Wounds on limbs of horses often develop exuberant granulation tissue, which behaves clinically in a manner similar to that of a benign tumor in which the evolving scar is trapped in the proliferative phase of repair and leads to fibrosis.1, 2 This condition ultimately leads to extensive scarring that may adversely affect function and force withdrawal of an affected horse from competition. Indeed, it has been reported3 that 7% of injuries that lead to the retirement of racehorses are the direct result of a wound.
Several mechanisms have been incriminated in problematic repair of horses, including an inefficient inflammatory response to trauma,4, 5 persistent local upregulation of profibrotic cytokines,6–8 disparity between collagen synthesis and lysis,9 and microvascular occlusion and deficient apoptosis of the cellular components of granulation tissue.10 These irregularities appear limited to wounds located on the distal portion of the limbs because even extensive wounds of the trunk and head will usually heal uneventfully.1,2,4
Attempts to ameliorate the repair of chronic wounds and prevent the development of exuberant granulation tissue in horses have been disappointing. This may relate to deficient knowledge of the underlying molecular mechanisms. Dermal wound repair involves sophisticated interactions between cells, cytokines, and extracellular matrix components acting locally and in parallel with numerous systemic factors. Events are conventionally divided into synchronized and overlapping phases, including acute inflammation, cellular proliferation, and matrix synthesis and remodeling with scar formation.
In addition to initiating the inflammatory response through interaction with leukocytes, microvascular endothelial cells play a key role in the proliferative phase of repair. The formation of new blood vessels from preexisting vasculature (angiogenesis) ensures nutritional support and maintenance of new granulation tissue. Angiogenesis, in response to tissue injury, is a complex and dynamic process mediated by soluble factors from serum and the surrounding extracellular matrix. Prime angiogenic inducers include growth factors, chemokines, angiogenic enzymes, endothelial-specific receptors, and adhesion molecules.11
Transition between the phases of repair depends on the activation or inhibition of many genes; any disturbance in gene expression can lead to abnormal scarring. Investigators have analyzed the expression of specific genes during normal or impaired healing,12, 13 although only 1 study9 has been performed in horses. Given the complexity of the repair process, our laboratory group conducted a comprehensive study14 in an effort to identify the genes differentially expressed during normal wound repair in horses. This profiling of mRNA expression during the proliferative phase of repair of normal wounds revealed 226 nonredundant, differentially expressed cDNAs, of which 129 could be matched against sequences contained in GenBank databases. In the study described here, we targeted a cDNA fragment that corresponded to equine PEDF because of its potential biological contribution to inflammation and angiogenesis, which are exacerbated during the repair of wounds in the limbs of horses.
Pigment epithelium-derived factor, a glycoprotein encoded by the Serpin clade F, member 1 gene, is among the most potent natural antiangiogenic factors identified.15 It specifically inhibits both migration and proliferation of endothelial cells in newly forming vessels while sparing existing vessels.16 The manner in which PEDF limits growth of new blood vessels may depend on the activation of the Fas/FasL apoptotic cascade.17 Furthermore, it has been suggested that PEDF may exert endogenous anti-inflammatory activity18, 19 and could function as an endogenous anti–transforming growth factor-B and antifibrotic factor, at least in the kidneys.20
We hypothesized that the pattern for temporal expression of this gene (with a potential role in angiogenesis) would differ between healing wounds located on the trunk and limbs of horses. The specific objectives of the study reported here were to clone full-length equine PEDF cDNA and to evaluate its temporal expression during wound repair. The ultimate purpose of our research program is to contribute to a better understanding of the repair process and prompt the development of novel diagnostic and therapeutic strategies to prevent or resolve complications associated with wound healing.
