• 1.

    Holmberg SD, Osterholm MT, Senger KA, et al. Drug-resistant Salmonella from animals fed antimicrobials. N Engl J Med 1984;311:617622.

  • 2.

    Kelly L, Smith DL, Snary EL, et al. Animal growth promoters: to ban or not to ban? A risk assessment approach. Int J Antimicrob Agents 2004;24:714.

    • Search Google Scholar
    • Export Citation
  • 3.

    McDermott PF, Zhao S, Wagner DD, et al. The food safety perspective antibiotic resistance. Anim Biotechnol 2002;13:7184.

  • 4.

    Gebreyes WA, Thakur S, Morgan WE. Comparison of prevalence, antimicrobial resistance, and occurrence of multidrug-resistant Salmonella in antimicrobial-free and conventional pig production. J Food Prot 2006;69:743748.

    • Search Google Scholar
    • Export Citation
  • 5.

    Cui S, Ge B, Zheng J, et al. Prevalence and antimicrobial resistance of Campylobacter spp and Salmonella serovars in organic chickens from Maryland retail stores. Appl Environ Microbiol 2005;71:41084111.

    • Search Google Scholar
    • Export Citation
  • 6.

    Sato K, Bartlett PC, Saeed MA. Antimicrobial susceptibility of Escherichia coli isolates from dairy farms using organic versus conventional production methods. J Am Vet Med Assoc 2005;226:589594.

    • Search Google Scholar
    • Export Citation
  • 7.

    Halbert LW, Kaneene JB, Ruegg PL, et al. Evaluation of antimicrobial susceptibility patterns in Campylobacter spp isolated from dairy cattle and farms managed organically and conventionally in the midwestern and northeastern United States. J Am Vet Med Assoc 2006;228:10741081.

    • Search Google Scholar
    • Export Citation
  • 8.

    Thakur S, Gebreyes WA. Prevalence and antimicrobial resistance of Campylobacter in antimicrobial-free and conventional pig production systems. J Food Prot 2005;68:24022410.

    • Search Google Scholar
    • Export Citation
  • 9.

    Gill S, Pop M, DeBoy R, et al. Metagenomic analysis of the human distal gut microbiome. Science 2006;312:13551359.

  • 10.

    Handelsman J. Metagenomics: application of genomics to uncultured microorganisms. Microbiol Mol Biol Rev 2004;68:669685.

  • 11.

    Part III. Health management and biosecurity in US feedlots, 1999. In: National Animal Health Monitoring System. Fort Collins, Colo: USDA, APHIS, Veterinary Services, Centers for Epidemiology and Animal Health, 2000.

    • Search Google Scholar
    • Export Citation
  • 12.

    Chopra I, Roberts M. Tetracycline antibiotics: mode of action, applications, molecular biology, and epidemiology of bacterial resistance. Microbiol Mol Biol Rev 2001;65:232260.

    • Search Google Scholar
    • Export Citation
  • 13.

    Roberts M. Update on acquired tetracycline resistance genes. FEMS Microbiol Lett 2005;245:195203.

  • 14.

    Roberts MC. Tetracycline resistance determinants: mechanisms of action, regulation of expression, genetic mobility, and distribution. FEMS Microbiol Rev 1996;19:124.

    • Search Google Scholar
    • Export Citation
  • 15.

    Ng LK, Martin I, Alfa M, et al. Multiplex PCR for the detection of tetracycline resistance genes. Mol Cell Probes 2001;15:209215.

  • 16.

    Blake DP, Humphry RW, Scott KP, et al. Influence of tetracycline exposure on tetracycline resistance and the carriage of tetracycline resistance genes within commensal Escherichia coli populations. J Appl Microbiol 2003;94:10871097.

    • Search Google Scholar
    • Export Citation
  • 17.

    Bryan A, Shapir N, Sadowsky M. Frequency and distribution of tetracycline resistance genes in genetically diverse, nonselected, and nonclinical Escherichia coli strains isolated from diverse human and animal sources. Appl Environ Microbiol 2004;70:25032507.

    • Search Google Scholar
    • Export Citation
  • 18.

