Mammalian melanocytes express differentiation antigens, such as tyrosinase, Melan-A (also known as MART-1), and the product of the SILV gene (known as gp100 and gp87 in humans and mice, respectively). These are all proteins or glycoproteins involved in melanin biosynthesis. Strong expression of these differentiation antigens in normal tissues is restricted to pigmented skin, mucosa, uvea, iris, and retinal epithelium.1 Tyrosinase, Melan-A, and the product of the SILV gene have been widely studied in many species because of their roles in melanin synthesis and pigmentation disorders. Melanomas in humans, mice, and dogs also express these gene products, which are referred to as MAAs. The MAAs contain potentially immunogenic epitopes and have been identified as possible targets for immunotherapy of melanoma in humans2–4 and dogs.5–8 Their restricted expression in normal tissues makes them attractive targets for immunotherapy, and although immune-mediated vitiligo is a potential adverse effect, it is a cosmetic problem and not a life-threatening condition. Because the eyes are an immunoprivileged site, there are unlikely to be ocular problems after immunotherapy targeting MAAs.
Tyrosinase is an enzyme that controls the first 2 rate-limiting steps in melanin synthesis.9,10 The product of the SILV gene (ie, gp100 in humans) forms a fibrillar meshwork in melanosomes on which melanin synthesis subsequently takes place. The exact function of Melan-A is not known, but it can form a complex with gp100 in human melanocytes and appears to be involved in the expression, stability, and trafficking of gp100 and its processing into cleaved fragments, which form the basis of the fibrillar meshwork.11
In preliminary studiesa,b of MAA mRNA expression in melanomas of dogs by use of reverse transcription PCR assays, alternative transcripts were identified. Additional variants were discovered when developing DNA vaccine constructs containing canine MAA coding sequences. The purpose of the study reported here was to characterize these MAA variants.
Materials and Methods
Animals—Nine dogs with suspected malignant melanoma undergoing resection of the primary mass were recruited for the study. Dogs underwent surgery at general veterinary practices and referral centers in the United Kingdom between 2000 and 2005. Tissue samples were obtained from 7 healthy control dogs within 4 hours after the dogs were euthanatized. The control dogs were strays from a local rescue center or were client-owned dogs from a local veterinary practice. Signed, informed consent was obtained from all owners for use of tissues for research purposes.
Collection of samples—Samples were obtained from melanomas of each of the 9 dogs (MM01 to MM09, respectively). Pigmented oral mucocutaneous tissue samples were collected from the 7 healthy control dogs. Tissue samples were placed in RNA stabilization bufferc and stored at −20°C. Archived formalin-fixed paraffin-embedded tissues from 9 additional dogs with poorly pigmented melanomas were also used, and an EDTA-anticoagulated canine blood sample (surplus from the Royal Veterinary College Clinical Pathology Service) was included as another control sample. Histologic examination was performed on all tumors by a single board-certified veterinary pathologist (TJS).
MAA gene analysis—The DNA sequences were accessed from a dog genome Web sited and a nucleotide sequence database.e A canine SNP databasef was used to identify SNPs within canine MAA genes. A signal peptide prediction toolg was used to identify signal peptides in canine MAA coding sequences. Protein domains for MAA were predicted by use of a protein architecture modeling database.h
Primer design—Primersi designed to amplify partial sequences for human Melan-A and gp100 that cross-react with their canine orthologs were initially used for PCR assays (Melan-A Hs and SILV Hs, respectively; Appendix).12–14 Primers also were designed to amplify full-length canine MAA coding sequences by use of sequences predicted from the dog genome assembly (Melan-A FL, SILV FL, and tyrosinase FL). These primers had modifications for downstream applications for the development of DNA vaccine constructs (a Kozak sequence at the 5′ end of the sense primer to promote protein translation, a polyhistidine-coding region in the antisense primer to allow protein detection and purification in vitro, and an XbaI restriction enzyme site at the 3′ end of the antisense primer to allow directional subcloning into a vaccine vector). Additional tyrosinase and SILV primers were designed to amplify the mature protein coding sequence (ie, lacking the signal peptide; tyrosinase MP and SILV MP, respectively). All primers spanned an exon boundary. Following the discovery of an insertion mutation in the SILV gene of 1 poorly pigmented melanoma, additional primers were designed in the canine SILV gene sequence that flanked this insertion mutation (SILV SINE insertion pairs 1 and 2).
MAA mRNA expression and sequence analysis—Tissues were homogenizedj in cell lysis buffer.k The RNA was isolated with a commercial kit,l which incorporated an on-column DNase digestion stepm to remove contaminant genomic DNA. The cDNA was synthesized by use of reverse transcriptasen in parallel with a control sample that was not reverse transcribed. Genomic DNA was extracted from canine EDTA-anticoagulated blood and paraffin-embedded melanoma biopsy samples by use of commercial kits.o,p
The PCR assaysq were performed in 25-μL volumes in a thermocycler.r The protocol was 95°C for 10 minutes followed by 20 to 30 cycles at 94°C for 40 seconds, 55° to 60°C for 30 seconds, and 72°C for 1 to 2 minutes, which was followed by a final extension step at 72°C for 7 to 10 minutes. The PCR products were separated by horizontal gel electrophoresis on 2% agarose gels containing 0.5 μg of ethidium bromides/mL, and DNA was examined under UV light.t For cloning purposes, a proofreading DNA polymeraseu was used for PCR assays. Purified PCR products were cloned in Escherichia coli,v and plasmid DNAw prepared from recombinant clones was sequenced.x
Results
Histologic examination of tumor tissues was reviewed by 1 investigator (TJS) for all tumors, except for 3 tumors (MM03, MM06, and MM09) used in reverse transcription PCR assays for which tissue blocks were unavailable. However, in each of these tumors, the original diagnosis was supported on the basis of the historical description in the clinical records of grossly pigmented tumors (in the oral cavity in 2 dogs and in the nail bed of the third dog) and the original histopathologic reports that described pleomorphic pigmented tumor cells containing melanin granules.
During investigation of MAA mRNA expression in melanomas, the anticipated PCR products were detected; however, other amplicons were also observed. Use of Melan-A Hs primers resulted in 2 amplicons, 1 of the expected size (264 bp) and a smaller band of approximately 150 bp (Figure 1). The smaller band was cloned, and plasmid DNA from 2 recombinant E coli clones containing PCR products from MM01 or MM06 was sequenced. Both clones had identical nucleotide sequences; when compared with the Melan-A coding sequence identified from the dog genome assembly, the smaller amplicon was identified as a splice variant with exon 4 deleted.
