1-bearing Salmonella organisms, followed by determinations of the resulting pathogen loads. Because of anecdotal reports suggesting unusual aspects of extraintestinal salmonellosis in pigs, the study reported here also investigated the potential for Salmonella-associated cytopathicity and neuropathogenicity in pigs. For cytopathicity studies, a relevant strain of Salmonella Typhimurium was inoculated into pigs in which pathogen loads were evaluated in numerous tissues, including those not typically associated with salmonellosis. For neuropathogenicity studies, pigs were inoculated with neuropathogenic Salmonella Saint-paul and then monitored for stress-mediated neurologic disease and evidence of Salmonella organisms in various tissues.

Materials and Methods

Animals—The in vivo portion of the study involved the use of 1-to 2-week-old male Holstein calves (n = 36) and 10-day-old mixed-breed pigs of both sexes (72). Animal experiments were approved by the Iowa State University Institutional Animal Care and Use Committee.

Bacterial strains and preparation—Bacterial strains used in the study were summarized5,7–12 (Appendix 1). Strain LNWI9 (designated as Salmonella Typhimurium CYP) served as the cytopathic (ie, CYP) strain, whereas Salmonella Typhimurium DT104 strain 98-7958 was used in experiments involving protozoa. Other SGI1-bearing strains included recently acquired isolates of Salmonella Dublin and Salmonella Choleraesuis. Salmonella Saint-paulNPG was chosen as a representative neuropathogenic (ie, NPG) strain, and SARB strains12 and certain SGI1-free strains served as control strains. Bacteria were stored in cryopreservation tubes containing 50% glycerol and 50% Lennox L brotha at −80°C and were grown in or on Lennox L broth or culture agarb prior to use.

Isolation of SGI1-bearing isolates of Salmonella Dublin and Salmonella Choleraesuis—For both serotypes, approximately 150 to 500 isolates were obtained from clinical and nonclinical isolates submitted to the National Veterinary Services Laboratories from 2004 to 2006. Serotype-specific isolates were pooled and grown aerobically for 16 hours at 37°C in 500 ml of Lennox L broth that contained ampicillinc (100 μg/mL) and chloramphenicoc (32 μg/mL). One milliliter of flocculent culture was then subcultured aerobically for 16 hours at 37°C in 50 ml of Lennox L broth that contained streptomycinc (64 μg/mL) and sulfamethoxazolec (512 μm/mL). Individual colonies were isolated by plating 30-μL aliquots on culture agarb that contained ampicillin, chloramphenciol, streptomycin, and sulfamethoxazole. The presence of SGI1 was assessed in individual colonies via a PCR assay that used the floR-tetR amplicon.8

Assessment of other SGI1 genes in isolates of Salmonella Dublin and Salmonella Choleraesuis—To evaluate the fidelity of SGI1 in isolates that had positive results for floR-tetR, 4 other SGI1 genes were examined. These genes were SO13, tnpR, aadA2, and pse-1. The PCR conditions were as described elsewhere8 for the floR-tetR amplicon. The oligonucleotide sequences were summarized6,8,13 (Appendix 2).

Salmonella invasion assays following survival within Acanthamoeba castellanii or HEp-2 cellsAcanthamoeba castellaniid and HEp-2 cellse (ie, immortal adherent mammalian epithelial cells that are used for assessing Salmonella virulence10) were maintained as described elsewhere.6 Approximately 109 bacteria were added to approximately 105 A castellanii or HEp-2 cells. The Salmonella-Protozoa mixture was then gently mixed for 16 hours at 37°C in a sealed 5-mL glass tube, whereas the Salmonella-HEp-2 mixture was maintained at 37°C in a 5% CO2 humidified incubator. At the end of the 16-hour incubation period, extracellular Salmonella organisms were killed by the addition of florfenicolf (300 μg/mL). Then, HEp-2 cells were trypsinized and resuspended in Coleman buffer.5,6 Cells were lysed by centrifugation (5,000 × g for 60 seconds) with 2.5mM glass beads and a mini-bead beater.g The lysate was centrifuged at 1,000 × g for 2 minutes and then re-suspended in 350 μL of Lennox L broth. Of the 350 μL, 25 were used for selective enumeration and 300 were used for an invasion assay performed in triplicate (ie, 100 μL/well), as described elsewhere.5,6 Percentage invasion was calculated by dividing the number of CFUs recovered by the number of CFUs added.