Materials and Methods
Cloning of equine PEDF cDNA—Isolation of the full-length equine cDNA was performed by screening size-selected cDNA libraries. Initially, the size of equine PEDF cDNA was estimated by performing virtual northern blot analyses. Briefly, total RNA was isolated from a biopsy specimen obtained from the wound edge 7 days after creation of a square (6.25-cm2) full-thickness wound on the lateral thoracic wall14; total RNA was transformed into cDNAa as described elsewhere.21 The cDNAs were separated by use of gel electrophoresis, transferred onto a nylon membrane, and hybridized with a radioactive probe (equine PEDF = 451 bp) generated during a previous suppression subtractive hybridization screening experiment.14 On the basis of the size of the hybridized product, a specific library was established via a plasmid-cloning techniqueb and screened by use of radioactive hybridization as described elsewhere.21 Hybridizing bacterial colonies were grown, their plasmid contents were isolated,c and the size of the cloned cDNA was evaluated via gel electrophoresis analysis following digestion with EcoR1. The cDNA was sequenced via the dideoxy sequencing methodd and analyzed on a sequencer.e Nucleic acid sequence was analyzed by use of BLAST,f and the protein sequence deduced from cDNA was analyzed by use of position-specific iterative BLASTf and pattern-hit iterative BLASTf on sequences contained in GenBank databases.
Sample population—Biopsy specimens were obtained from 4 clinically normal 2- to 3-year-old Standardbred mares. Specimens of normal skin and biopsy specimens from wound edges were obtained from the horses at specific times during the repair process, as described.10 Experiments were approved by the Animal Ethics Committee of the Faculty of Veterinary Medicine of the University of Montreal and were sanctioned by the Canadian Council on Animal Care.
Equine tissues and RNA extraction—Briefly, horses were sedated by administration of detomidine hydrochlorideg (0.01 mg/kg, IV) and butorphanol tartrateh(0.04 mg/kg, IV). Local analgesia was achieved by performing a lateral high palmar nerve block with 2% lidocaine hydrochloridei (0.5 mg/kg, SC). The surgical sites were aseptically prepared and included 5 areas on the dorsolateral surface of the metacarpus beginning immediately proximal to the metacarpophalangeal joint and 5 areas on the lateral thoracic wall; areas were 1.5 cm apart in a staggered vertical column. From each of these areas, a square (6.25 cm2) of skin was excised, and wounds were then allowed to heal by second intention, with no bandages.
Butorphanol (0.04 mg/kg, IV, q 8 h) was administered for 2 days after surgery. Excised skin from the most distal wound was retained as a time 0 sample. Samples were obtained from 1 wound/anatomic site (ie, thorax and limb) from each horse at 1, 2, 3, 4, and 6 weeks after creation of the wounds. To avoid repeated trauma, each wound, beginning with the most distal wound for the limbs or the most ventral wound for the thoracic wall, was designated for a single biopsy. Full-thickness specimens were collected by use of an 8-mm - diameter biopsy punch to include a 3- to 4-mm strip of peripheral skin, the migrating epithelium, and a 3- to 4-mm strip of granulation tissue from the wound center (when possible). Biopsy specimens were snap-frozen in liquid nitrogen and stored at −80°C. Total RNA was extracted from each sample and analyzed as described elsewhere.22
Semiquantitative reverse transcription–PCR analysis of temporal expression of mRNA—Total RNA was initially transformed into cDNA. One microgram of total RNA from samples of healing thoracic wounds from each of the 4 mares was pooled for each biopsy collection time point; the same was done for samples collected from limb wounds. From each of these pools, RNA was reverse transcribed with an oligo-dT30 primerj to generate the first-strand cDNA.23,a Secondstrand cDNA was generated and amplified by use of PCR techniques.k To perform semiquantitative reverse transcription– PCR assays, cDNA pools were used in a 25-ML PCR reaction with a polymerase kit.k Gene-specific PCR primers were designed in the open reading frame of the equine cDNA sequence for PEDF (GenBank accession No. DQ310374; sense, 5a–GATTAACAACTGGGTGCAGGCC–3a; antisense, 5a–CTCTAGGGTTTTCTTCATCTAGGG– 3a) and GAPDH (sense, 5a–CAAGTTCCATGGCACAGTCACGG–3a; antisense, 5a– AAAGTGGTCGTTGAGGGCAATGC–3a).14
For all samples, PCR amplification was performed in triplicate.l The number of cycles used (GAPDH = 18 cycles, and PEDF = 21 cycles) was optimized to be within the linear range of PCR amplification. Products of the PCR reactions (20 ML/reaction) were resolved on a 2% Tris acetate–agarose gel (40mM Tris acetate [pH, 8] and 1mM EDTA) with ethidium bromide (0.5 μg/mL); PCR products were developed by use of UV light, and the images were digitized. Digitized signals were analyzed by use of densitometry.m Gene-specific signals for PEDF were standardized on the basis of the corresponding GAPDH signals for each sample.