Results of PCR assays performed with the primers Melan-A Hs (A), Melan-A FL (B), SILV Hs (C), and tyrosinase MP (D). The cDNA prepared from biopsy specimens of melanomas obtained from 9 dogs (MM01 to MM09, respectively) was used as a template for the PCR assays. Expected product size of amplicons was 264 bp for Melan-A Hs, 388 bp for Melan-A FL, 421 bp for SILV Hs, and 1,567 bp for tyrosinase MP. In panels A and C, standard polymerase was used, whereas panels ≤ and D depict representative PCR amplicons generated from tumor cDNA by use of a proofreading polymerase. Additional lanes include a molecular weight ladder (lane L), water as a negative control template (lane –), and a plasmid DNA containing the corresponding MAA full-length coding sequence as a positive control sample (lane +). In addition to the product of the expected size, additional amplicons (splice variants [sv]) were amplified from melanoma cDNA.
Citation: American Journal of Veterinary Research 70, 12; 10.2460/ajvr.70.12.1512
Results of PCR assays performed with the primers Melan-A Hs (A), Melan-A FL (B), SILV Hs (C), and tyrosinase MP (D). The cDNA prepared from biopsy specimens of melanomas obtained from 9 dogs (MM01 to MM09, respectively) was used as a template for the PCR assays. Expected product size of amplicons was 264 bp for Melan-A Hs, 388 bp for Melan-A FL, 421 bp for SILV Hs, and 1,567 bp for tyrosinase MP. In panels A and C, standard polymerase was used, whereas panels ≤ and D depict representative PCR amplicons generated from tumor cDNA by use of a proofreading polymerase. Additional lanes include a molecular weight ladder (lane L), water as a negative control template (lane –), and a plasmid DNA containing the corresponding MAA full-length coding sequence as a positive control sample (lane +). In addition to the product of the expected size, additional amplicons (splice variants [sv]) were amplified from melanoma cDNA.
Citation: American Journal of Veterinary Research 70, 12; 10.2460/ajvr.70.12.1512
Results of PCR assays performed with the primers Melan-A Hs (A), Melan-A FL (B), SILV Hs (C), and tyrosinase MP (D). The cDNA prepared from biopsy specimens of melanomas obtained from 9 dogs (MM01 to MM09, respectively) was used as a template for the PCR assays. Expected product size of amplicons was 264 bp for Melan-A Hs, 388 bp for Melan-A FL, 421 bp for SILV Hs, and 1,567 bp for tyrosinase MP. In panels A and C, standard polymerase was used, whereas panels ≤ and D depict representative PCR amplicons generated from tumor cDNA by use of a proofreading polymerase. Additional lanes include a molecular weight ladder (lane L), water as a negative control template (lane –), and a plasmid DNA containing the corresponding MAA full-length coding sequence as a positive control sample (lane +). In addition to the product of the expected size, additional amplicons (splice variants [sv]) were amplified from melanoma cDNA.
Citation: American Journal of Veterinary Research 70, 12; 10.2460/ajvr.70.12.1512
Primers designed to amplify the full-length Melan-A coding sequence generated 3 PCR amplicons (Figure 1). The largest band (388 bp) corresponded to the expected full-length coding sequence, and the middle band corresponded to the exon 4 deletion splice variant (271 bp). The smallest unidentified band was cloned, and plasmid DNA from 2 recombinant clones from 2 tumors (MM01 and MM03) was sequenced. This revealed that the small amplicon was a splice variant with exons 3 and 4 deleted (Figure 2).
Schematic diagram of Melan-A, SILV, and tyrosinase coding sequences and their splice variants detected in melanomas of dogs. Forward (F) and reverse (R) primer binding sites are indicated (arrowheads). The human Melan-A gene consists of 5 exons, with a short 5′ untranslated region in exon 1. The equivalent canine exon could not be located from evaluation of the dog genome. The SILV and tyrosinase full-length coding sequences contain a leader sequence encoding a signal peptide (SP). The deleted exons (or in the case of tyrosinase, the deleted part of exon 1) are indicated (diagonal stripes). Numbers above each bar represent nucleotide positions at which splicing occurs.
Citation: American Journal of Veterinary Research 70, 12; 10.2460/ajvr.70.12.1512
Schematic diagram of Melan-A, SILV, and tyrosinase coding sequences and their splice variants detected in melanomas of dogs. Forward (F) and reverse (R) primer binding sites are indicated (arrowheads). The human Melan-A gene consists of 5 exons, with a short 5′ untranslated region in exon 1. The equivalent canine exon could not be located from evaluation of the dog genome. The SILV and tyrosinase full-length coding sequences contain a leader sequence encoding a signal peptide (SP). The deleted exons (or in the case of tyrosinase, the deleted part of exon 1) are indicated (diagonal stripes). Numbers above each bar represent nucleotide positions at which splicing occurs.
Citation: American Journal of Veterinary Research 70, 12; 10.2460/ajvr.70.12.1512
Schematic diagram of Melan-A, SILV, and tyrosinase coding sequences and their splice variants detected in melanomas of dogs. Forward (F) and reverse (R) primer binding sites are indicated (arrowheads). The human Melan-A gene consists of 5 exons, with a short 5′ untranslated region in exon 1. The equivalent canine exon could not be located from evaluation of the dog genome. The SILV and tyrosinase full-length coding sequences contain a leader sequence encoding a signal peptide (SP). The deleted exons (or in the case of tyrosinase, the deleted part of exon 1) are indicated (diagonal stripes). Numbers above each bar represent nucleotide positions at which splicing occurs.
Citation: American Journal of Veterinary Research 70, 12; 10.2460/ajvr.70.12.1512
Similarly, when SILV Hs primers were used, 2 PCR products were generated: 1 as expected (421 bp), and a smaller amplicon of approximately 260 bp (Figure 1), which was cloned and sequenced. Sequence data generated from plasmid DNA from 2 clones from 2 tumors (MM01 and MM02) were compared with that for the published partial sequence15 and the SILV coding sequence identified from the dog genome assembly. This revealed that the smaller amplicon was a splice variant with exon 5 deleted (Figure 2). By use of primers to amplify the full length canine SILV coding sequence, no further splice variants were detected (data not shown).
A splice variant was detected when primers designed to amplify the mature tyrosinase protein coding sequence were used (Figure 1). The smaller band (approx 1,100 bp) was cloned and sequenced (plasmid DNA from 2 clones from melanomas MM05 and MM03), which revealed it was a splice variant with the latter part of exon 1 deleted (nucleotides 355 to 819, inclusive), with an alternative splice site at nucleotide 354, codon 118 (Figure 2).