    Sunde M, Norstrom M. The prevalence of, associations between and conjugal transfer of antibiotic resistance genes in Escherichia coli isolated from Norwegian meat and meat products. J Antimicrob Chemother 2006;58:741747.

    • Search Google Scholar
    • Export Citation
  • 19.

    Gevers D, Huys G, Swings J. In vitro conjugal transfer of tetracycline resistance from Lactobacillus isolates to other Gram-positive bacteria. FEMS Microbiol Lett 2003;225:125130.

    • Search Google Scholar
    • Export Citation
  • 20.

    Wilcks A, Andersen S, Licht T. Characterization of transferable tetracycline resistance genes in Enterococcus faecalis isolated from raw food. FEMS Microbiol Lett 2005;243:1519.

    • Search Google Scholar
    • Export Citation
  • 21.

    Hummel A, Holzapfel W, Franz C. Characterisation and transfer of antibiotic resistance genes from enterococci isolated from food. Syst Appl Microbiol 2007;30:17.

    • Search Google Scholar
    • Export Citation
  • 22.

    Huys G, D'Haene K, Collard J, et al. Prevalence and molecular characterization of tetracycline resistance in Enterococcus isolates from food. Appl Environ Microbiol 2004;70:15551562.

    • Search Google Scholar
    • Export Citation
  • 23.

    Aquilanti L, Garofalo C, Osimani A, et al. Isolation and molecular characterization of antibiotic-resistant lactic acid bacteria from poultry and swine meat products. J Food Prot 2007;70:557565.

    • Search Google Scholar
    • Export Citation
  • 24.

    Mayrhofer S, Domig K, Amtmann E, et al. Antibiotic susceptibility of Bifidobacterium thermophilum and Bifidobacterium pseudolongum isolates from animal sources. J Food Prot 2007;70:119124.

    • Search Google Scholar
    • Export Citation

Advertisement

A metagenomic approach for determining prevalence of tetracycline resistance genes in the fecal flora of conventionally raised feedlot steers and feedlot steers raised without antimicrobials

Rebekah Harvey MPH-VPH1, Julie Funk DVM, PhD2, Thomas E. Wittum PhD3, and Armando E. Hoet DVM, PhD4
View More View Less
  • 1 Department of Veterinary Preventive Medicine, College of Veterinary Medicine, College of Public Health, The Ohio State University, Columbus, OH 43210.
  • | 2 National Food Safety and Toxicology Center, Michigan State University, East Lansing, MI 48824.
  • | 3 Department of Veterinary Preventive Medicine, College of Veterinary Medicine, College of Public Health, The Ohio State University, Columbus, OH 43210.
  • | 4 Department of Veterinary Preventive Medicine, College of Veterinary Medicine, College of Public Health, The Ohio State University, Columbus, OH 43210.

Abstract

Objective—To compare prevalence of tetracycline resistance genes in the fecal flora of conventionally raised feedlot steers and feedlot steers raised without antimicrobials.

Sample Population—61 fecal samples from conventionally raised steers and 61 fecal samples from steers raised without antimicrobials at a single feedlot.

Procedures—Total DNA was extracted from each fecal sample and analyzed by means of 4 multiplex PCR assays for 14 tetracycline resistance genes.

Results—At least 3 tetracycline resistance genes were identified in all 122 fecal samples. For 5 of the 14 tetracycline resistance genes, the percentage of samples in which the gene was detected was significantly higher for fecal samples from conventionally raised cattle than for fecal samples from antimicrobial-free cattle, and for 1 gene, the percent-age of samples in which the gene was detected was significantly higher for fecal samples from antimicrobial-free cattle than for fecal samples from conventionally raised cattle. The percentage of samples with r 11 tetracycline resistance genes was significantly higher for fecal samples from conventionally raised cattle (35/61 [57%]) than for fecal samples from antimicrobial-free cattle (16/61 [26%]).

Conclusions and Relevance—Results suggested that the prevalence of tetracycline resistance genes was significantly higher in the fecal flora of conventionally raised feedlot steers than in the fecal flora of feedlot steers raised without antimicrobials and that a metagenomic approach may be useful in understanding the epidemiology of antimicrobial resistance in food animals.

Abstract

Objective—To compare prevalence of tetracycline resistance genes in the fecal flora of conventionally raised feedlot steers and feedlot steers raised without antimicrobials.