Results
Cloning and characterization of equine cDNA for PEDF—The cDNA fragment used for the virtual northern blot analysis originated from sequences obtained from an experiment to profile gene expression by use of suppression subtractive hybridization screening that intended to identify mRNAs whose expression was increased or induced during the proliferative phase of wound repair in horses.14 The virtual northern blot analysis determined an approximate molecular weight of 1.3 to 1.5 kilobases for the full-length PEDF cDNA (data not shown). This suppression subtractive hybridization cDNA fragment was used as a probe to screen (by hybridization) appropriate size-selected cDNA libraries generated from biopsy specimens collected 7 days after surgery from thoracic wound margins of the horses. The cDNA size-selected libraries each consisted of 1,568 bacterial colonies; 2 colonies hybridized for PEDF. Two clones were ultimately selected for plasmid DNA purification and sequencing.
The full-length equine PEDF cDNA was cloned, and it consisted of 1,464 bp (GenBank accession No. DQ310374) that included a 5a–untranslated region of 84 bp, an open reading frame of 1,254 bp encoding a 417-amino acid protein with a theoretic molecular mass of 46.1 kd, an isoelectric point of 6.3, and a 3a–untranslated region of 126 bp containing 1 polyadenylation signal followed by a poly-A+ tail (Figure 1). Nucleotide homology between horses, cattle, and pigs was determined to be 88%, whereas homologies of horses versus humans and dogs and versus mice were 87% and 84%, respectively.
Sequence of equine PEDF cDNA cloned by use of library screening and amino acids deduced from the cDNA (GenBank accession No. DQ310374). Numbers on the left side represent nucleotide number. Equine PEDF cDNA is composed of 1,464 bp (84 of which are in the 5a–untranslated region) and an open reading frame of 1,254 bp encoding a 417-amino acid protein with a theoretic molecular mass of 46.1 kd, an isoelectric point of 6.3, and a 3a–untranslated region of 126 bp containing 1 polyadenylation signal (bold and underline) followed by a poly-A+ tail (not shown). The stop codon is indicated (asterisks).
Citation: American Journal of Veterinary Research 70, 1; 10.2460/ajvr.70.1.112
A search on amino acid homology in GenBank revealed orthologous proteins with an overall identity of 88% for human and canine, 87% for bovine, and 85% for murine PEDF (Figure 2). For the equine PEDF sequence, the signal peptide spanned from M1 to C19, which should be cleaved, yielding a mature secreted protein with a theoretic molecular mass of 44.2 kDa and an isoelectric point of 6.2. The equine PEDF protein contains a Serpin domain (L47-P414) and 1 potential N-glycosylation site (N285).
Comparison of the deduced amino acid sequences of equine (GenBank accession No. DQ310374), bovine (GenBank accession No. NM_174140), porcine (GenBank accession No. NM_001078662), human (GenBank accession No. NM_002615), canine (GenBank accession No. NM_001077588), and murine (GenBank accession No. NM_011340) PEDF sequences. Identical amino acid residues are indicated (dots). Gaps in protein sequences (hyphens) were used to optimize alignment. Numbers on the right side represent the amino acid number.