Biopsy specimens from healthy pigmented oral tissue were screened for the splice variants identified in the melanomas. The Melan-A and SILV splice variants were expressed in healthy pigmented tissues (data not shown); thus, they were not unique to tumor tissue. The tyrosinase partial exon 1 deletion splice variant was not detected in healthy pigmented tissue (Figure 3).
Results for PCR assays performed by use of tyrosinase MP primers. The cDNA prepared from pigmented oral mucocutaneous tissue obtained from 4 healthy dogs (lanes 1 through 4, respectively) and from a melanoma (lane MM03) was used as the template for the PCR assay. Notice the lack of the tyrosinase partial exon 1 deletion splice variant in healthy pigmented tissues. See Figure 1 for remainder of key.
Citation: American Journal of Veterinary Research 70, 12; 10.2460/ajvr.70.12.1512
Results for PCR assays performed by use of tyrosinase MP primers. The cDNA prepared from pigmented oral mucocutaneous tissue obtained from 4 healthy dogs (lanes 1 through 4, respectively) and from a melanoma (lane MM03) was used as the template for the PCR assay. Notice the lack of the tyrosinase partial exon 1 deletion splice variant in healthy pigmented tissues. See Figure 1 for remainder of key.
Citation: American Journal of Veterinary Research 70, 12; 10.2460/ajvr.70.12.1512
Results for PCR assays performed by use of tyrosinase MP primers. The cDNA prepared from pigmented oral mucocutaneous tissue obtained from 4 healthy dogs (lanes 1 through 4, respectively) and from a melanoma (lane MM03) was used as the template for the PCR assay. Notice the lack of the tyrosinase partial exon 1 deletion splice variant in healthy pigmented tissues. See Figure 1 for remainder of key.
Citation: American Journal of Veterinary Research 70, 12; 10.2460/ajvr.70.12.1512
Primers designed to amplify the mature SILV protein coding sequence yielded a larger amplicon than expected from MM04 cDNA. When this was sequenced, a 156-bp insertion mutation was detected. Genomic DNA was also isolated from the MM04 biopsy specimen and used as the template for a PCR assay with SILV-specific primers flanking the insertion (SILV SINE insertion pair 1). Anomalous PCR amplicons were detected in cDNA and genomic DNA from MM04 (Figure 4).
Results of PCR assays performed by use of primers designed in exon 10 and exon 11 of the SILV gene that flanked the insertion mutation (SILV SINE insertion pair 1) on biopsy specimens obtained from malignant melanomas of dogs. Lanes were as follows: 1, cDNA from malignant melanoma MM07, with no insertion mutation (expected product size, 154 bp); 2, cDNA from MM04, which yielded a larger amplicon (approx 300 bp); 3, genomic DNA extracted from a blood sample obtained from a healthy control dog (expected product size, 792 bp); and 4, genomic DNA from MM04 that had 2 bands (a band of the expected size [792 bp] and a larger band [approx 1,000 bp]). The PCR amplicons reveal an insertion mutation in the SILV gene in malignant melanoma MM04. See Figure 1 for remainder of key.
Citation: American Journal of Veterinary Research 70, 12; 10.2460/ajvr.70.12.1512
Results of PCR assays performed by use of primers designed in exon 10 and exon 11 of the SILV gene that flanked the insertion mutation (SILV SINE insertion pair 1) on biopsy specimens obtained from malignant melanomas of dogs. Lanes were as follows: 1, cDNA from malignant melanoma MM07, with no insertion mutation (expected product size, 154 bp); 2, cDNA from MM04, which yielded a larger amplicon (approx 300 bp); 3, genomic DNA extracted from a blood sample obtained from a healthy control dog (expected product size, 792 bp); and 4, genomic DNA from MM04 that had 2 bands (a band of the expected size [792 bp] and a larger band [approx 1,000 bp]). The PCR amplicons reveal an insertion mutation in the SILV gene in malignant melanoma MM04. See Figure 1 for remainder of key.
Citation: American Journal of Veterinary Research 70, 12; 10.2460/ajvr.70.12.1512
Results of PCR assays performed by use of primers designed in exon 10 and exon 11 of the SILV gene that flanked the insertion mutation (SILV SINE insertion pair 1) on biopsy specimens obtained from malignant melanomas of dogs. Lanes were as follows: 1, cDNA from malignant melanoma MM07, with no insertion mutation (expected product size, 154 bp); 2, cDNA from MM04, which yielded a larger amplicon (approx 300 bp); 3, genomic DNA extracted from a blood sample obtained from a healthy control dog (expected product size, 792 bp); and 4, genomic DNA from MM04 that had 2 bands (a band of the expected size [792 bp] and a larger band [approx 1,000 bp]). The PCR amplicons reveal an insertion mutation in the SILV gene in malignant melanoma MM04. See Figure 1 for remainder of key.
Citation: American Journal of Veterinary Research 70, 12; 10.2460/ajvr.70.12.1512
Cloning and sequencing of the larger amplicon from the tumor genomic DNA yielded a product of 1,034 bp from 1 clone and 1,036 bp from another clone (because of 2 extra T nucleotides in the latter). The sequences contained an insertion mutation of 242 to 244 bp at the intron 10–exon 11 boundary. This consisted of a SINE in reverse complement, with a direct repeat of 15 nucleotides flanking the SINE. All the characteristic features of a SINE were evident,16 including a poly-A region at 1 end, multiple CT repeats, and the potential RNA polymerase III transcriptional control regions (A box and ≤ box; Figure 5).
The SINE insertion mutation in the canine SILV gene of malignant melanoma MM04. A—Plasmid DNA from 2 clones was sequenced. The partial canine SILV sequence generated contained an insertion mutation (red type). The 3′ end of exon 10 and 5′ end of exon 11 (black type) and intron 10 (blue type) are indicated. The insertion mutation consisted of a SINE (yellow shading) and nucleotides that constituted part of the direct nucleotide repeats, which flanked the SINE (bold type). Only part of the insertion mutation was detected in cDNA. Notice the typical 5′ splice donor site (black arrow) and alternative 3′ splice acceptor site (red arrow) as well as the PCR primer binding sites (SILV SINE insertion forward primer 1 [black underline] and SILV SINE insertion forward primer 2 [blue underline]). The reverse primer is the same for both clones. B—The SINE insertion is depicted in the sense orientation, which reveals the characteristic features of potential RNA polymerase III binding sites (A and ≤ boxes), multiple CT repeats, and a poly-A region.