Sample Population—61 fecal samples from conventionally raised steers and 61 fecal samples from steers raised without antimicrobials at a single feedlot.

Procedures—Total DNA was extracted from each fecal sample and analyzed by means of 4 multiplex PCR assays for 14 tetracycline resistance genes.

Results—At least 3 tetracycline resistance genes were identified in all 122 fecal samples. For 5 of the 14 tetracycline resistance genes, the percentage of samples in which the gene was detected was significantly higher for fecal samples from conventionally raised cattle than for fecal samples from antimicrobial-free cattle, and for 1 gene, the percent-age of samples in which the gene was detected was significantly higher for fecal samples from antimicrobial-free cattle than for fecal samples from conventionally raised cattle. The percentage of samples with r 11 tetracycline resistance genes was significantly higher for fecal samples from conventionally raised cattle (35/61 [57%]) than for fecal samples from antimicrobial-free cattle (16/61 [26%]).

Conclusions and Relevance—Results suggested that the prevalence of tetracycline resistance genes was significantly higher in the fecal flora of conventionally raised feedlot steers than in the fecal flora of feedlot steers raised without antimicrobials and that a metagenomic approach may be useful in understanding the epidemiology of antimicrobial resistance in food animals.

It has been hypothesized that use of antimicrobials in food animals has allowed for the emergence and maintenance of resistance genes that could reach the human population through the food chain.1–3 Food animals raised in feedlots or in intensive farm settings where they may receive antimicrobials as growth promoters are commonly referred to as having been conventionally reared. Previous studies4–8 have revealed that conventionally raised food animals are more likely to harbor antimicrobial-resistant bacteria than are food animals that have been raised without antimicrobials. In 1 study,8 for instance, Campylobacter coli isolates from conventionally raised pigs had a higher prevalence of tetracycline resistance genes than did isolates from pigs raised without antimicrobials. Similarly, in a separate study,7 Campylobacter isolates from conventionally raised cattle were found to have more resistance genes than isolates from cattle raised without antimicrobials.

Much of the published research on antimicrobial resistance has been confined to the study of cultivable bacterial isolates, which represent only a fraction of the actual microbial population and genetic diversity in any individual.9 Because a large portion of gastrointestinal tract microbes have not been or cannot be cultured, molecular approaches such as metagenomics, which involves genomic analysis of assemblages of organisms, are needed to study the true diversity and distribution of antimicrobial resistance genes.10 Given the well-documented horizontal transfer of antimicrobial resistance genes among bacteria, these noncultivated organisms may represent an important reservoir for maintenance of antimicrobial resistance genes.

Tetracycline antimicrobials have been used for the treatment and prevention of various diseases in food animals and as growth promoters in swine and cattle.11 Currently, 38 tetracycline resistance gene classes encoding for 3 mechanisms of resistance have been described.12,13 The genes tet(A), tet(B), tet(C), tet(D), tet(E), tet(G), tet(K), and tet(L) are associated with the efflux pump mechanism; the genes tet(M), tet(O), tet(P), tet(Q), and tet(S) are associated with ribosomal protection proteins; and the gene tet(X) encodes a tetracycline inactivating enzyme.12,13 All of these genes have been identified within broad groups of bacteria, including anaerobic and facultative anaerobic bacteria as well as gram-positive and gram-negative bacteria. Acquisition of tetracycline resistance by bacteria occurs mainly as a result of transfer of these genes by mobile genetic elements such as plasmids and transposons.13,14 However, there is limited information regarding the distribution of tetracycline resistance genes in the gastrointestinal tract flora of cattle raised conventionally versus cattle raised without antimicrobials. The purpose of the study reported here was to determine prevalences of 14 tetracycline resistance genes in the fecal flora of conventionally raised feedlot steers and feedlot steers raised without antimicrobials. Prevalence of tetracycline resistance genes was determined by analysis of bacterial community DNA in fecal samples. Our hypotheses were that a higher number of fecal samples from conventionally raised feedlot steers would be positive for tetracycline resistance genes, compared with fecal samples from feedlot steers raised without antimicrobials, and that fecal samples from conventionally raised feedlot steers would have higher numbers of tetracycline resistance genes, compared with fecal samples from feedlot steers raised without antimicrobials. We elected to examine tetracycline resistance in the present study because > 50% of feedlot farms involved in the 1999 National Animal Health Monitoring System survey reported using tetracycline antimicrobials as a health or production management tool.11