In vivo infection experiments involving protozoa-laden Salmonella organisms—For all in vivo experiments, animals were assigned to groups by use of a randomization procedure. Acanthamoeba castellanii was chosen for use in these experiments because this protozoan can mediate Salmonella hypervirulence6 and is often associated with water and thus is relevant to potable water used in swine operations.

Approximately 109 bacteria were added to approximately 105 A castellanii or HEp-2 cells, and the mixtures were subjected to the same regimen described for the invasion assay. Salmonella-laden HEp-2 cells were trypsinized and removed from tissue culture dishes prior to in vivo challenge exposure. Previous studies5,6 have revealed that approximately 40% to 60% of Salmonella organisms are recovered from eukaryotic cells after coincubation.

The Salmonella-eukaryotic cell mixture was then placed in a gelatin capsule, and the capsule was orally administered to 1- to 2-week-old male Holstein calves or 10-day-old mixed-breed pigs of both sexes. For each strain of Salmonella spp, 6 pigs and 3 calves were inoculated with A castellana cells that contained Salmonella spp, whereas 3 animals received HEp-2 cells that contained Salmonella spp (the latter was not administered to calves for Salmonella Typhimurium DT104 and TH11). All animals received approximately 4.5 × 106 CFUs/kg. Animals were monitored every 8 to 12 hours to evaluate changes in appetite, fecal consistency, and rectal temperature. Bacteriologic examinations were performed on blood samples collected every 12 hours.

At 36 to 96 hours after inoculation, animals were euthanatized. Calves were premedicated by administration of xylazine hydrochlorideh (0.45 mg/kg, IM), which was followed by administration of pentobarbitali (1 mg/kg, IV). Pigs were euthanatized by administration of pentobarbital (1 mg/kg, IP). The spleen was then removed from each animal and submitted for bacteriologic examinations.

In vivo infection experiments involving cytopathic strains—Animals were challenge-exposed via oral administration of 4.5 × 106 CFUs of Salmonella Typhimurium CYP/kg; these Salmonella organisms were grown aerobically for 16 hours at 37°C. Six pigs and 3 calves were inoculated with Salmonella Typhimurium CYP, and 6 pigs and 3 calves were inoculated with the control strain (Salmonella Typhimurium CYP-SlyA', which is not capable of cytopathic effects11).

When pronounced clinical signs, such as diarrhea, dehydration, and pyrexia (typically at 2 to 4 days after inoculation), were observed, affected animals were immediately euthanatized. Euthanasia was performed with xylazine and pentobarbital as described previously. Various samples were collected, including samples of the intestines, blood, spleen, lungs, liver, kidneys, and gonads; the kidneys and gonads were collected because these 2 tissues rarely harbor Salmonella spp, except for the novel cytopathic strains.1,10,11

In vivo infection-stress experiments involving neuropathogenic strains—Animals were challenge-exposed via oral administration of 4.5 × 106 CFUs of Salmonella Saint-paulNPG/kg; these Salmonella organisms were grown aerobically for 16 hours at 37°C. For each strain, 3 pigs and 3 calves received daily doses of norepinephrinec (45 μg/kg, IM) starting on the day of inoculation and continuing until the animals were euthanatized. As a control treatment, 3 calves and 3 pigs were challenge-exposed by oral administration of Salmonella Saint-paulNPG and administered a placebo (volume of saline [0.9% NaCl] solution identical to the volume of norepinephrine, IM). Additionally, 3 calves and 3 pigs were challenge-exposed by oral administration of Salmonella Saint-paulNPG and administered daily doses of dexamethasonej (0.1 mg/kg, IM). The control strain, which was administered to 3 calves and 3 pigs, was Salmonella Saint-paulSARB, which is not capable of causing neurologic disease in cattle.7

Animals were monitored for neurologic disease (seizures or clinical signs such as excessive ear fluttering, ataxia, opisthotonus, and proprioceptive placing deficits). When signs of neurologic disease were observed (typically 4 to 9 days after inoculation), affected animals were immediately euthanatized. An animal with neurologic disease was defined as an animal that had convulsions or that had at least 2 of the aforementioned 4 clinical signs of neurologic disease. Animals that did not have signs of neurologic disease were euthanatized 12 to 14 days after inoculation (ie, at least 3 or 4 days after animals with signs of neurologic disease were euthanatized). Animals were euthanatized with xylazine and pentobarbital, as described previously. Samples of the intestines, blood, spleen, and brain were collected from each animal.

