Materials and Methods

Participants and sample collection—Blood samples from swine and feeders and veterinarians who had close contact with the swine were collected from commercial pig farms in rural Shanghai. Information was collected on age, sex, and geographic region for each swine sample. For humans and swine, clinical manifestations of disease at the time of sample collection were recorded, and medical records were also obtained. The protocol for sample collection from swine was approved by the Shanghai Animal Management Committee. Blood samples were obtained from human participants after acquiring their consent.

General procedures—Blood samples were evaluated to determine the infection status of swine and humans by means of 3 techniques: microscopy, PCR assay, and scanning electron microscopy. A blood sample from a pig known to be infected with M suis was maintained in the laboratory as a positive control sample. This sample had been obtained from an experimentally infected specific-pathogenfree pig, and infection was confirmed via microscopy and PCR assay. For a negative control sample, a blood sample from an uninfected specific-pathogenfree pig was used.

Compound microscopy—Blood films on microscopy slides were prepared and allowed to dry. Wright-Giemsa stain (0.8 mL) was applied to cover each blood film for 1 minute, then a 2X volume of PBS solution (pH, 7.8) was applied and mixed with the stain by means of gentle blowing for 5 minutes. Slides were subsequently rinsed with water and dried, then examined with a compound microscope.

PCR assay—A standard phenol-chloroform–isoamyl alcohol protocol¹² was used to extract DNA from each blood sample (500 μL). Attempts to amplify the whole 16S rRNA gene by use of universal primers failed. Therefore, a 16S rRNA gene fragment was amplified by use of the following primers: upper primer, 5′–CACGCCGTAACGATGGGTAT–3′ and lower primer, 5′–CAGCCCAAGGCATAAGGGG–3′.

The DNA materials extracted from laboratory archived and confirmed Escherichia coli, group E Streptococcus (serotype II), Toxoplasma gondii, and Salmonella choleraesuis, and samples of blood from healthy humans and pigs were selected as control samples to evaluate the specificity of the PCR assay. Rigorous precautions were taken to avoid bacterial contamination. The 396-bp fragments were amplified with Pfu polymerase (36 cycles of 94°C for 1 minute, 60°C for 1 minute, and 72°C for 1 minute, with a 10-minute extension). After electrophoresis, the PCR product was purified with a spin column^a and dissolved with double-distilled water. Extracted DNA was sequenced in both directions by use of an automatic sequencer.^b

Scanning electron microscopy—The procedure for examination of blood samples via scanning electron microscopy is described elsewhere.² Three blood samples identified as positive for M suis DNA via the PCR assay and 2 blood samples identified as negative were randomly selected from among all swine blood samples. Fresh samples of anticoagulated blood were washed with PBS solution (pH, 7.4) 3 times and diluted with a 2X volume of PBS solution (pH, 7.4). A drop from each sample was then placed on a polylysine-coated slide that had been moistened with distilled water, and the slide was placed in a covered Petri dish for 30 minutes. The material was then fixed on the slide by application of 2.5% (vol/vol) glutaraldehyde (pH, 6.8) for 30 minutes. Afterward, 2% osmium tetroxide (wt/vol) in 0.1M HEPES buffer (pH, 6.8) was applied for 30 minutes. The slide was subsequently rinsed again with HEPES buffer and dehydrated by application of ethanol at an increasing concentration (70% to 95%). At the critical point, the slide was dried by use of liquid CO₂ in a critical point drier, sputter coated with goldpalladium (60:40), and examined with a field-emission scanning electron microscope.^c

Phylogenetic analysis—The 16S rRNA gene sequences of various hemotrophic Mycoplasma spp were downloaded from the database of the National Center for Biotechnology Information, and their corresponding fragments together with the partial 16S rRNA gene sequence obtained in the present study were aligned by use of a multiple-sequence alignment program. Mycoplasma penetrans was chosen as the out (reference) group. A phylogenetic tree was generated by means of the neighbor-joining method, which was corrected for nucleotide substitutions by use of the Kimura 2-parameter correction with the transition-to-transversion ratio set at 2. Data were resampled 1,000 times, and bootstrap analysis was used for statistical assessment of the resulting node.²

Statistical analysis—Statistical analysis of the association between seropositivity for M suis infection in swine and sex, age, geographic region (ChongMin, BaoShan, JinShan, PuDong, JiaDing, SonJiang, Fen-Xian, QingPu, NanHui, or MinHang), and clinical signs of infection was performed by use of a C² test.^d A value of P < 0.05 was considered significant.