Materials and Methods

Farm description—Two groups of beef calves raised at a commercial feedlot in Nebraska were included in the study. Calves in both groups consisted of a mixture of crossbred (predominantly beef breeds) and Holstein steers between 8 and 10 months old. The first group consisted of 327 conventionally raised calves distributed in 3 pens. Mean time in the feedlot was 222 days. Calves in this group received monensin and tylosin in their feed and were treated with antimicrobials when needed, according to standard farm operating procedures. Calves that required antimicrobial treatment because of respiratory tract disease received either tilmicosin or a long-acting oxytetracycline formulation.

The second group consisted of 207 calves distributed in 3 pens that were raised without antimicrobials. Mean time in the feedlot was 229 days. Calves that required antimicrobial treatment because of health issues were removed from the pen and managed according to standard farm operating procedures.

Fecal sample collection—Sixty-one fecal samples were collected from the 3 pens of conventionally raised calves, and an additional 61 fecal samples were collected from the 3 pens of antimicrobial-free calves. Individual fecal samples were collected from the ground. To avoid environmental contamination, each fecal sample was taken from the top and center of a fresh manure pat without contacting soil.

Fecal sample analysis—Total community DNA was extracted from each fecal sample with a commercial kita used in accordance with the manufacture's instructions. Extracted DNA was then frozen at −80°C until analyzed.

The 14 tetracycline resistance genes to be studied were organized into 4 diagnostic groups on the basis of molecular size (Table 1), as previously described,15 to facilitate identification of individual genes with multiplex PCR assays. Multiplex PCR assay procedures were performed as described,15 with the exception that a multiplex PCR assay kitb was used. Each fecal sample was analyzed by performing a multiplex PCR assay for each of the 4 diagnostic groups of tetracycline resistance genes. Briefly, the assay mixture was prepared with 2× multiplex PCR assay master mixb (25 μL/reaction), the primer mix for the diagnostic group being tested (5 μL/reaction), Q solution (5 μL/reaction), and distilled water (17 μL/reaction). Fifty microliters of the mixture was loaded in each well of a 96-well microtitration plate, and DNA (3 μL) extracted from fecal samples was added to individual wells. Control strains for the diagnostic group being tested were included on each plate; 1 well on each plate contained the PCR mixture alone as a negative control reaction.

Table 1—

Diagnostic groupings and mechanism of action for 14 tetracycline resistance genes.

Diagnostic groupResistance geneResistance mechanismPrimer sequence (5′-3′)Amplicon size (bp)
I
tet(B)Efflux pumpTTGGTTAGGGGCAAGTTTGGTAATGGGCCAATAACACCG659
tet(C)Efflux pumpCTTGAGAGCCTTCAACCCAGATGGTCGTCATCTACCTGCC418
tet(D)Efflux pumpAAACCATTACGGCATTCTGCGACCGGATACACCATCCATC787
II
tet(A)Efflux pumpGCTACATAATGCTTGCCTTCCATAGATCGCCGTGAAGAGG210
tet(G)Efflux pumpCAGCTTTCGGATTCTTACGGGATTGGTGAGGCTCGTTAGC844
tet(E)Efflux pumpAAACCACATCCTCCATACGCAAATAGGCCACAACCGTCAG278
III
tet(K)Efflux pumpTCGATAGGAACAGCAGTACAGCAGATCCTACTCCTT169
tet(L)Efflux pumpTCGTTAGCGTGCTGTCATTCGTATCCCACCAATCTAGCCG267
tet(M)Ribosomal protectionCTGCAGAAAGGTACAACGAGCGGTAAAGTTCGTCACACAC406
tet(O)Ribosomal protectionAACTTAGGCATTCTGGCTCACTCCCACTGTTCCATATCGTCA515
tet(S)Ribosomal protectionCATAGACAAGCCGTTGACCATGTTTTTGGAACGCCAGAG667
IV
tet(P)Ribosomal protectionCTTGAGAGCCTTCAACCCAGATATGCCCATTTAACCACGC676
tet(Q.)Ribosomal protectionTTATACTTCCTCCGGCATCGATCGGTTCGAGAATGTCCAC904
tet(X)Inactivating enzymeCAATAATTGGTCGTGGACCCTTCTTACCTTGGACATCCCG468