Citation: American Journal of Veterinary Research 70, 1; 10.2460/ajvr.70.1.112
Temporal expression of PEDF mRNA in fullthickness excisional wounds of the equine thorax and limbs—The PEDF mRNA was constitutively expressed in equal amounts in normal skin of the thorax and limbs; expression was upregulated in wounds, and PEDF mRNA did not return to baseline values by the end of the study. Relative overexpression was identified in thoracic wounds, compared with expression in limb wounds, at 1, 2, and 6 weeks of wound repair (Figure 3).
Tris acetate–agarose gels depicting equine PEDF mRNA content in samples obtained from wounds created in the skin of the lateral thoracic wall and the forelimbs of 4 horses. Samples were obtained at the time of surgery (time 0) and 1, 2, 3, 4, and 6 weeks after surgery during wound healing. Total RNA was extracted from biopsy specimens obtained from the wound margins, and mRNA expression analyses were conducted by use of semiquantitative reverse transcription–PCR assay. Bar graphs represent the mean (PCR analysis performed in triplicate) of the PEDF mRNA of wounds in the thorax (white bars) and forelimbs (black bars) for the 4 horses included in the study. Values reported represent the relative amount of PEDF mRNA in biopsy specimens, which were standardized as a percentage of the results for the control gene GAPDH.
Citation: American Journal of Veterinary Research 70, 1; 10.2460/ajvr.70.1.112
Discussion
The purpose of the study reported here was to determine the temporal mRNA expression of PEDF during the repair of wounds on the trunk and limbs of horses in an effort to define some of the molecular mechanisms underlying the exuberant formation of granulation that leads to complications in healing and undue scarring in limb wounds. Thus, to our knowledge, this report is the first to characterize the full-length equine cDNA for PEDF and to detect upregulation of PEDF mRNA in response to dermal wounds in any species.
The amino acid sequence of equine PEDF is highly conserved, compared with that of other species. The 50-kd protein is encoded by a single gene that also is strongly conserved across phyla from fish to mammals.24 Therefore, it is tempting to attribute an essential biological role to PEDF. In mice and humans, the gene for PEDF is approximately 13 to 16 kilobases and is divided among 8 exons and 7 introns.25 Although PEDF is strongly homologous in sequence and structure to members of the Serpin family, in particular the ovalbumin-plasminogen activator inhibitor-2 subgroup, it is not a proteinase inhibitor.26 Two specific domains on the PEDF protein interact with extracellular matrix components and may mediate some of the biological actions of this protein. The transducers through which PEDF signals endothelial cells are defined and involve major pathways, including Akt–nuclear factor KB, mitogen-activated protein kinase, and the caspases.24 Furthermore, PEDF also binds to type I collagen in a concentration-dependent manner.27
The severity of scarring of wounds on the limbs of horses appears to be related to an excessive proliferative phase in which angiogenesis and fibroplasia are exacerbated, which hinders epithelialization and wound contraction.4,6,9 Thus, an imbalance between upregulation and downregulation of the molecular components governing angiogenesis during wound repair may underlie the abnormal healing pattern identified in the limbs of horses.
Currently, PEDF is considered one of the most potent, naturally occurring antiangiogenic factors, surpassing even thrombospondin-1 and angiostatin.16 This noninhibitory member of the Serpin family appears to mediate its antiangiogenic effects through multiple protein-to-protein interactions that downregulate the function of proangiogenic molecules, such as platelet-derived growth factor, vascular endothelial growth factor, and basic fibroblast growth factor15,16,28; induce apoptosis of endothelial cells bordering newly formed blood vessels via activation of the Fas/FasL cascade17, 28; and upregulate other antiangiogenic molecules, such as thrombospondin-1.29
In view of the fact that PEDF is more powerful than other identified endogenous angiogenesis inhibitors, targets only new vessel growth, can be administered as a soluble protein or by viral-mediated gene transfer, and is stable and nontoxic when injected, it may represent an excellent pharmacologic tool for combating overabundant vessel growth.18 The production of PEDF by skin30 suggests that its therapeutic potential should be explored in conditions of pathologic wound repair and tumor transformation of the dermis. However, before launching an investigation of the therapeutic effects of this glycoprotein in horses, it was essential to map its expression in experimentally created wounds in horses.