Bacteriologic-based detection of Salmonella spp in various tissues—For qualitative assessment of Salmonella spp, microbes were selectively cultured by inoculation of 3 to 5 g of each sample into 100 mL of GN Hajna brothk and incubation overnight at 37°C in aerobic conditions. Then, 100 μL of the inoculum was transferred into 5 mL of Rappaport-Vassiliadis R10 broth,k which was also incubated overnight at 37°C in aerobic conditions. Cultures were then transferred to plates containing BGS agark; plates were incubated overnight at 37°C. Individual colonies recovered from selective plates were grown overnight in Lennox L broth and identified by use of a Salmonella-speciñc PCR assay targeting the sipB-sipC junction.8 All media included antimicrobials specific to the antibiogram of the individual isolate.

For quantitation of Salmonella organisms in blood and spleen tissues as an estimate of systemic pathogen load and as an indirect correlate of clinical signs, samples were directly inoculated on plates containing BGS agar. For blood samples, 100 μL was inoculated onto each of 10 separate plates. For spleen samples, 50 to 75 g of sample was homogenized, filtered with cheesecloth, and then inoculated onto 10 plates containing BGS agar (ie, approx 3 to 5 g of sample/plate). Colonies were enumerated the following day. Because these tissues can harbor similar numbers of bacteria at early time points in the infectious process, CFU data for spleen samples were pooled with counts from blood samples to provide the final data of each time course experiment. The identity of Salmonella strains was confirmed by use of antisera-agglutination-based serogroupingl in addition to confirmation of the original antibiogram for each isolate.

Statistical analysis—Statistical analysis was performed by use of an ANOVA with the Scheffe F test for multiple comparisons. Analyses were performed by use of a commercially available statistical program.m Although multiple samples were obtained from each tissue, each tissue-associated value represented a mean for the replicates from that particular tissue.

Results

Isolation and preliminary characterization of SGI1-bearing Salmonella Choleraesuis and Salmonella Dublin—From the pools of Salmonella Choleraesuis and Salmonella Dublin isolates, 3 colonies of Salmonella Choleraesuis and 2 colonies of Salmonella Dublin had ampicillin-chloramphenicol-streptomycin-sulfonamide antibiograms. One colony of each serotype yielded the floR-tetR amplicon (Figure 1); this amplicon is present in SGI1.8

Figure 1—
Figure 1—

Bands for PCR-based characterization of SGI1 in Salmonella enterica serotype Choleraesuis (C) and S enterica serotype Dublin (D). Genes evaluated were SO133,6, tnpR (resolvase), aadA2 (spectinomycin-streptomycin resistance), floR-tetR (junction between floR [florfenicol resistance] and tetR [regulator of tetracycline resistance]), and pse-1 (carbenicillinase). Predicted amplicon sizes are 800 bp (SO13), 172 bp (tnpR), 250 bp (aadA2), 280 bp (floR-tetR), and 231 bp (pse-1). M = DNA ladder.

Citation: American Journal of Veterinary Research 71, 10; 10.2460/ajvr.71.10.1170

Profile of SGI1 genes in isolates of Salmonella Choleraesuis and Salmonella Dublin with the floR-tetR amplicon—To evaluate the nature of SGI1 in isolates with the floR-tetR amplicon, 4 other SGI1 genes (SO13, tnpR, aadA2, and pse-1) were evaluated. The function of the SO13 gene is unknown,3 although a recent study6 revealed that it participates in upregulating invasion genes (and thus virulence) in Salmonella Typhimurium DT104 and other strains containing SGI1.6 The tnpR gene is a transposase-encoding gene present in many integrons,14 whereas aadA2 and pse-1 confer resistance to streptomycin-spectinomycin and ampicillin-amoxicillin, respectively. All 5 genes were detected in both Salmonella Choleraesuis and Salmonella Dublin.