Thermocycling conditions were as follows: initial denaturation at 95°C for 15 minutes; followed by 31 cycles of denaturation at 94°C for 30 seconds, annealing at 60°C for 90 seconds, and extension at 72°C for 90 seconds; and a final extension at 72°C for 10 minutes. Subsequently, 12 μL of commercial loading bufferc was added to each well on the plate, and 12 μL of each amplification product–loading buffer mixture was transferred to a well in a 2% agarose gel. Three microliters of a 100-bp ladder was added to 3 wells (first, middle, and last) in the agarose gel, and the gel was electrophoresed at 150 V for approximately 1 hour. Results were visualized with a commercial imaging system,d and bands for each fecal sample were compared with bands for control strains in which the gene of interest had been inserted.

Control reference strains containing each tetracycline resistance gene15 were grown on Mueller-Hinton agar to which tetracycline had been added and Luria-Bertani agar to which ampicillin had been added. Single colonies were selected for use as control samples in the PCR assay, and DNA was extracted with a commercial kit.e Extracted DNA from control strains was frozen at −80°C until needed.

Statistical analysis—For each of the 14 tetracycline resistance genes, the C2 test for homology was used to compare proportions of fecal samples with that gene between groups (conventionally raised cattle vs antimicrobial-free cattle). In addition, the C2 test for homology was used to compare proportions of fecal samples with various numbers of tetracycline resistance genes (0, 1 to 2, 3 to 4, 5 to 6, 7 to 8, 9 to 10, and ≥ 11) between groups. Analyses were performed with standard software.f Values of P ≤ 0.05 were considered significant.

Results

For 5 of the 14 tetracycline resistance genes studied, the percentage of samples in which the gene was detected was significantly higher for fecal samples from conventionally raised cattle than for fecal samples from antimicrobial-free cattle (Table 2), and for 1 gene, the percentage of samples in which the gene was detected was significantly higher for fecal samples from antimicrobial-free cattle than for fecal samples from conventionally raised cattle. For 6 genes, no significant differences in prevalence were identified between groups. The remaining 2 genes (tet[B] and tet[K]) were not detected in any of the fecal samples.

Table 2—

Distribution of tetracycline resistance genes in fecal samples (n = 61/group) from conventionally raised feedlot steers and feedlot steers raised without antimicrobials.

Resistance geneNo. (%) of samples with geneP value
Conventionally raised cattleAntimicrobial-free cattle
tet(A)56 (92)41 (67)≤ 0.001
tet(E)46 (75)22 (36)≤ 0.001
tet(G)45 (74)21 (34)≤ 0.001
tet(L)49 (80)36 (59)≤ 0.017
tet(P)41 (67)13 (21)≤ 0.001
tet(C)57 (93)58 (95)1.000
tet(D)55 (90)51 (84)0.422
tet(M)61 (100)60 (98)1.000
tet(O)61 (100)60 (98)1.000
tet(S)61 (100)61 (100)1.000
tet(X)42 (69)38 (62)0.568
tet(Q)46 (75)58 (95)≤ 0.004
tet(B)0 (0)0 (0)1.000
tet(K)0 (0)0 (0)1.000

A minimum of 5 tetracycline resistance genes were detected in fecal samples from the conventionally raised cattle, and a minimum of 3 tetracycline resistance genes were detected in fecal samples from the antimicrobial-free cattle (Table 3). The percentage of samples with ≥ 11 tetracycline resistance genes was significantly higher for fecal samples from conventionally raised cattle than for fecal samples from antimicrobial-free cattle.

Table 3—

Numbers of tetracycline resistance genes found in fecal samples (n = 61/group) from conventionally raised feedlot steers and feedlot steers raised without antimicrobials.