Citation: American Journal of Veterinary Research 70, 12; 10.2460/ajvr.70.12.1512
The SINE insertion mutation in the canine SILV gene of malignant melanoma MM04. A—Plasmid DNA from 2 clones was sequenced. The partial canine SILV sequence generated contained an insertion mutation (red type). The 3′ end of exon 10 and 5′ end of exon 11 (black type) and intron 10 (blue type) are indicated. The insertion mutation consisted of a SINE (yellow shading) and nucleotides that constituted part of the direct nucleotide repeats, which flanked the SINE (bold type). Only part of the insertion mutation was detected in cDNA. Notice the typical 5′ splice donor site (black arrow) and alternative 3′ splice acceptor site (red arrow) as well as the PCR primer binding sites (SILV SINE insertion forward primer 1 [black underline] and SILV SINE insertion forward primer 2 [blue underline]). The reverse primer is the same for both clones. B—The SINE insertion is depicted in the sense orientation, which reveals the characteristic features of potential RNA polymerase III binding sites (A and ≤ boxes), multiple CT repeats, and a poly-A region.
Citation: American Journal of Veterinary Research 70, 12; 10.2460/ajvr.70.12.1512
The SINE insertion mutation in the canine SILV gene of malignant melanoma MM04. A—Plasmid DNA from 2 clones was sequenced. The partial canine SILV sequence generated contained an insertion mutation (red type). The 3′ end of exon 10 and 5′ end of exon 11 (black type) and intron 10 (blue type) are indicated. The insertion mutation consisted of a SINE (yellow shading) and nucleotides that constituted part of the direct nucleotide repeats, which flanked the SINE (bold type). Only part of the insertion mutation was detected in cDNA. Notice the typical 5′ splice donor site (black arrow) and alternative 3′ splice acceptor site (red arrow) as well as the PCR primer binding sites (SILV SINE insertion forward primer 1 [black underline] and SILV SINE insertion forward primer 2 [blue underline]). The reverse primer is the same for both clones. B—The SINE insertion is depicted in the sense orientation, which reveals the characteristic features of potential RNA polymerase III binding sites (A and ≤ boxes), multiple CT repeats, and a poly-A region.
Citation: American Journal of Veterinary Research 70, 12; 10.2460/ajvr.70.12.1512
It was considered feasible that an insertion mutation in the SILV gene could disrupt melanin synthesis, which would lead to poor pigmentation (as was observed in MM04) or even complete amelanosis of a melanoma. Genomic DNA isolated from 8 additional poorly pigmented melanomas was screened with PCR assays for the insertion mutation by use of primers SILV SINE insertion pair 2. A PCR amplicon of 242 bp, which was similar to that from the control blood sample, was generated from all 8 tumors, with no evidence of a SINE insertion (data not shown).
To verify sequences for canine MAAs and generate potential DNA vaccine constructs, primers were designed to amplify full-length or mature protein coding regions. Sequence data generated from plasmid DNA containing canine tyrosinase were analyzed from 24 clones to identify polymorphisms in the canine tyrosinase coding sequence. Six novel SNPs were identified, in addition to the 3 SNPs that had been published in the canine SNP databasef (Table 1). Three of the novel SNPs were synonymous, and 3 caused amino acid changes. The SNPs reported at nucleotides 972 and 1,312 in the canine SNP database were not observed, but the A/T synonymous SNP at position 780 was confirmed. A possible alternative allele (G) was also identified at this location in a single clone.
Exonic SNPs in the canine tyrosinase gene determined from various sources and from PCR assay of malignant melanomas obtained from dogs.
| Nt | Cons | Gen | Pub | SNP db | MM01 clones | MM03 PCR 1 clones | MM03 PCR 2 clones | MM05 PCR 1 clones | MM05 PCR 2 clones | MM05 PCR 3 clones | MM07 clones | Amino acid change | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 1 | 2 | 3 | 1 | 2 | 3 | 1 | 2 | 1 | 2 | 3 | 1 | 2 | 1 | 2 | 3 | 1 | 2 | 3 | ||||||
| 175* | G | G | A* | — | G | G | G | G | G | G | G | G | G | G | G | G | G | G | G | G | A* | A* | A* | Ile 59 Val |
| 178* | C | C | C | — | C | C | C | C | C | C | C | C | T* | C | C | T* | C | C | T* | C | C | C | C | Synonymous |
| 287* | T | T | T | — | T | T | T | C* | T | T | T | T | T | T | T | T | T | T | T | C* | T | T | T | Thr 96 Met |
| 780* | T | T | A | A/T | T | T | T | T | T | T | T | T | T | T | T | T | T | T | T | T | G* | A | A | Synonymous |
| 882* | G | G | A* | — | G | G | G | G | A* | A* | A* | A* | A* | G | G | A* | G | G | A* | G | G | G | G | Synonymous |
| 972 | G | G | G | G/A | G | G | G | G | G | G | G | G | G | G | G | G | G | G | G | G | G | G | G | Synonymous |
| 1,312 | T | T | C | C/T | T | T | T | T | T | T | T | T | T | T | T | T | T | T | T | T | T | T | T | Leu 438 Phe |
| 1,470* | T | T | T | — | T | T | T | T | T | C* | T | T | T | C* | T | T | T | T | T | T | T | T | T | Synonymous |
| 1,564* | C | C | C | — | C | C | C | C | C | C | G* | G* | C | C | G* | C | G* | C | C | C | C | C | C | Asp 522 His |
Malignant melanomas are designated for each dog (MM01, MM03, MM05, and, MM07, respectively). The PCR reactions are designated as PCR1, PCR2, or PCR3.
Novel sequence not previously published.
— = Not detected. Cons = Consensus sequence generated from 10 clones containing the full-length tyrosinase sequence. Gen = Dog genome assembly sequence. Nt = Nucleotide. Pub = Published sequence (GenBank accession No. NM001002941). SNP db = Canine SNP database.
Sequences from plasmid DNA clones containing full-length SILV (n = 4), SILV constructs lacking the leader sequence (12), and partial sequences (10) were analyzed to identify SNPs in the canine SILV gene (Table 2). One nonsynonymous SNP (C478T) was detected in 2 tumors (MM01 and MM05), which changed the predicted amino acid sequence (Arg160Trp). A synonymous SNP (C841T), which has been reported in the canine SNP database,f was not detected in any of the current sequences. A T insertion between nucleotides 953 and 954, which caused a frame shift mutation, has also been reported in the canine SNP database,f but this was not apparent in any of the tumors analyzed.
