Endotoxemia is a leading cause of morbidity and fatalities in adult horses and foals,1 and it has been associated with acute abdominal disease, laminitis, strenuous exercise, and neonatal sepsis.2,3 Current methods of treatment often are ineffective; hence, there is a need for new therapeutic approaches.
The hydrophobic lipid A region of LPS (ie, endotoxin) is responsible for initiating various innate immune responses that result in development of the systemic inflammatory response syndrome. Because the lipid A region is relatively conserved among a variety of gram-negative bacteria, this molecule is an attractive target for the development of LPS antagonists.4 Lipid A and LPS isolated from Rhodobacter sphaeroides as well as E5531 (a synthetic analogue of the lipid A region from Rhodobacter capsulatus) are potent inhibitors of enteric LPS in several species. For example, diphosphoryl lipid A from R sphaeroides inhibits cytokine release in response to cell stimulation by enteric LPS in murine5,6 and human7 cells, expression of LPS-inducible genes,8 and binding of enteric LPS to a murine cell line.9 In vivo experiments have identified an inhibitory effect of this lipid A on LPS-induced lethality in mice.10
Compound E5531 acts as an LPS antagonist in murine and human cells as well as in whole blood,11,12 protects mice after injection with a lethal dose of viable Escherichia coli bacteria,13 and completely blocks signs and symptoms attributable to sepsis in human volunteers with experimentally induced endotoxemia.14 However, results of studies15,16 indicate that R sphaeroides LPS and E5531 both elicit strong proinflammatory responses in equine cells and equine whole blood, which makes it impossible to use these compounds in the treatment of endotoxemic horses.
Compound E5564 (eritoran tetrasodium) is a second-generation synthetic lipid A analogue derived from the structure of R sphaeroides. It is approximately 10 times as potent, has a longer duration of action, and is more stable than E5531.4 In addition, E5564 blocks the action of LPS at its cell-surface receptor (Toll-like receptor 4), thereby preventing in vitro and in vivo induction of cellular mediators in rodents and humans17 and improving survival in LPS-challenged mice.18 Furthermore, E5564 completely blocks the effects of experimentally induced endotoxemia in humans but does not have agonistic LPS-like activity.19 Currently, E5564 is in phase III clinical trials in human patients with severe sepsis.
To determine the therapeutic potential of this compound in horses, there were 2 objectives for the study reported here. The first was to evaluate E5564 for proinflammatory effects in equine peripheral whole blood and isolated monocytes. The second was to evaluate the ability of E5564 to prevent LPS-induced expression of proinflammatory and anti-inflammatory cytokine genes by equine monocytes. We hypothesized that E5564 would not induce agonist responses but would antagonize the effects of enteric LPS in equine whole blood and monocytes and inhibit LPS-induced expression of mRNA for TNF-α, IL-1B, IL-6, and IL-10 by monocytes.
Materials and Methods
Horses—A group of 19 adult horses determined to be healthy on the basis of clinical examination was used for the study. A venipuncture site over a jugular vein on each horse was aseptically prepared, and blood samples were collected. The Animal Care and Use Committee at the University of Georgia approved the experimental protocol.
Preparation of LPS and E5564—Lipopolysaccharidea was reconstituted in DPBSSb without calcium and magnesium (LPS concentration, 1 mg/mL). Prior to use, LPS was sonicated for 60 seconds and further diluted in RPMI 1640c containing 1% HIFBS.20,d Compound E5564e was reconstituted in RPMI 1640 at a concentration of 100μM and further diluted in the same medium. All experiments were conducted in triplicate for each horse.
Stimulation of whole blood—Heparinizedf whole blood (1 U of heparin/mL) was divided into aliquots and placed in 1.5-mL microcentrifuge tubes. In preliminary experiments that involved use of a limited range of concentrations (10, 100, or 1,000nM), E5564 was tested for agonist activity in whole blood samples obtained from 3 healthy horses. In addition, E coli O111: B4 LPS (1 ng/mL) was included as a positive control sample in these experiments.
In an additional set of experiments that involved use of a wider range of concentrations of LPS, it was determined that 300 pg/mL was the lowest concentration to yield the maximal increase in TNF-α production. In subsequent experiments, E5564 was evaluated for antagonist effects in whole blood samples obtained from 7 healthy horses. In those experiments, LPS was added to achieve a final concentration of 300 pg/mL, and E5564 was added to achieve final concentrations of 0.01, 0.1, 1, 10, 100, 1,000, and 10,000nM. Additional DPBSS was added to bring the total volume of cells and reagents to 1 mL. Samples were incubated on an orbital mixer at 37°C for 6 hours. At the end of the incubation period, plasma was collected by centrifugation (6,000 × g at 4°C for 10 minutes) and stored frozen (−80°C) until assayed for TNF-α.