GroupNo. of resistance genes per sample
01 to 23 to 45 to 67 to 89 to 10≥11
Conventionally raised cattle0 (0)0 (0)0 (0)4 (7)10 (16)12 (20)35 (57)*
Antimicrobial-free cattle0 (0)0 (0)1 (2)11 (18)21 (34)12 (20)16 (26)

Data are given as number (%) of fecal samples with the indicated number of tetracycline resistance genes; fecal samples were tested for Htetracycline resistance genes.

* Significantly (P < 0.05) higher than percentage of fecal samples from antimicrobial-free cattle.

Discussion

Results of the present study suggested that the prevalence of tetracycline resistance genes was significantly higher in the fecal flora of conventionally raised feedlot steers than in the fecal flora of feedlot steers raised without antimicrobials. Specifically, although 1 tetracycline resistance gene was more common in fecal samples from antimicrobial-free cattle than in fecal samples from conventionally raised cattle, 5 other genes were more common in fecal samples from the conventionally raised cattle. In addition, the percentage of samples with ≥ 11 tetracycline resistance genes was significantly higher for fecal samples from conventionally raised cattle than for fecal samples from antimicrobial-free cattle.

In the present study, we used a metagenomic approach to identify tetracycline resistance genes in the fecal flora of cattle included in the study. Thus, our findings represent results not only for cultivable bacteria in the fecal samples but also for uncultivable and unknown organisms. To our knowledge, this was the first time a metagenomic approach involving analysis of total fecal community DNA was used to determine the antimicrobial resistance potential of the fecal flora of feedlot calves. Our results were similar to results of previous studies6–8,16,17 of tetracycline resistance in specific bacteria cultivated from fecal samples from conventionally raised and antimicrobial-free animals. In 2 studies,6,7 for instance, higher proportions of Campylobacter and Escherichia coli isolates from dairy cattle managed conventionally were resistant to tetracycline, compared with isolates from cattle raised organically. In other studies,8,16 85.1% and 83.4% of commensal E coli and Campylobacter isolates from conventionally raised swine with frequent antimicrobial exposure were resistant to tetracycline, compared with 62% and 56.2% of E coli and Campylobacter isolates from pigs raised in antimicrobial-free production systems. Finally, Bryan et al17 found that E coli isolates from animals continuously exposed to antimicrobials such as tetracycline were more likely to be resistant to tetracycline and that those isolates had higher numbers of tetracycline resistance genes.

We believe that our finding in the present study that the percentage of fecal samples with ≥ 11 tetracycline resistance genes was significantly higher for conventionally raised than for antimicrobial-free cattle was particularly important because a more diverse pool of tetracycline resistance genes within individual animals could result in a greater likelihood that bacteria would resist treatment with tetracycline, which could increase the health risk for the animals themselves and for any humans exposed to bacteria coming from those animals. Importantly, all 14 tetracycline resistance genes examined in the present study have frequently been associated with plasmids, transposons, and conjugative transposons,12–14 which has allowed these genes to spread in gram-negative and gram-positive bacteria. Chopra and Roberts12 concluded that because of the mobility of theses genes, there has been an increase in the number of bacterial species and genera that have acquired tetracycline resistance since the 1950s, which has led to a reduction in the efficacy of tetracycline for many diseases. A higher number of tetracycline resistance genes in individual animals could mean that there would be more ways for tetracycline resistance to spread among bacteria.

The higher prevalence of tetracycline resistance in the fecal flora of conventionally raised cattle could mean that these cattle pose a greater risk of transmitting tetracycline-resistant bacteria to humans as a result of environmental contamination, direct transfer to individuals working with cattle, and contamination of food products. Contamination of food products with antimicrobial-resistant bacteria containing mobile resistance genes is a potential public health problem because of the possibility that antimicrobial resistance genes would be transmitted to human bacterial pathogens. Several studies18–24 have already revealed that tetracycline resistance genes can frequently be found in common intestinal bacteria, such as E coli, Enterococcus faecalis, Enterococcus faecium, Lactobacillus spp, and Bifidobacterium spp, isolated from animals and from food products of animal origin, such as meat, meat products, poultry, pork, and dairy products. In addition, some authors have demonstrated that several tetracycline resistance genes found in food products can be transferred to other bacteria of the same18,20,22 or different19 species.