Exonic SNPs in the canine SILV gene determined from various sources and from PCR assay of malignant melanomas obtained from dogs.
| Nt | Cons | Gen | Pub | SNP db | MM01 clones | MM03 clones | MM04 clones | MM05 PCR 1 clones | MM05 PCR 2 | MM08 clones | MM07 clones | Amino acid change | ||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 1 | 2 | 1 | 2 | 1 | 2 | 1 | 2 | 3 | 1 | 2 | 1 | 2 | 3 | |||||||
| 478* | — | T | T | T | T | C* | T | T | T | T | C* | T | T | T | T | T | T | T | T | Arg 60 Trp |
| 841 | — | C | — | C/T | C | C | C | C | C | C | C | C | C | C | C | C | C | C | C | — |
Malignant melanomas are designated for each dog (MM01, MM03, MM04, MM05, MM07, and MM08, respectively). The PCR reactions are designated as PCR1, PCR2, or PCR3.
See Table 1 for remainder of key.
No SNPs were identified in the Melan-A coding region. This included the sequences for the tumors of this study and those in the canine SNP database.d
Discussion
Splice variants of Melan-A, SILV, and tyrosinase were identified in melanomas of dogs in the study reported here. The Melan-A and SILV splice variants were also expressed in pigmented oral mucocutaneous tissue from healthy control dogs and thus were not unique to malignant tissue. The importance of these splice variants is unclear because it is possible that the proteins translated from such alternative transcripts would not be functional. Alternative splicing of mammalian pigmentation gene transcripts is a recognized phenomenon17–19 and could represent a regulatory mechanism to control the rate of melanin synthesis in normal melanocytes, which is retained in neoplastic cells.
To our knowledge, splice variants of Melan-A have not been reported in dogs or other animals. Deletion of exon 4 (nucleotides 175 to 288, inclusive) would correspond to amino acids 58 to 96 in the protein sequence, whose function is unknown. Deletion of exons 3 and 4, which correspond to amino acids 26 to 96, would result in deletion of the predicted transmembrane portion of the protein. This would likely interfere with Melan-A activity because this region would be important for localization of Melan-A in melanosomes, which would enable interaction with the product of the SILV gene during melanogenesis.11
Splice variants of the canine SILV gene have not been reported, whereas alternative transcripts of human SILV mRNA have been described. The human SILV gene yields 2 proteins via alternative splicing (gp100 and Pmel17). The protein Pmel17 differs from gp100 in that it has a 21-bp (7–amino acid) insertion in the juxtamembranous lumenal domain that uses an alternative 3′ splice acceptor site in the ninth intron; it also has 3 other nucleotide differences, 2 of which result in a single amino acid substitution.20,21 Splice variants of Pmel17 and gp100 with a cryptic intron excised from exon 6 have also been described,18 in addition to a transcript with a retained fourth intron that encodes an extra 35 amino acids.22 All of these human SILV alternative transcripts are expressed in normal and pigmented tissues. The splice variant detected in the canine SILV gene had a deletion of exon 5, which would correspond to amino acids 156 to 210 within the predicted N-terminal region of the protein. This region is well-conserved across species and appears to be involved in formation of intralumenal vesicles within endosomes and melanosome biogenesis.23 Loss of these amino acids may interfere with normal melanosome formation.
The tyrosinase partial exon 1 deletion splice variant was not detected in healthy pigmented oral mucocutaneous tissue. It is possible that it had low expression, and real-time PCR assays that use primers specific for the alternative transcript would be a more sensitive method for detection and quantification. If the tyrosinase splice variant were uniquely expressed in melanomas of dogs or overexpressed relative to expression in normal tissues, the novel peptide sequence generated at the splice site might, when the protein is processed and presented by major histocompatibility molecules, be recognized as an immunogenic T-cell epitope. In another report,24 a TRP-2 peptide encoded by alternatively spliced TRP-2 mRNA was recognized by cytotoxic T cells and appeared to be unique to human melanoma cells. Such novel peptides could be exploited as targets for immunotherapy.
Tyrosinase splice variants have been identified in melanomas of mice and normal skin melanocytes, in which exon skipping, use of alternative 5′ or 3′ (or both) splice sites,17,25,26 and retention of intronic sequences27 are all evident. The tyrosinase partial exon 1 deletion splice variant detected in melanoma tissues of dogs used an alternative 5′ splice site equivalent to one reported28 in melanomas and melanocytes of humans at nucleotide 354, codon 118. Deletion of nucleotides 355 to 819 corresponds to loss of amino acids 119 to 273 from canine tyrosinase. This region is within the predicted enzymatic domain and contains critical histidine residues in one of the copper-binding regions, which is necessary for tyrosinase function.29 Thus, loss of these amino acids is likely to inhibit tyrosinase function and subsequent melanin synthesis.
A SINE insertion mutation was identified in the SILV gene in 1 poorly pigmented or amelanotic melanoma (MM04). In dogs, SINEs are derived from tRNA sequences and are frequently repeated throughout the genome at intervals of approximately 5 to 8 kb.16,30 The 15-bp direct repeat flanking of the canine SILV SINE insertion in the study reported here included a palindromic sequence (GAAGNCTTC). It is possible that this nucleotide sequence, which is found in the canine SILV gene, could act as a restriction site and predispose to cleavage and integration of SINE insertions. However, the authors are not aware of any restriction enzyme that recognizes this particular sequence.
The SINE insertion mutations have been associated with diseases in dogs, such as centronuclear myopathy in Labrador Retrievers (PTPLA gene)31 and narcolepsy in Doberman Pinschers (HCRTR2 gene).32 In humans, SINE insertion mutations have been associated with colorectal, pancreatic, and breast cancers,33–35 and it has been suggested36 that this might relate to upregulated RNA polymerase III activity increasing the likelihood for a SINE mutation.
The SINE insertion mutation identified in the poorly pigmented tumor MM04 was located at the intron 10–exon 11 boundary of the genomic DNA, but only part of the SINE sequence (156 nucleotides) was in the cDNA. Although the SINE insertion mutation did not change the open reading frame or encode a premature stop codon, the additional 53 amino acids (which were inserted between the predicted transmembrane and cytoplasmic domains) could have interfered with SILV protein function and affected pigmentation. Because the SILV glycoprotein is a key component of the melanin-synthesis pathway, it was thought that a SINE insertion in the SILV gene could be 1 reason why melanomas become amelanotic. After detecting the SINE insertion in MM04, 8 additional poorly pigmented melanomas were screened, but none had the mutation, which indicated that a SINE insertion was not responsible for the lack of melanin synthesis in these tumors.