Protozoa-dependent invasion assays for SGI1-bearing Salmonella Choleraesuis and Salmonella Dublin—To determine whether the SGI1-bearing strains of Salmonella Choleraesuis and Salmonella Dublin are hyperinvasive following exposure to protozoa (as has been reported5 for Salmonella Typhimurium DT104), bacteria were incubated with free-living protozoa (A castellanii cells) and invasion assays were performed. As a control sample, bacteria were incubated with HEp-2 cells. Bacteria were recovered from protozoa or HEp-2 cells and then subjected to a standard tissue culture invasion assay by use of HEp-2 cells.10 Protozoa were capable of augmenting invasion for the SGI1-bearing strains of Salmonella Choleraesuis and Salmonella Dublin (Figure 2). The 6- to 7-fold increase was similar to that observed for Salmonella Typhimurium DT104, which parallels that reported5 for rumen protozoa-mediated hyperinvasion and hypervirulence. No such effect was observed for Salmonella Fyphimurium TH11 (a DT104 strain that lacks SGI18) or for the SGI1-free SARB strains of Salmonella Choleraesuis and Salmonella Dublin.12

Figure 2—
Figure 2—

Protozoa-mediated effects on the invasion of HEp-2 cells (black bars) and Acanthamoeba castellanii cells (white bars) by SGI1-bearing isolates of Salmonella Choleraesuis (Sch) and Salmonella Dublin (Sdub). Mean ± SEM values for invasion percentage were determined after recovery from HEp-2 or A castellanii cells. Control isolates included SGI1-bearing S enterica serotype Typhimurium DT104, Salmonella Typhimurium TH11 (ie, SGI1-free Salmonella Typhimurium DT104), and Salmonella CholeraesuisSARB and Salmonella DublinSARB (both of which lack SGI1). Invasion percentage was calculated as follows: 100 × (CFUs recovered from the HEp-2 cells/CFUs added to the HEp-2 cells). *Within an isolate, value differs significantly (P < 0.05) from the value for the HEp-2 cells.

Citation: American Journal of Veterinary Research 71, 10; 10.2460/ajvr.71.10.1170

In vivo experiments to assess protozoa-associated virulence for Salmonella Typhimurium DF104 in pigs and cattleSalmonella organisms were incubated with protozoa and then inoculated into pigs and calves to determine whether protozoa-associated Salmonella Typhimurium DT104 hypervirulence in calves could extend to pigs. As a control sample, the same Salmonella strains were incubated with HEp-2 cells prior to in vivo inoculation.

Protozoa were able to enhance the systemic virulence of Salmonella Typhimurium DT104 in pigs (Figure 3). This effect was not as dramatic as that observed in calves, as indicated by the results for the present study as well as results of another study5 All Salmonella Typhimurium DT104—inoculated calves were euthanatized by 48 hours after inoculation because of severe clinical manifestations of salmonellosis (eg, pyrexia, diarrhea, lethargy, anorexia, and dehydration). Clinical signs were mild and transient in the Salmonella Typhimurium TH11-inoculated calves and in all pigs; thus, these animals were not euthanatized until 96 hours after inoculation. Protozoa-associated Salmonella Typhimurium DT104 were recovered to a significantly greater extent than were Salmonella Typhimurium DT104 not exposed to protozoa. The SGI1-free strains were not recovered from samples of blood or spleen obtained from inoculated pigs, regardless of protozoa exposure. Salmonella organisms were not recovered from most of the spleen tissues obtained from animals challenge-exposed with SGI1 free strains or strains that were not exposed to protozoa.