Nucleotide sequence accession number—The partial 16S rRNA sequences of pig and human genetic isolates obtained in the study were deposited with GenBank under accession Nos. EU371555 and EU371556, respectively.

Results

Blood samples were obtained from 172 swine and 65 swine feeders and veterinarians from 19 pig farms distributed throughout rural Shanghai. Seventy-nine (46%) of the swine were male, and 93 (54%) were female. The distribution of swine by age group was as follows: < 30 days, 18; 31 to 60 days, 18; 61 to 100 days, 63; 101 to 150 days, 28; 151 to 190 days, 19; 191 days to 1 year, 17; and > 1 year, 9. The distribution of swine by geographic regions was as follows: ChongMin, 17; BaoShan, 16; JinShan, 21; PuDong, 11; JiaDing, 16; SongJiang, 16; FenXian, 23; QingPu, 17; NanHui, 20; and MinHang, 15.

Compound and scanning electron microscopy revealed M suis attached to erythrocytes (Figure 1) in 32 of 65 (49%) human blood samples and 132 of 172 (77%) swine blood samples. When M suis was detected, the number of organisms was typically small. Most of the organisms were round, measured approximately 1 μm in diameter, and were arranged singly, in pairs, and in clusters on erythrocytes. Scanning electron microscopy revealed that M suis had attached to the surface of porcine erythrocytes but had not penetrated them.

View Full Size

Photomicrographs of blood samples from swine evaluated for evidence of Mycoplasma suis infection via scanning electron microscopy (A and B) and compound microscopy (C and D). In panel A, an M suis (arrow) organism is attached to the surface of an erythrocyte in a blood sample from an infected pig. In panel B, erythrocytes (dashed arrow) surround a lymphocyte (solid arrow) in a blood sample from an uninfected pig. In panel C, several M suis organisms (arrows) are evident on the surface of erythrocytes in a blood film from an infected pig. In panel D, no M suis organisms are evident in a blood film from an uninfected pig. A and B—Bar = 1 μm. C and D—Wright-Giemsa stain; bar = 5 μm.

Citation: American Journal of Veterinary Research 70, 7; 10.2460/ajvr.70.7.890

• Download Figure
• Download figure as PowerPoint slide

The PCR assay revealed that 32 (49%) blood samples from humans and 148 (86%) blood samples from swine contained M suis DNA. In total, 15 swine blood samples in which M suis organisms were not detected via the compound microscopic method were identified as containing M suis DNA via the PCR assay. On the other hand, there was no microscopic evidence of M suis in any of the human and swine blood samples in which the PCR assay failed to detect M suis DNA.

Results of evaluation of the specificity of the PCR assay indicated that the 16S rRNA gene fragment could be amplified only in positive control samples but not in the negative control samples (E coli, group E Streptococcus [serotype II], T gondii, and S choleraesuis; Figure 2). Sequence alignment analysis confirmed that the microorganisms for which DNA was recovered from the blood samples were hemotrophic Mycoplasma spp.

View Full Size

Photograph of electrophoretic gel for determining the specificity of a PCR assay for detecting DNA of M suis in human and swine blood samples, with DNA from other microorganisms used for reference. Values to the left of the gel represent molecular weight (kDa) of bands. M = Molecular weight marker. SP = M suis–positive swine sample. E = Escherichia coli. S2 = Group E Streptococcus (serotype II). T = Toxoplasma gondii.S= Salmonella choleraesuis.NH= M suis–negative human sample. NP = M suis–negative swine sample. HP = M suis–positive human sample.

Citation: American Journal of Veterinary Research 70, 7; 10.2460/ajvr.70.7.890

• Download Figure
• Download figure as PowerPoint slide

Statistical analysis revealed there was no association between M suis infection status in swine and sex (C² = 1.73; P > 0.05), age (C² = 2.80; P > 0.05), or geographic location (C² = 1.26; P > 0.05). During the study, 3 of 65 (5%) humans with icterus and 4 (6%) with a history of anemia were identified. Among these, the blood sample from only 1 person with icterus contained M suis DNA. The PCR assay did not detect M suis DNA in the blood samples of 7 of 73 (10%) swine with mild pyrexia and 6 of 60 (10%) swine with subcutaneous bleeding, but it did detect M suis DNA in the blood samples of 66 (90%) other swine with mild pyrexia and 54 (90%) other swine with subcutaneous bleeding. Statistical analysis confirmed these 2 clinical signs of disease were associated with M suis infection in swine (C² = 7.04 and C² = 6.63, respectively; P < 0.01). Moreover, 46 of the 54 (85%) infected swine with subcutaneous bleeding were also mildly pyrexic. There was no association between clinical signs of disease in swine and geographic location. Although icterus was evident in the visible mucosa of some swine, this factor was not associated with M suis infection status. There were no associations between clinical signs of disease or medical history and infection status in humans.