Stimulation of monocytes—Mononuclear cells were isolated by density-gradient centrifugation with a solution of polysucrose and sodium diatrizoate.20,g One-milliliter aliquots containing 4 × 106 mononuclear cells were added to sterile 12 × 75-mm polysterene tubes and incubated for 2 hours (37°C and 5% carbon dioxide). After incubation, nonadherent cells were removed with 1 wash of warm RPMI 1640. Adherent monocytes were overlaid with RPMI 1640 containing 100 U of penicillin/mL and 100 μg of streptomycin/mL.h Control samples used in the study contained 1% HIFBS in RPMI 1640 (negative control sample) and E coli O111:B4 LPS (100 pg/mL) in RPMI 1640 with 1% HIFBS (positive control sample). To test for agonist activity of E5564, cells from 6 healthy horses were incubated in culture medium containing E5564 or its vehiclei at final concentrations of 0.1, 1, 10, 100, and 1,000nM. To test for antagonist activity of E5564, cells from 19 horses were incubated with E5564 at final concentrations of 0.1, 1, 10, 100, and 1,000nM for 15 minutes and then stimulated with E coli O111:B4 LPS (100 pg/mL). To measure the potency of E5564, monocytes were incubated with RPMI 1640 containing 1 of 4 concentrations of E5564 (0.1, 1, 10, and 100nM) and E coli O111:B4 LPS at 0.0001, 0.001, 0.01, 0.1, 1, 10, and 100 ng/mL. Cells were incubated for 6 hours (37°C and 5% carbon dioxide), after which cell lysates and supernatants were assayed for PCA and TNF-α, respectively.
TNF-α assays—The TNF-α activity in whole blood samples was determined by modification of an in vitro cytotoxicity bioassay that used the murine fibrosarcoma cell line WEHI-164 clone 13, as described elsewhere.21 The TNF-α protein concentration in whole blood and monocyte cell supernatants was measured by use of an equine TNF-α ELISA (developed with commercially available reagents) and a recombinant equine TNF-α standard.j Standard ELISA platesk (96-well flat-bottom plates) were coated with equine TNF-α polyclonal antibodyl that recognized equine TNF-α. The antibody was diluted 1:333 in a 0.05M carbonate-bicarbonate bufferm (pH, 9.6), and 100 μL of antibody was added to each well. Microtiter plates were incubated overnight at 4°C, after which antibody was removed and the wells were filled with 100 μL of blocking buffer (1% bovine serum albuminn in 1X DPBSS). Plates were incubated for 1 hour at 24°C. Then plates were washed 3 times with DPBST.o Next, 100 μL of each sample or standard was added to duplicate wells, and plates were incubated at 37°C for 2 hours. Plates were washed 3 times with DPBST. Equine TNF-α biotin-labeled polyclonal antibodyp against TNF-α was diluted 1:277 in DPBST, and 100 μL was added to each well. Plates were incubated at 37°C for 90 minutes, after which they were washed 3 times with DPBST. Next, 100 μL of avidin-horseradish peroxidase,q diluted 1:5,000 in DPBST, was added to each well and incubated for 1 hour at 37°C. Plates were then washed 5 times with DPBST. Finally, 100 μL of substrater was added to each well. Plates were incubated for 30 minutes at 24°C and measurements made at 405 nm on an automated microplate reader.s
PCA assay—An automated 1-stage clotting assayt was used to determine the effects of cell lysates on calcium-induced clotting of pooled equine plasma. The PCA of samples was determined by comparing the results with those obtained for a standard curve generated by use of equine brain thromboplastin.20
RNA extraction and cDNA synthesis—Mononuclear cells were isolated by density-gradient centrifugation with a solution of polysucrose and sodium diatrizoate.20 Approximately 8 × 107 mononuclear cells were added to sterile 150 × 15-mm Petri dishes and incubated for 2 hours (37°C and 5% carbon dioxide). After incubation, nonadherent cells were removed with 1 wash of warm RPMI 1640. Adherent monocytes were overlaid with RPMI 1640 containing 100 U of penicillin/mL and 100 μg of streptomycin/mL. Monocytes were incubated for 1 hour and 4 hours in media alone (nonstimulated control sample), media containing E5564 (100nM), media containing E coli O111:B4 LPS (100 pg/mL), or media containing E5564 and E coli O111:B4 LPS. After incubation, cells were washed with cold DPBSS and scraped from the plates, isolated by centrifugation, suspended and homogenized in lysis solution,u and stored at −80°C. Cell pellets were thawed and total RNA was extracted by use of a commercially available kitv (performed in accordance with the manufacturer's protocol) and treated by incubation with DNase Iw at 24°C for 30 minutes. Only samples with 260:280-nm absorbance ratios between 2.0 and 2.2 (as measured on the spectrophotometer) were processed for cDNA synthesis with a commercially available kit.x
Real-time quantification of mRNA expression—A real-time qPCR assay that used a nucleic acid dyey was performed in a sequence detection system,z with 18S ribosomal RNAaa used as an endogenous control sample. Conditions for the detection system were 2 minutes at 50°C, 10 minutes at 95°C, 40 cycles of 15 s/cycle at 95°C, and 60 seconds at 60°C. Oligonucleotide primers used for the detection of cDNA specific for equine cytokines were derived from the GenBank database and designed by use of commercially available softwarebb (Appendix). The PCR assays contained 300nM of each primer, a master mix, and 2 μL of the diluted cDNA sample in a final volume of 10 μL. Intra-assay variation was evaluated with a pooled cDNA sample prepared from RNA of cells stimulated with E coli O111:B4 LPS (100 pg/mL). Changes in cytokine expression were calculated by relative quantification against 18s ribosomal RNA by use of the $$CT method and plain media used as the calibrator. Fold changes in gene expression among treatments for each sample were calculated as 2−δδCT.