Figure 3—
Figure 3—

Evaluation of the protozoal-mediated effects on time-dependent systemic infectivity of Salmonella Typhimurium DT104 in pigs (SW) or calves. Data represent the mean ± SEM number of CFUs of Salmonella Typhimurium DT104 or Salmonella Typhimurium TH11 (ie, the SGI1-free version of Salmonella Typhimurium DT104) recovered from calves or pigs inoculated with protozoa (Pz) that contained Salmonella spp or with HEp-2 cells (no Pz) that contained Salmonella spp; values were calculated for 3 or 6 samples, each of which was assayed in triplicate. The last data points (48 hours after inoculation for Salmonella Typhimurium DT104-inoculated calves and 96 hours after inoculation for pigs and Salmonella Typhimurium TH11-infected calves) represent cumulative data for samples of blood and spleen. *Within a time point, value differs significantly (P < 0.05) from the relevant control treatment (eg, Salmonella Typhimurium DT104 vs Salmonella Typhimurium TH11 or Pz vs no Pz).

Citation: American Journal of Veterinary Research 71, 10; 10.2460/ajvr.71.10.1170

In vivo experiments to assess protozoa-associated virulence for SGI1-bearing host-adapted Salmonella spp in pigs and cattle—In vivo experiments were conducted to determine whether protozoa-associated hyper-virulence could be detected in 2 new SGI1-bearing strains of Salmonella spp adapted to pigs (Salmonella Choleraesuis) and cattle (Salmonella Dublin). Salmonella organisms were incubated with protozoa and then inoculated into calves and pigs. As a control sample, the same Salmonella strains were incubated with HEp-2 cells prior to in vivo inoculation. Control strains included the SARB versions of each serotype.

Protozoa were able to enhance the systemic virulence of SGI1-bearing Salmonella Choleraesuis in pigs (Figure 4). This effect was evident at an earlier onset of detectable pathogen load (36 hours for Salmonella CholeraesuisSGI plus protozoa and 48 hours for all others) and an earlier onset of pathogen burden necessitating euthanasia (48 hours for Salmonella CholeraesuisSGI plus protozoa and 60 hours for all others). Protozoa were incapable of augmenting the virulence of SGI1-bearing Salmonella Dublin.

Figure 4—
Figure 4—

Protozoal-mediated effects on time-dependent systemic infectivity of SGI1-bearing host-adapted Salmonella spp in pigs (A) or calves (B). Data represent mean ± SEM number of CFUs of Salmonella organisms recovered from pigs or calves noculated with protozoa (Pz) that contained Salmonella spp or with HEp-2 cells (no Pz) bearing Salmonella spp; values were calculated for 3 samples, each of which was assayed in triplicate See Figure 3 for remainder of key.

Citation: American Journal of Veterinary Research 71, 10; 10.2460/ajvr.71.10.1170

In vivo experiments to evaluate the cytopathicity of strain Salmonella Typhimurium CYP in pigs—In vivo experiments were conducted to determine whether strain Salmonella TyphimuriumCYP could evoke cytopathic effects and polysystemic salmonellosis in pigs, similar to that observed in veal calves.10 Salmonella TyphimuriumCYP was inoculated into young calves and pigs. As a control sample, animals were inoculated with Salmonella TyphimuriumCYP-SlyA', which is not capable of cytopathic activity11 As an additional control sample, tissue samples were obtained from animals inoculated with the host-adapted serotypes.

Pigs did not harbor Salmonella TyphimuriumCYP in any of the extraintestinal sites (Table 1). In contrast, Salmonella TyphimuriumCYP was recovered from all tissues obtained from the calves, including organs not usually associated with salmonellosis (eg, kidneys and testes). The noncytopathic strain Salmonella TyphimuriumCYP-SlyA' was recovered from all intestinal samples and from the spleen of 1 calf. Both host-adapted serotypes were recovered from extraintestinal sites (ie, blood, spleen, and lungs) usually associated with these pathogens in their preferred hosts. Renal and gonadal tissues did not yield either host-adapted strain from the respective host.

Table 1—

Qualitative assessment of Salmonella organisms recovered* from tissues of male Holstein calves and male and female mixed-breed pigs inoculated with Salmonella enterica serotype TyphimuriumCYP, compared with recovery for the control treatment noncytopathic Salmonella TyphimuriumCYP-SlyA' and the host-adapted strains of S enterica serotype DublinSARB in calves and S enterica serotype CholerasuisSARB in pigs.