Although PEDF was constitutively expressed by normal equine skin, rapid upregulation was detected in thoracic wounds. Indeed, mRNA expression of PEDF was greater in wounds of the thorax than in wounds of the limbs at the earliest measurement points (1 and 2 weeks after creation of the wounds). Considering the ability of PEDF to inhibit angiogenesis, our findings correlate well with what has been detected histologically,10 whereby a decrease in angiogenesis is apparent in thoracic wounds beginning at 3 weeks after surgery, relative to the results for equivalent wounds on the limbs. Similarly, studies31, 32 performed on humans with diabetic proliferative retinopathy or macular degeneration, which are conditions characterized by a significant increase in ocular vascularization, reveal a decrease in PEDF contents in the eyes.
Because the numerous biological functions of PEDF could all contribute to wound repair and because our in vivo technique represents a mixed cellular population, it is possible that the continued presence of PEDF mRNA late in the study (6 weeks after surgery) is no longer related to its antiangiogenic function but rather to its ability to inhibit growth (particularly of fibroblasts) via reduction in the number of cells entering the S phase of the cell cycle.33 Furthermore, PEDF can enhance apoptosis,17 a process essential to remodeling, and can function as an endogenous anti–transforming growth factor-B and antifibrotic factor.20 This may explain the relative underexpression of PEDF mRNA in wounds on the limbs 6 weeks after their creation because these wounds have excessive fibroplasia.
To our knowledge, the study reported here is the first to characterize full-length equine cDNA for PEDF and to identify upregulation of PEDF mRNA in response to dermal wounding in any species. In view of the potent antiangiogenic capacity of PEDF, analysis of these data suggests that PEDF may contribute to the superior healing detected in wounds on the trunks of horses by protecting them against the excessive formation of vascular granulation tissue that characterizes wounds on the limbs and encourages scarring in horses.
The molecule investigated in this study has been credited with a number of roles, depending on its cellular origin, its cellular target, and the physiologic mechanisms in which it participates. Wound repair is a complex, dynamic process in which various cell populations interact in different manners during the healing phases. In vitro systems such as conventional 2-dimensional cultures can help elucidate the mechanisms underlying repair; however, for most investigators who use such techniques, the question remains as to how far the results can be extrapolated to in vivo situations. Thus, although data interpretation is a challenge, the value of the study reported here lies in the fact that the findings are more representative of the actual events in patients.
Development of a protein assay specific for equine PEDF would enable gene expression to be correlated with protein contents in healing dermal wounds. This may then provide a basis for the development of treatments targeted to prevent excessive angiogenesis and the subsequent development of exuberant granulation tissue that leads to excessive scarring of limb wounds in horses.
ABBREVIATIONS
| BLAST | Basic local alignment search tool |
| cDNA | Complementary DNA |
| GAPDH | Glyceraldehyde-3–phosphate dehydrogenase |
| PEDF | Pigment epithelium-derived factor |
| Serpin | Serine proteinase inhibitor |
SMART cDNA synthesis method, BD Biosciences Clontech, Mississauga, ON, Canada.
Qiagen PCR cloning kit, Qiagen, Mississauga, ON, Canada.
QIA-prep, Qiagen, Mississauga, ON, Canada.
Big Dye Terminator 3.0, ABI Prism, Applied BioSystem, Branchburg, NJ.
ABI Prism 310, Applied BioSystem, Branchburg, NJ.
BLAST, National Center for Biotechnology Information, Bethesda Md. Available at: www.ncbi.nlm.nih.gov/BLAST/. Accessed Dec 16, 2008.
Dormosedan 10 mg/mL, Pfizer Santé Animale, Kirkland QC, Canada.