Subsequent to the study reported here, SILV SINE insertion mutations have been reported in association with merle coat color in several breeds of dogs, including Great Danes.37,38 The SILV SINE insertion mutation in tumor MM04 had a poly-A tail equivalent to a short SINE insertion and was from a blue Great Dane. Thus, it is likely that this mutation represents a germ-line mutation in a breed known to carry the merle anomaly, rather than a somatic mutation responsible for poor pigmentation in the tumor. It is possible that breeds that carry the merle mutation, when affected by melanoma, may have a tendency to develop tumors that are poorly pigmented or amelanotic. If this were the case, when tumor morphology is assessed, knowledge of breeds that possess the merle mutation (in addition to each patient's phenotype) could be important information to aid histopathologic diagnosis of melanoma.
Six novel SNPs were identified in the tyrosinase coding region and 1 novel SNP was detected in the SILV coding sequence in melanomas from dogs. Because blood or other tissues were not available from the melanoma patients, it is unknown whether the novel SNPs identified in the tyrosinase and SILV coding sequences represented somatic, tumor-specific mutations or whether they represented alternative alleles in the germ line. The SNPs at nucleotides 972 and 1,312 in the canine SNP databasef were not detected in the clones sequenced in the study reported here. The T/A SNP reported at position 780 in a Boxer was detected in the clones sequenced in our study. In 1 of 4 clones from MM07 (which was from an Airedale), we detected a G at this position.
Four of 5 nucleotide differences between the published canine tyrosinase sequence (GenBank accession No. NM 001002941) and the dog genome sequence were accounted for as SNPs (Table 1). Two of these were identified via the genome serverd (nucleotides 780 and 1,312), and 2 others were identified by comparison with the current sequence data (nucleotides 175 and 882). The fifth discrepancy in the published sequence (nucleotide 1,223) was not detected in any of the clones in our study and may have been attributable to a PCR error or sequencing error. Alternatively, this could represent a relatively uncommon SNP.
Single nucleotide polymorphisms are common in the human tyrosinase gene.39 There are numerous missense mutations as well as insertion and deletion mutations in the human tyrosinase gene associated with oculocutaneous albinism type 1, in addition to synonymous SNPs that are not associated with disease.y,z In the present study, the SNPs identified in the canine tyrosinase gene did not result in albinism or amelanotic tumors and their importance is unknown.
The nonsynonymous SNP identified at nucleotide 478 in the canine SILV coding sequence has not been reported elsewhere. The SNPs identified in the SILV gene in other species have been associated with variations in coat pigmentation. In horses, the silver phenotype has been associated with 2 SNPs (a missense mutation in exon 11 of the SILV gene that caused an amino acid change [Arg618Cys] in the cytoplasmic region of the protein and a nucleotide substitution within intron 9).40,41 In cattle, a nonsynonymous SNP (G64A) causes an amino acid change in the signal sequence of the bovine SILV gene (Gly22Arg), which reportedly is associated with coat color dilution in Charolais.42,43 The importance of the SNP at nucleotide 478 in the SILV gene is unknown and did not result in poor pigmentation in the 2 dogs or their tumors.
In the study reported here, there was variability in the MAA mRNA transcripts expressed in melanomas of dogs. These included splice variants, a SINE insertion mutation, and several SNPs. All the MAA splice variants identified in the tumor tissues were also expressed in normal pigmented tissues, with the exception of the partial exon 1 deletion splice variant of tyrosinase. If this particular splice variant were unique to melanomas, the novel peptide sequence encoded may, when the protein is processed and presented by major histocompatibility molecules, represent a tumor-specific target that could be exploited in immunotherapy.
ABBREVIATIONS
| MAA | Melanoma-associated antigen |
| NCBI | National Center for Biotechnology Information |
| SINE | Short interspersed nuclear element |
| SNP | Single nucleotide polymorphism |
Stell AJ, Dobson JM, Catchpole B. Characterisation of melanoma-associated antigen mRNA expression in canine oral malignant melanomas (abstr). J Vet Intern Med 2004;18:792.
Stell AJ, Dobson JM, Catchpole B. Identification of a splice variant of gp100 expressed in canine melanoma tumours (abstr), in Proceedings. Vet Cancer Soc Annu Conf 2004;57.
RNAlater, Sigma-Aldrich, Poole, Dorset, England.
NCBI Dog Genome Resources [database online]. Bethesda, Md: National Center for Biotechnology Information, 2009. Available at: www.ncbi.nlm.nih.gov/projects/genome/guide/dog. Accessed Aug 14, 2004.
NCBI Entrez Nucleotide Sequence Database [database online]. Bethesda, Md: National Center for Biotechnology Information, 2009. Available at: www.ncbi.nlm.nih.gov/Entrez. Accessed Aug 14, 2004.
Dog SNP Database [database online]. Cambridge, Mass: BROAD Institute, 2008. Available at: www.broad.mit.edu/mammals/dog/snp. Accessed Apr 13, 2005
SignalP 3.0 Server, Center for Biological Sequence Analysis, Lyngby, Denmark. Available at: www.cbs.dtu.dk/services/SignalP. Accessed Oct 15, 2004.
Simple Modular Architecture Research Tool, European Molecular Biology Laboratory, Heidelberg, Germany. Available at: smart.embl-heidelberg.de/. Accessed Mar 30, 2007.
Fisher Scientific, Loughborough, Leicestershire, England.
Mixer mill MM300, Retsch, Leeds, West Yorkshire, England.
GenElute RNA lysis solution, Sigma-Aldrich, Poole, Dorset, England
GenElute mammalian total RNA kit, Sigma-Aldrich, Poole, Dorset, England.
RNase-free DNase, Qiagen, Crawley, West Sussex, England.
M-MLV reverse transcriptase, Promega, Southampton, Hampshire, England.
QIAamp DNA blood mini kit, Qiagen, Crawley, West Sussex, England.
DNeasy tissue kit, Qiagen, Crawley, West Sussex, England.
Immolase DNA polymerase, Bioline, London, England.
DNA engine (PTC-200) Peltier thermal cycler, Bio-Rad, Hemel Hempstead, Hertfordshire, England.
Ethidium bromide, Sigma-Aldrich, Poole, Dorset, England.
ImageMaster VDS gel documentation system, Pharmacia Biotech, Uppsala, Sweden.
Easy-A high-fidelity PCR cloning enzyme, Stratagene, Amsterdam, The Netherlands.
pCRII-TOPO vector, Invitrogen, Paisley, Scotland.
GenElute Plasmid Miniprep Kit, Sigma-Aldrich, Poole, Dorset, England.