StrainCalves
InBlSpLu
Salmonella TyphimuriumCYPAAA
Salmonella TyphimuriumCYP-SlyA'ANIC
Salmonella DublinSARB†AAA
Salmonella CholeraesuisSARB†

Salmonella organisms were isolated from all 3 inoculated animals (A), 2 of 3 inoculated animals (B), or 1 of 3 inoculated animals (C) or was not isolated (NI), †lnfected with the SARB strains in HEp-2 cells.

— = Not applicable. Bl = Blood. Go = Gonads. In = Intestines. Ki = Kidneys. Li = Liver. Lu = Lungs. Sp = Spleen.

In vivo experiments to evaluate the neuropathogenic effects of Salmonella Saint-paulNPG in pigs—In vivo experiments were conducted to determine whether strain Salmonella Saint-paulNPG could lead to neurologic disease in pigs, similar to that observed in stressed calves.7 Salmonella Saint-paulNPG was inoculated into young calves and pigs, and these animals were also administered consecutive daily doses of norepinephrine or dexamethasone to mimic stress. As a control sample, animals were inoculated with Salmonella Saint-paulSARB, which is not capable of eliciting signs of neurologic disease in calves.7

Pigs did not have signs of clinical disease, and Salmonella organisms could only be recovered from the intestines (Table 2). In contrast, calves had signs of neurologic disease when inoculated with Salmonella Saint-paulNPG and administered norepinephrine or dexamethasone. Salmonella organisms were isolated from the intestines, blood, spleen, and brain of calves with signs of neurologic disease. Nonneuropathogenic Salmonella Saint-paulSARB was only recovered from the intestines of calves, similar to results in another study.7

Table 2—

Qualitative assessment of Salmonella organisms recovered from male Holstein calves and male and female mixed-breed pigs inoculated with S enterica serotype Saint-paulNPG or nonneuropathogenic Salmonella Saint-paulSARB and injected with norepinephrine or dexamethasone to simulate stress.

StrainTreatmentCalves
Neurologic disease*Tissue source
InBl-SpBrIn
Salmonella Saint-paulNPGSaline (0.9% NaCI) solutionANI
 NorepinephrineAA
 DexamethasoneAB
Salmonella Saint-paulSARBNorepinephrineANI

Neurologic disease was defined as animals that had convulsions or that had at least 2 of 4 clinical signs of neurologic disease (excessive ear fluttering, ataxia, opisthotonus, and proprioceptive placing deficits).

A = Isolated or observed in all 3 animals. B = Isolated or observed in 2 of 3 animals. Bl-Sp = Blood and spleen combined. Br = Brain. In = Intestines. NI = Not isolated or identified.

Discussion

Several unique strains of Salmonella spp have unusual virulence and pathogenicity properties in calves. However, these effects have not been confirmed clinically in pigs. Hypervirulence in cattle is attributable to the presence of both SGI1 and survival within protozoa, whereas cytopathogenicity and neuropathogenicity have been associated with specific strains of Salmonella spp under certain conditions. Stress has been implicated in the etiology of the encephalopathies related to the neuropathogenic Salmonella spp.

Analysis of results for the study reported here indicated that protozoa-associated hypervirulence of Salmonella Typhimurium DT104 can be observed in pigs, although the effect is not as pronounced as that found in cattle. In pigs, Salmonella Typhimurium DT104 infection peaked at 60 hours after inoculation but decreased with time, whereas the pathogen increased in a time-dependent logarithmic manner in cattle until clinical signs warranted euthanasia at 48 hours. The SGI1-bearing Salmonella Choleraesuis had enhanced virulence following exposure to protozoa, but this effect was only related to the onset of disease. Salmonella Dublin associated with protozoa did not have significant enhancement of virulence in cattle, and this may have been related to its inherent putative maximal degree of virulence in calves.

Further comparisons revealed that Salmonella TyphimuriumCYP could not evoke cytopathic effects and polysystemic salmonellosis in pigs similar to those observed in cattle. Salmonella Saint-PaulNPG caused neurologic disease in cattle, but similar effects were not observed in pigs. These 2 findings are not altogether surprising because the Salmonella-associated cytopathogenicity and neuropathogenicity appear to be dependent on neurohormonal factors in cattle that may be divergent from those in swine.