An important limitation of the present study was that fecal samples were obtained from cattle at a single feedlot, making it impossible to know whether our results can be generalized to other feedlots. However, findings from the present study will assist in the design of future studies to test on a larger scale for associations between antimicrobial resistance and antimicrobial use policies on farms. In addition, because we used a qualitative PCR assay in the present study, we were only able to determine whether particular tetracycline resistance genes were present or absent in the fecal samples and could not quantify the concentration of individual genes that were identified. Thus, although conventionally raised cattle had more samples with resistance genes and a higher number of resistance genes within individual samples, it is possible that antimicrobial-free cattle had higher numbers of copies of specific resistance genes. Finally, even though various resistance genes were detected with the multiplex PCR assay used in the present study, we could not determine whether those genes were functional or had been expressed. Therefore, it is possible that bacteria with the resistant phenotype would not be isolated from these animals.

Importantly, we do not know why all of the fecal samples from antimicrobial-free cattle in the present study had at least 1 tetracycline resistance gene, with 16 of the 61 (26%) fecal samples having ≥ 11 resistance genes. It is possible that because antimicrobial-free cattle were sharing the same food and water sources as conventionally raised cattle and that management procedures were the same for the 2 groups, there was some transmission of bacteria carrying tetracycline resistance genes among animals on the farm. Alternatively, it is possible that these calves had been exposed to antimicrobials prior to their arrival at the study feedlot and that bacteria had developed resistance to tetracycline as a result.

Finally, in the present study, we only tested for a subset of all of the tetracycline resistance genes that have been identified. Therefore, the implications of our findings for human health are uncertain. Nevertheless, tetracycline resistance genes are often associated with other antimicrobial resistance genes, which may result in coselection as a result of genetic linkage. Furthermore, by evaluating tetracycline resistance, we have been able to establish that metagenomic approaches may be valuable in understanding the epidemiology of antimicrobial resistance in food animals.

a.

QIAamp DNA Stool Mini Kit, Qiagen, Valencia, Calif.

b.

Multiplex PCR kit, Qiagen, Valencia, Calif.

c.

10X Blue Juice loading buffer, Invitrogen, Carlsbad, Calif.

d.

Kodak 1D 3.6 Imaging System, Eastman Kodak Co, Rochester, NY.

e.

DNeasy Tissue Kit, Qiagen, Valencia, Calif.

f.

STATA, version 9.2, StataCorp, College Station, Tex.

References

  • 1.

    Holmberg SD, Osterholm MT, Senger KA, et al. Drug-resistant Salmonella from animals fed antimicrobials. N Engl J Med 1984;311:617622.

  • 2.

    Kelly L, Smith DL, Snary EL, et al. Animal growth promoters: to ban or not to ban? A risk assessment approach. Int J Antimicrob Agents 2004;24:714.

    • Search Google Scholar
    • Export Citation
  • 3.

    McDermott PF, Zhao S, Wagner DD, et al. The food safety perspective antibiotic resistance. Anim Biotechnol 2002;13:7184.

  • 4.

    Gebreyes WA, Thakur S, Morgan WE. Comparison of prevalence, antimicrobial resistance, and occurrence of multidrug-resistant Salmonella in antimicrobial-free and conventional pig production. J Food Prot 2006;69:743748.

    • Search Google Scholar
    • Export Citation
  • 5.

    Cui S, Ge B, Zheng J, et al. Prevalence and antimicrobial resistance of Campylobacter spp and Salmonella serovars in organic chickens from Maryland retail stores. Appl Environ Microbiol 2005;71:41084111.

    • Search Google Scholar
    • Export Citation
  • 6.

    Sato K, Bartlett PC, Saeed MA. Antimicrobial susceptibility of Escherichia coli isolates from dairy farms using organic versus conventional production methods. J Am Vet Med Assoc 2005;226:589594.

    • Search Google Scholar
    • Export Citation
  • 7.

    Halbert LW, Kaneene JB, Ruegg PL, et al. Evaluation of antimicrobial susceptibility patterns in Campylobacter spp isolated from dairy cattle and farms managed organically and conventionally in the midwestern and northeastern United States. J Am Vet Med Assoc 2006;228:10741081.

    • Search Google Scholar
    • Export Citation
  • 8.