Torbugesic, 10 mg/mL, Wyeth Canada, St-Laurent, QC, Canada.
Lurocaïne, 20 mg/mL, Vetoquinol NA Inc, Lavaltrie, QC, Canada.
PowerScript, BD Biosciences Clontech, Mississauga, ON, Canada.
Advantage 2 DNA polymerase, BD Biosciences Clontech, Mississauga, ON, Canada.
Eppendorf Mastercycler ep, Fisher Scientific, Ottawa, ON, Canada.
NIH Image program. National Center for Biotechnology Information, Bethesda Md. Available at: rsb.info.nih.gov/nih-image/.
References
- 1.
Jacobs KA, Leach DH, Fretz PB, et al. Comparative aspects of the healing of excisional wounds on the leg and body of horses. Vet Surg 1984;13:83–90.
- 2.↑
Knottenbelt DC. Equine wound management: are there significant differences in healing at different sites on the body? Vet Dermatol 1997;8:273–290.
- 3.↑
Perkins NR, Reid SW, Morris RS. Profiling the New Zealand Thoroughbred racing industry. 2. Conditions interfering with training and racing. N Z Vet J 2005;53:69–76.
- 4.
Wilmink JM, van Weeren PR, Stolk PW, et al. Differences in second-intention wound healing between horses and ponies: histological aspects. Equine Vet J 1999;31:61–67.
- 5.
Wilmink JM, Veenman JN, van den Boom R, et al. Differences in polymorphonucleocyte function and local inflammatory response between horses and ponies. Equine Vet J 2003;35:561–569.
- 6.
Theoret CL, Barber SM, Moyana TN, et al. Expression of transforming growth factor B1, B3, and basic fibroblast growth factor in full-thickness skin wounds of equine limbs and thorax. Vet Surg 2001;30:269–277.
- 7.
Theoret CL, Barber SM, Moyana TN, et al. Preliminary observations on expression of transforming growth factor B1, B3, and basic fibroblast growth factor in equine limb wounds healing normally or with proud flesh. Vet Surg 2002;31:266–273.
- 8.
van den Boom R, Wilmink JM, O'Kane S, et al. Transforming growth factor-beta levels during second-intention healing are related to the different course of wound contraction in horses and ponies. Wound Repair Regen 2002;10:188–194.
- 9.↑
Schwartz AJ, Wilson DA, Keegan KG, et al. Factors regulating collagen synthesis and degradation during second-intention healing of wounds in the thoracic region and the distal aspect of the forelimb of horses. Am J Vet Res 2002;63:1564–1570.
- 10.↑
Lepault E, Céleste C, Doré M, et al. Comparative study on microvascular occlusion and apoptosis in body and limb wounds in the horse. Wound Repair Regen 2005;13:520–529.
- 11.↑
Liekens S, De Clercq E, Neyts J. Angiogenesis: regulators and clinical applications. Biochem Pharmacol 2001;61:253–270.
- 12.
Braun S, Hanselmann C, Gassmann MG, et al. Nrf2, transcription factor, a novel target of keratinocyte growth factor action which regulates gene expression and inflammation in the healing skin wound. Mol Cell Biol 2002;22:5492–5505.
- 13.
Si Z, Bhardwaj R, Rosch R, et al. Impaired balance of type I and type III procollagen mRNA in cultured fibroblasts of patients with incisional hernia. Surgery 2002;131:324–331.
- 14.↑
Lefebvre-Lavoie J, Lussier JG, Theoret CL. Profiling of differentially expressed genes in wound margin biopsies of horses using suppression subtractive hybridization. Physiol Genomics 2005;22:157–170.
- 15.↑
Ren J-G, Jie C, Talbot C. How PEDF prevents angiogenesis: a hypothesized pathway. Med Hypotheses 2005;64:74–78.
- 16.↑
Dawson DW, Volpert OV, Gillis P, et al. Pigment epitheliumderived factor: a potent inhibitor of angiogenesis. Science 1999;285:245–248.