Overall, these Salmonella strains typically are more virulent in cattle. For SGIl-bearing Salmonella spp, protozoa-associated hyperinvasion led to augmented virulence in pigs, and this was evident in the onset of disease for Salmonella Choleraesuis. From a clinical perspective, the hypervirulence phenomenon has not been reported in pigs because these animals have a lower exposure to protozoa than do ruminants (ie, protozoamediated hypervirulence of Salmonella spp can occur in pigs, but the incidence is probably not as high as that in cattle). In contrast, cytopathic and neuropathogenic strains were not capable of expressing their respective phenotypes in pigs.

Abbreviations

BGS

Brilliant green sulfa

DT104

Phagetype DT104

SGI1

Salmonella genomic island 1

TH11

PhagetypeTH11

a.

Lennox broth base, 12780-052, Invitrogen, Carlsbad, Calif.

b.

Lennox agar, 22700-025, Invitrogen, Carlsbad, Calif.

c.

Sigma Chemical Co, St Louis, Mo.

d.

30010, ATCC, Manassas, Va.

e.

CCL-23, ATCC, Manassas, Va.

f.

NuFlor, Schering-Plough, Kenilworth, NJ.

g.

Biospec Products, Bartlesville, Okla.

h.

Phoenix Scientific Inc, St Joseph, Mo.

i.

Fort Dodge Animal Health, Fort Dodge, Iowa.

j.

Vedco, St Joseph, Mo.

k.

Becton-Dickinson, Sparks, Md.

l.

Difco, Becton-Dickinson, Sparks, Md.

m.

Statview, SAS Institute Inc, Cary, NC.

References

  • 1

    Carlson SAStoffregen WC, Bolìn SR. Abomasitis due to multiple antibiotic resistant Salmonella enterica serotype Typhimurium phagetype DT104. Vet Microbiol 2002;85:233240.

    • Search Google Scholar
    • Export Citation
  • 2

    Wall PGMorgan DLamden K, et al. A case control study of infection with an epidemic strain of multiresistant Salmonella typhimurium DT104 in England and Wales. Commun Dis Rep CDR Rev 1994;4:R130R135.

    • Search Google Scholar
    • Export Citation
  • 3

    Boyd DPeters GCloeckaert A, et al. Complete nucleotide sequence of a 43-kilobase genomic island associated with the multidrug resistance region of Salmonella enterica serovar Typhimurium DT104 and its identification in phage type DT120 and serovar Agona. J Bacteriol 2001;183:57255732.

    • Search Google Scholar
    • Export Citation
  • 4

    Briggs CEFratamico PM. Molecular characterization of an antibiotic resistance gene cluster of Salmonella typhimurium DTI04. Antimicrob Agents Chemother 1999;43:846849.

    • Search Google Scholar
    • Export Citation
  • 5

    Rasmussen MACarlson SAFranklin SK, et al. Exposure to rumen protozoa leads to enhancement of invasion and pathogenicity for multiple antibiotic resistant Salmonella bearing SGI-1. Infect Immun 2005;73:46684675.

    • Search Google Scholar
    • Export Citation
  • 6

    Carlson SASharma VKMcCuddin ZP, et al. Involvement of a Salmonella genomic island 1 gene in the rumen protozoan-mediated enhancement of invasion for multiple-antibiotic-resistant Salmonella enterica serovar Typhimurium. Infect Immun 2007;75:792800.

    • Search Google Scholar
    • Export Citation
  • 7

    McCuddin ZPCarlson SASharma VK. Experimental reproduction of bovine Salmonella encephalopathy using a norepinephrine-based stress model. Vet J 2008;175:8288.

    • Search Google Scholar
    • Export Citation
  • 8

    Carlson SABolton LFBriggs CE, et al. Detection of Salmonella typhimurium DT104 using multiplex and fluorogenic PCR. Mol Cell Probes 1999;13:213222.