Geneservice, Cambridge, Cambridgeshire, England.
Albinism database [database online]. Available at: www.albinismdb.med.umn.edu. Accessed Jun 20, 2006.
Human Gene Mutation Database [database online]. Available at: www.hgmd.org/. Accessed Jun 20, 2006.
References
- 1.↑
Theos AC, Truschel ST, Raposo G, et al. The Silver locus product Pmel17/gp100/Silv/ME20: controversial in name and in function. Pigment Cell Res 2005;18:322–336.
- 2.
Bakker AB, Schreurs MW, Tafazzul G, et al. Identification of a novel peptide derived from the melanocyte-specific gp100 antigen as the dominant epitope recognized by an HLA-A2.1-restricted anti-melanoma CTL line. Int J Cancer 1995;62:97–102.
- 3.
Brichard V, Van Pel A, Wolfel T, et al.The tyrosinase gene codes for an antigen recognized by autologous cytolytic T lymphocytes on HLA-A2 melanomas. J Exp Med 1993;178:489–495.
- 4.
Kawakami Y, Eliyahu S, Sakaguchi K, et al. Identification of the immunodominant peptides of the MART-1 human melanoma antigen recognized by the majority of HLA-A2-restricted tumor infiltrating lymphocytes. J Exp Med 1994;180:347–352.
- 5.
Bergman PJ, Camps-Palau MA, McKnight JA, et al. Development of a xenogeneic DNA vaccine program for canine malignant melanoma at the Animal Medical Center. Vaccine 2006;24:4582–4585.
- 6.
Bergman PJ, McKnight J, Novosad A, et al. Long-term survival of dogs with advanced malignant melanoma after DNA vaccination with xenogeneic human tyrosinase: a phase I trial. Clin Cancer Res 2003;9:1284–1290.
- 7.
Gyorffy S, Rodriguez-Lecompte JC, Woods JP, et al. Bone marrow-derived dendritic cell vaccination of dogs with naturally occurring melanoma by using human gp100 antigen. J Vet Intern Med 2005;19:56–63.
- 8.
Liao JC, Gregor P, Wolchok JD, et al. Vaccination with human tyrosinase DNA induces antibody responses in dogs with advanced melanoma. Cancer Immun 2006;6:8–18.
- 9.
Hearing VJ, Jimenez M. Mammalian tyrosinase—the critical regulatory control point in melanocyte pigmentation. Int J Biochem 1987;19:1141–1147.
- 10.
Sulaimon SS, Kitchell BE. The biology of melanocytes. Vet Dermatol 2003;14:57–65.
- 11.↑
Hoashi T, Watabe H, Muller J, et al. MART-1 is required for the function of the melanosomal matrix protein PMEL17/GP100 and the maturation of melanosomes. J Biol Chem 2005;280:14006–14016.
- 12.
Pinelli E, van der Kaaij SY, Slappendel R, et al.Detection of canine cytokine gene expression by reverse transcription-polymerase chain reaction. Vet Immunol Immunopathol 1999;69:121–126.
- 13.
Schrader AJ, Probst-Kepper M, Grosse J, et al. Molecular and prognostic classification of advanced melanoma: a multi-marker microcontamination assay of peripheral blood stem cells. Melanoma Res 2000;10:355–362.
- 14.
Schittek B, Blaheta HJ, Florchinger G, et al. Increased sensitivity for the detection of malignant melanoma cells in peripheral blood using an improved protocol for reverse transcription-polymerase chain reaction. Br J Dermatol 1999;141:37–43.
- 15.↑
Catchpole B, Gould SM, Kellett-Gregory LM, et al.Development of a multiple-marker polymerase chain reaction assay for detection of metastatic melanoma in lymph node aspirates of dogs. Am J Vet Res 2003;64:544–549.
- 16.↑
Das M, Chu LL, Ghahremani M, et al. Characterization of an abundant short interspersed nuclear element (SINE) present in Canis familiaris. Mamm Genome 1998;9:64–69.
- 17.
Kelsall SR, Le Fur N, Mintz B. Qualitative and quantitative catalog of tyrosinase alternative transcripts in normal murine skin melanocytes as a basis for detecting melanoma-specific changes. Biochem Biophys Res Commun 1997;236:173–177.
- 18.↑
Nichols SE, Harper DC, Berson JF, et al. A novel splice variant of Pmel17 expressed by human melanocytes and melanoma cells lacking some of the internal repeats. J Invest Dermatol 2003;121:821–830.
- 19.
Pisarra P, Lupetti R, Palumbo A, et al. Human melanocytes and melanomas express novel mRNA isoforms of the tyrosinase-related protein-2/DOPAchrome tautomerase gene: molecular and functional characterization. J Invest Dermatol 2000;115:48–56.
- 20.
Adema GJ, de Boer AJ, Vogel AM, et al.Molecular characterization of the melanocyte lineage-specific antigen gp100. J Biol Chem 1994;269:20126–20133.
- 21.
Maresh GA, Marken JS, Neubauer M, et al. Cloning and expression of the gene for the melanoma-associated ME20 antigen. DNA Cell Biol 1994;13:87–95.
- 22.↑
Robbins PF, El-Gamil M, Li YF, et al. The intronic region of an incompletely spliced gp100 gene transcript encodes an epitope recognized by melanoma-reactive tumor-infiltrating lymphocytes. J Immunol 1997;159:303–308.
- 23.↑
Theos AC, Truschel ST, Tenza D, et al. A lumenal domain-dependent pathway for sorting to intralumenal vesicles of multivesicular endosomes involved in organelle morphogenesis. Dev Cell 2006;10:343–354.
- 24.↑
Lupetti R, Pisarra P, Verrecchia A, et al. Translation of a retained intron in tyrosinase-related protein (TRP) 2 mRNA generates a new cytotoxic T lymphocyte (CTL)-defined and shared human melanoma antigen not expressed in normal cells of the melanocytic lineage. J Exp Med 1998;188:1005–1016.
- 25.
Ruppert S, Muller G, Kwon B, et al. Multiple transcripts of the mouse tyrosinase gene are generated by alternative splicing. EMBO J 1988;7:2715–2722.
- 26.
Le Fur N, Kelsall SR, Mintz B. Base substitution at different alternative splice donor sites of the tyrosinase gene in murine albinism. Genomics 1996;37:245–248.
- 27.↑
Porter S, Mintz B. Multiple alternatively spliced transcripts of the mouse tyrosinase-encoding gene. Gene 1991;97:277–282.