- 17.↑
Volpert OV, Zaichuk T, Zhou W, et al. Inducer-stimulated Fas targets activated endothelium for destruction by anti-angiogenic thrombospondin-1 and pigment epithelium-derived factor. Nat Med 2002;8:349–357.
- 18.↑
Tombran-Tink J, Barnstable CJ. Therapeutic prospects for PEDF: more than a promising angiogenesis inhibitor. Trends Mol Med 2003;9:244–250.
- 19.
Zhang SX, Wang JJ, Gao G, et al. Pigment epithelium-derived factor (PEDF) is an endogenous antiinflammatory factor. FASEB J 2006;20:323–325.
- 20.↑
Wang JJ, Zhang SX, Mott R, et al. Salutary effect of pigment epithelium-derived factor in diabetic nephropathy: evidence for antifibrogenic activities. Diabetes 2006;55:1678–1685.
- 21.↑
Lévesque V, Fayad T, Ndiaye K, et al. Size-selection of cDNA libraries for the cloning of cDNAs after suppression subtractive hybridization. Biotechniques 2003;35:72–78.
- 22.↑
Bédard J, Brule S, Price CA, et al. Serine protease inhibitor-E2 (SERPINE2) is differentially expressed in granulosa cells of dominant follicle in cattle. Mol Reprod Dev 2003;64:152–165.
- 23.↑
Ndiaye K, Fayad T, Silversides DW, et al. Identification of downregulated messenger RNAs in bovine granulosa cells of dominant follicles following stimulation with human chorionic gonadotropin. Biol Reprod 2005;73:324–333.
- 24.↑
Tombran-Tink J. The neuroprotective and angiogenesis inhibitory serpin, PEDF: new insights into phylogeny, function, and signalling. Front Biosci 2005;1:2131–2149.
- 25.↑
Singh VK, Chader GJ, Rodriguez IRL. Structural and comparative analysis of the mouse gene for pigment epithelium-derived factor (PEDF). Mol Vis 1998;4:7–12.
- 26.↑
Becerra SP, Sagasti A, Spinella P, et al. Pigment epithelium-derived factor behaves like a noninhibitory serpin. Neurotrophic activity does not require the serpin reactive loop. J Biol Chem 1995;270:25992–25999.
- 27.↑
Petersen SV, Valnickova Z, Enghild JJ. Pigment-epithelium-derived factor (PEDF) occurs at a physiologically relevant concentration in human blood: purification and characterization. Biochem J 2003;374:199–206.
- 28.
Takenaka K, Yamagishi S, Jinnouchi Y, et al. Pigment epithelium-derived factor (PEDF)-induced apoptosis and inhibition of vascular endothelial growth factor (VEGF) expression in MG63 human osteosarcoma cells. Life Sci 2005;77:3231–3241.
- 29.↑
Aparicio S, Sawant S, Lara N, et al. Expression of angiogenesis factors in human umbilical vein endothelial cells and their regulation by PEDF. Biochem Biophys Res Commun 2005;326:387–394.
- 30.↑
Francis MK, Appel S, Meyer C, et al. Loss of EPC1/PEDF expression during skin aging in vivo. J Invest Dermatol 2004;122:1096–1105.
- 31.
Spranger J, Osterhoff M, Reimann M, et al. Loss of the antiangiogenic pigment epithelium-derived factor in patients with angiogenic eye disease. Diabetes 2001;50:2641–2645.
- 32.
Holekamp NM, Bouck N, Volpert O. Pigment epithelium-derived factor is deficient in the vitreous of patients with choroidal neovascularization due to age-related macular degeneration. Am J Ophthalmol 2002;134:220–227.
- 33.↑
Pignolo RJ, Francis MK, Rotenberg MO, et al. Putative role for EPC-1/PEDF in the G0 growth arrest of human diploid fibroblasts. J Cell Physiol 2003;195:12–20.