Phylogenetic analysis yielded an evolutionary tree that indicated the relationship among the 16S rRNA of human and swine isolates in this study with the 16S rRNA of other hemotrophic Mycoplasma spp. The 16S rRNA genes of human and swine isolates were highly similar (98% homology) and in the same phylogenetic cluster as a previously identified swine isolate (Figure 3).

View Full Size

Phylogenetic tree generated by use of partial 16S rRNA gene sequences, indicating the relationship of 2 Eperythrozoon spp identified in swine and humans in the present study (asterisk) with other Eperythrozoon spp and Haemobartonella spp. The accession number and origin of each species are provided in parentheses when available. Nomenclature used is that which was assigned when the species sequences were originally identified and reported. Mycoplasma penetrans was selected as the out (reference) group. The percentage of replicate trees in which the associated taxa clustered together in the bootstrap test (1,000 replicates) is indicated at the nodes of the tree. The evolutionary distances were calculated by use of the neighbor-joining method and were corrected for nucleotide substitutions by use of the Kimura 2-parameter correction. The tree is drawn to scale, with branch lengths in the same units as those of the evolutionary distances used to infer the phylogenetic tree. Distance indicated by the scale bar is equivalent to 1 base substitution/10 nucleotides. UK = United Kingdom. US = United States.

Citation: American Journal of Veterinary Research 70, 7; 10.2460/ajvr.70.7.890

• Download Figure
• Download figure as PowerPoint slide

Discussion

Many species of vertebrates are susceptible to hemotrophic Mycoplasma infections. In Europe and the United Kingdom, hemotrophic Mycoplasma DNA was identified via PCR assay in blood samples of between 10% and 23% of dogs and cats tested between 2003 and 2006.^13–15 A large-scale study¹¹ of the prevalence of hemotrophic Mycoplasma in humans in Inner Mongolia, China, revealed that 35.3% of the population was infected, and infection status appeared to be associated with occupation and season. People that had close contact with livestock were significantly more likely to be infected than those that did not have close contact. In 2007, 4 swine farms in Brazil were evaluated, and 33.1% of swine in that study¹⁶ were identified as infected with M suis via Southern blot and PCR techniques. The PCR assay used in the study reported here revealed a higher prevalence of infection in humans with close contact with swine (49%) and the swine with which they had contact (86%), compared with the prevalences reported for other studies.^11,13–16 Poor sanitary conditions in the commercial swine farms in the present study provided a good environment for breeding of mosquitoes (Aedes spp), which are believed to play an important role in transmission of M suis among swine.¹⁷ Other situations conducive to the transmission of M suis among swine, such as ingestion of food contaminated with blood from infected swine or reuse of syringes by farm workers between swine, were common in these farms as well. These factors might have contributed to the high prevalence of infection in the swine in our study.

Infection with M suis is typically subclinical in humans and swine, and symptoms or clinical signs can vary among those infected. In the study reported here, data on clinical manifestations of disease and medical histories of all tested humans were collected, but no association of these data with M suis infection was detected (data not shown). Therefore, it was concluded that the low numbers of M suis in human blood samples and, hence, the low degree of infection in humans, failed to result in symptoms. The lack of symptoms could also have been attributable to a loss in the degree of pathogenicity after the pathogen was transmitted from swine to humans, assuming swine were the source of human infection. Common clinical signs in M suisinfected swine were mild pyrexia and subcutaneous bleeding. We speculated that precipitation and stacking of erythrocytes in blood of M suis–infected swine would lead to formation of immune complexes that would become trapped in capillaries, reducing blood flow, causing injury to those vessels, and leading to subcutaneous bleeding. However, whether the subcutaneous bleeding was actually attributable to infection with M suis would require additional research.

To the authors' knowledge, there is no molecular evidence to suggest that M suis can be transmitted from swine to humans. In the study reported here, results of phylogenetic analysis revealed a high degree of homology between the 16S rRNA from humans and swine and among that 16S rRNA and the 16S rRNA isolated from a different strain of M suis. The similarity of the human and swine strains suggested that transmission of M suis to humans may take place. To investigate this possibility further, it would be beneficial to determine whether the hemotrophic Mycoplasma spp from humans from the same geographic regions who had no contact with swine differ from the species detected in the present study.