    • Search Google Scholar
    • Export Citation
  • 9

    Carlson SMeyerholz DStabel T, et al. Secretion of a putative cytotoxin in multiple antibiotic resistant Salmonella enterica serotype Typhimurium phagetype DT104. Microb Pathog 2002;31:201204.

    • Search Google Scholar
    • Export Citation
  • 10

    Wu MTCarlson SAMeyerholz DK. Cytopathic effects observed upon expression of a repressed collagenase gene present in Salmonella and related pathogens: mimicry of a cytotoxin from multiple antibiotic-resistant Salmonella enterica serotype Typhimurium phagetype DT104. Microb Pathog 2002;32:279287.

    • Search Google Scholar
    • Export Citation
  • 11

    Carlson SAMcCuddin ZPWu MT, et al. SlyA partially regulates the collagenase-mediated cytopathic phenotype specific for multiresistant Salmonella. Microb Pathog 2005;38:181187.

    • Search Google Scholar
    • Export Citation
  • 12

    Pabbaraju KMiller WSanderson K. Distribution of intervening sequences in the genes for 23S rRNA and rRNA fragmentation among strains of Salmonella Reference Collection B (SARB) and SARC sets. J Bacteriol 2000;182:19231929.

    • Search Google Scholar
    • Export Citation
  • 13

    Frana TSCarlson SAGriffith RW. Relative distribution and conservation of genes encoding aminoglycoside-modifying enzymes in Salmonella enterica serotype typhimurium phage type DT104. Appl Environ Microbiol 2001;67:445448.

    • Search Google Scholar
    • Export Citation
  • 14

    Guerra BSoto SHelmuth R, et al. Characterization of a self-transferable plasmid from Salmonella enterica serotype typhimurium clinical isolates carrying two integron-borne gene cassettes together with virulence and drug resistance genes. Antimicrob Agents Chemother 2002;46:29772981.

    • Search Google Scholar
    • Export Citation

Appendix 1

Salmonella enterica strains and plasmids used in the study.

Strain designationSGI1 statusVirulence phenotype
Salmonella Typhimurium DT104+Hyperinvasive after exposure to protozoa
Salmonella Typhimurium TH11ND
Salmonella TyphimuriumCYP+Cytopathic in veal calves
Salmonella TyphimuriumCYP-SlyA'+ND
Salmonella DublinSARBAdapted to cattle; nonneuropathogenic
Salmonella CholeraesuisSARBAdapted to swine
Salmonella DublinSGI1+Adapted to cattle
Salmonella CholeraesuisSGl1+Adapted to swine
Salmonella Saint-paulNPGNeuropathogenic in stressed calves
Salmonella Saint-paulSARBNonneuropathogenic

+ = SGI1 present. — = SGI1 absent. NA = Not applicable; developed for the study reported here. ND = Not determined. NN = Nothing noteworthy.

Appendix 2

The SGI1-specific oligonucleotides and resulting amplicons used in the study for the characterization of multiresistant S enterica sero-types Choleraesuis and Dublin.

Oligonucleotide designationDNA sequence (5′ to 3′)Amplicon size (bp)Reference
S013Forward: ATGAAAATGAATATGTCAACTTCC8006
 Reverse: TCATTGGCCTTCCTAAAATAGCAA 6
tnpForward: GCACTGTTCGTTTCAATCTGT172NA
 Reverse: TGGGAAGAATGCCGCTAGAC NA
pse-1Forward: TTTGGTTCCGCGCTATCTG2318
 Reverse: TACTCCGAGCACCAAATCCG 8
aadA2Forward: CGGTGACCATCGAAATTTCG25013
 Reverse: CTATAGCGCGGAGCGTCTCGC 13
floR-tetRForward: CGCTCCTTCGATCCCGT2808
  Reverse: GCTGCGTTCATCTACAACAGAT8

NA = Not applicable; developed for the study reported here.

Contributor Notes

Dr. Barnhill's present address is National Animal Disease Center, 2300 Dayton Rd, Ames, IA 50010.

Supported in part by the National Pork Board on behalf of the Iowa Pork Producers Association.

The authors thank Diane McDonald for technical assistance.

Address correspondence to Dr. Carlson (stevec@iastate.edu).