    Thakur S, Gebreyes WA. Prevalence and antimicrobial resistance of Campylobacter in antimicrobial-free and conventional pig production systems. J Food Prot 2005;68:24022410.

    • Search Google Scholar
    • Export Citation
  • 9.

    Gill S, Pop M, DeBoy R, et al. Metagenomic analysis of the human distal gut microbiome. Science 2006;312:13551359.

  • 10.

    Handelsman J. Metagenomics: application of genomics to uncultured microorganisms. Microbiol Mol Biol Rev 2004;68:669685.

  • 11.

    Part III. Health management and biosecurity in US feedlots, 1999. In: National Animal Health Monitoring System. Fort Collins, Colo: USDA, APHIS, Veterinary Services, Centers for Epidemiology and Animal Health, 2000.

    • Search Google Scholar
    • Export Citation
  • 12.

    Chopra I, Roberts M. Tetracycline antibiotics: mode of action, applications, molecular biology, and epidemiology of bacterial resistance. Microbiol Mol Biol Rev 2001;65:232260.

    • Search Google Scholar
    • Export Citation
  • 13.

    Roberts M. Update on acquired tetracycline resistance genes. FEMS Microbiol Lett 2005;245:195203.

  • 14.

    Roberts MC. Tetracycline resistance determinants: mechanisms of action, regulation of expression, genetic mobility, and distribution. FEMS Microbiol Rev 1996;19:124.

    • Search Google Scholar
    • Export Citation
  • 15.

    Ng LK, Martin I, Alfa M, et al. Multiplex PCR for the detection of tetracycline resistance genes. Mol Cell Probes 2001;15:209215.

  • 16.

    Blake DP, Humphry RW, Scott KP, et al. Influence of tetracycline exposure on tetracycline resistance and the carriage of tetracycline resistance genes within commensal Escherichia coli populations. J Appl Microbiol 2003;94:10871097.

    • Search Google Scholar
    • Export Citation
  • 17.

    Bryan A, Shapir N, Sadowsky M. Frequency and distribution of tetracycline resistance genes in genetically diverse, nonselected, and nonclinical Escherichia coli strains isolated from diverse human and animal sources. Appl Environ Microbiol 2004;70:25032507.

    • Search Google Scholar
    • Export Citation
  • 18.

    Sunde M, Norstrom M. The prevalence of, associations between and conjugal transfer of antibiotic resistance genes in Escherichia coli isolated from Norwegian meat and meat products. J Antimicrob Chemother 2006;58:741747.

    • Search Google Scholar
    • Export Citation
  • 19.

    Gevers D, Huys G, Swings J. In vitro conjugal transfer of tetracycline resistance from Lactobacillus isolates to other Gram-positive bacteria. FEMS Microbiol Lett 2003;225:125130.

    • Search Google Scholar
    • Export Citation
  • 20.

    Wilcks A, Andersen S, Licht T. Characterization of transferable tetracycline resistance genes in Enterococcus faecalis isolated from raw food. FEMS Microbiol Lett 2005;243:1519.

    • Search Google Scholar
    • Export Citation
  • 21.

    Hummel A, Holzapfel W, Franz C. Characterisation and transfer of antibiotic resistance genes from enterococci isolated from food. Syst Appl Microbiol 2007;30:17.

    • Search Google Scholar
    • Export Citation
  • 22.

    Huys G, D'Haene K, Collard J, et al. Prevalence and molecular characterization of tetracycline resistance in Enterococcus isolates from food. Appl Environ Microbiol 2004;70:15551562.

    • Search Google Scholar
    • Export Citation
  • 23.

    Aquilanti L, Garofalo C, Osimani A, et al. Isolation and molecular characterization of antibiotic-resistant lactic acid bacteria from poultry and swine meat products. J Food Prot 2007;70:557565.

    • Search Google Scholar
    • Export Citation
  • 24.

    Mayrhofer S, Domig K, Amtmann E, et al. Antibiotic susceptibility of Bifidobacterium thermophilum and Bifidobacterium pseudolongum isolates from animal sources. J Food Prot 2007;70:119124.

    • Search Google Scholar
    • Export Citation

Contributor Notes

Address correspondence to Dr. Hoet.