- 28.↑
Fryer JP, Oetting WS, Brott MJ, et al. Alternative splicing of the tyrosinase gene transcript in normal human melanocytes and lymphocytes. J Invest Dermatol 2001;117:1261–1265.
- 29.↑
Jackman MP, Hajnal A, Lerch K. Albino mutants of Streptomyces glaucescens tyrosinase. Biochem J 1991;274:707–713.
- 30.
Minnick MF, Stillwell LC, Heineman JM, et al. A highly repetitive DNA sequence possibly unique to canids. Gene 1992;110:235–238.
- 31.↑
Pele M, Tiret L, Kessler JL, et al. SINE exonic insertion in the PTPLA gene leads to multiple splicing defects and segregates with the autosomal recessive centronuclear myopathy in dogs. Hum Mol Genet 2005;14:1417–1427.
- 32.↑
Lin L, Faraco J, Li R, et al. The sleep disorder canine narcolepsy is caused by a mutation in the hypocretin (orexin) receptor 2 gene. Cell 1999;98:365–376.
- 33.
Kloor M, Sutter C, Wentzensen N, et al. A large MSH2 Alu insertion mutation causes HNPCC in a German kindred. Hum Genet 2004;115:432–438.
- 34.
Slebos RJ, Resnick MA, Taylor JA. Inactivation of the p53 tumor suppressor gene via a novel Alu rearrangement. Cancer Res 1998;58:5333–5336.
- 35.
Rohlfs EM, Puget N, Graham ML, et al. An Alu-mediated 7.1 kb deletion of BRCA1 exons 8 and 9 in breast and ovarian cancer families that results in alternative splicing of exon 10. Genes Chromosomes Cancer 2000;28:300–307.
- 36.↑
White RJ. RNA polymerases I and III, growth control and cancer. Nat Rev Mol Cell Biol 2005;6:69–78.
- 37.
Hédan B, Corre S, Hitte C, et al. Coat colour in dogs: identification of the merle locus in the Australian shepherd breed. BMC Vet Res 2006;2:9–19.
- 38.
Clark LA, Wahl JM, Rees CA, et al. Retrotransposon insertion in SILV is responsible for merle patterning of the domestic dog. Proc Natl Acad Sci U S A 2006;103:1376–1381.
- 39.↑
Opitz S, Kasmann-Kellner B, Kaufmann M, et al. Detection of 53 novel DNA variations within the tyrosinase gene and accumulation of mutations in 17 patients with albinism. Hum Mutat 2004;23:630–631.
- 40.
Reissmann M, Bierwolf J, Brockmann GA. Two SNPs in the SILV gene are associated with silver coat colour in ponies. Anim Genet 2007;38:1–6.
- 41.
Brunberg E, Andersson L, Cothran G, et al. A missense mutation in PMEL17 is associated with the silver coat color in the horse. BMC Genet 2006;7:46–56.
- 42.
Oulmouden A, Julien R, Laforet JM, et al. Use of silver gene for authentication of the racial origin of animal populations, and the derivative products thereof. Patent publication US2006183127. Munich: European Patent Office, 2005. Available at: ep.spacenet.com. Accessed Jun 25, 2007.
- 43.
Kuhn C, Weikard R. An investigation into the genetic background of coat colour dilution in a Charolais × German Holstein F(2) resource population. Anim Genet 2007;38:109–113.
Appendix
Primers and primer conditions used in PCR assays for detection of MAAs in melanomas of dogs.
| Target gene | Primer description | Primer sequence (5′–3′) | Annealing temperature (°C) | PCR amplicon (bp) | Reference |
|---|---|---|---|---|---|
| GAPDH | Housekeeping gene | F: ACCACAGTCCATGCCATCAC | 55 | 452 | 12 |
| R: TCCACCACCCTGTTGCTGTA | |||||
| Melan-A Hs | Based on human Melan-A sequence | F: ATCGGCATCCTGACAGTGATCCTG | 55 | 264 | 13 |
| R: TGAATAAGGTGGTGGTGACTGTTC | |||||
| Melan-A FL | Designed to amplify the full-length canine Melan-A coding sequence | F: GCCGCCACCATGGCAAAGAGAAGAGGCTCAC | 60 | 385 | NP |
| R: TCTAGATATGATGATGATGATGATGCAAATAAGGTGGTGATGACTG | |||||
| SILV Hs | Based on human gp100 coding sequence | F: CATCTGGCTCTTGGTCTCAG | 60 | 421 | 14 |
| R: GTATGAGTGACCACAAGTGC | |||||
| SILV FL | Designed to amplify full-length canine SILV coding sequence | F: GCCGCCACCATGGATCTGGTGCCGAGAAAATG | 60 | 2,008 | NP |
| R: TCTAGATATGATGATGATGATGATGGACCTGCTGCTGCCCATTGAG | |||||
| SILV MP | Designed to amplify the mature protein coding sequence of canine SILV (ie, lacking the signal peptide) | F: GCCACCATGGCCACAGAAGGACCCAGAGAC | 55 | 1,942 | NP |
| R: TCTAGATATGATGATGATGATGATGGACCTGCTGCTGCCCATTGAG | |||||
| SILV SINE insertion pair 1 | Primers designed in the canine SILV gene flanking the insertion mutation, (forward primer in exon 10 and reverse primer in exon 11) | F: GCTGGCTATGGTGCTGGTAT | 55 | 792 for genomic DNA with no SINE insertion | NP |
| R: GAGGGGTCTGTTCTCACCAA | |||||
| SILV SINE insertion pair 2 | Primers designed in the canine SILV gene flanking the insertion mutation, (forward primer in intron 10 and reverse insertion | F: TGAAGAGGGGAGGGAGCTAGA | 60 | 242 for genomic DNA with no SINE primer in exon 11) | NP |
| R: GAGGGGTCTGTTCTCACCAA | |||||
| Tyrosinase FL | Designed to amplify the full-length canine tyrosinase coding sequence | F: GCCGCCACCATGGTCCTGGCTGCTTTGTGCTGT | 60 | 1,618 | NP |
| R: TCTAGATATGATGATGATGATGATGGGTCTGATACAACAAGCTGTG | |||||
| Tyrosinase MP | Designed to amplify the mature protein coding sequence of canine tyrosinase (ie, lacking the signal peptide) | F: GCCACCATGGGCCATTTTCCTCGAGC | 60 | 1,567 | NP |
| R: TCTAGATATGATGATGATGATGATGGGTCTGATACAACAAGCTGTG |
GAPDH = Glyceraldehyde-3-phosphate dehydrogenase. F = Forward. NP = Not published. R = Reverse.