Data analysis—Data were analyzed by fitting a logistic expression to concentration-response data by use of commercial software.cc This analysis allowed determination of IC50 and maximum response values with associated 95% CIs. The affinity constant for E5564 as an antagonist of the E coli O111:B4 LPS concentration–response curve was derived from Schild analysis.22 Plots of the logarithm (dose ratio −1) as a function of the negative logarithm of the concentration of the antagonist were analyzed by linear regression. The pA2 values were determined from the intercept of the regression line with the x-axis on the Schild plots.23 Gene expression of proinflammatory cytokines was analyzed by use of an unpaired t test with the Welch correction. Significance was set at P < 0.05. All data were reported as mean ± SE. Because of the horse-to-horse variation in LPS-induced production of TNF-α and expression of PCA, all data were reported as a percentage of the maximal response to LPS.
Results
Effects of E coli LPS and E5564 in equine whole blood—Activity and protein production of TNF-α in whole blood incubated with E coli O111:B4 LPS increased significantly in all horses (data not shown), whereas E5564 at final concentrations of 10, 100, and 1,000nM did not stimulate TNF-α activity. TNF-α activity in whole blood incubated with E5564 was not significantly different from values for DPBSS (DPBSS, 4.6 ± 0.8 U/mL; 10nM E5564, 3.8 ± 0.6 U/mL; 100nM E5564, 4.5 ± 0.8 U/mL; and 1,000nM E5564, 3.5 ± 0.7 U/mL); however, it did differ significantly (P = 0.04) from values obtained with E coli O111:B4 LPS at 1 ng/mL (19.2 ± 0.8 U/mL). To assess the ability of E5564 to antagonize LPS-induced TNF-α production, whole blood was coincubated with these compounds. Analysis of the results of these experiments indicated that E5564 inhibited LPS-induced TNF-α protein production in a concentration-dependent manner, with a calculated IC50 value of 0.9nM (95% CI, 0.4 to 1.9nM; Figure 1).
Production of TNF-α protein in equine whole blood incubated with Escherichia coli O111:B4 LPS (300 pg/mL) and the second-generation synthetic lipid A analogue E5564 (10pM to 10μM). Results are expressed as the mean ± SE percentage of the maximal response to E coli LPS (assigned a value of 100%) for samples obtained from 7 horses. The IC50 is 0.9nM (95% CI, 0.4 to 1.9nM).
Citation: American Journal of Veterinary Research 69, 6; 10.2460/ajvr.69.6.796
Effects of E5564 on isolated monocytes—Monocyte production of TNF-α protein and expression of PCA were increased by incubation with E coli O111:B4 LPS. Use of E5564 inhibited LPS-induced TNF-α protein production and PCA expression in isolated equine monocytes in a concentration-dependent manner, with calculated IC50 values of 4.6nM (95% CI, 1.7 to 12nM) and 4.4nM (95% CI, 1.8 to 11nM), respectively (Figures 2 and 3). Analysis of Schild plots of pooled LPS concentration–PCA response curves for 3 horses performed by use of 4 concentrations of E5564 yielded a pA2 value of 10.17 and a slope of 1.04 (Figure 4). Monocytes incubated with medium alone, E5564 alone, or vehicle did not express PCA (data not shown).
Production of TNF-α protein in supernatants of monocytes incubated with E coli O111:B4 LPS (100 pg/mL) and E5564 (0.1nM to 1μM). Results are expressed as the mean ± SE percentage of the maximal response (ie, 100%) to E coli LPS for samples obtained from 6 horses. The IC50 is 4.6nM (95% CI, 1.7 to 12nM).
Citation: American Journal of Veterinary Research 69, 6; 10.2460/ajvr.69.6.796
Expression of PCA by monocytes coincubated with E coli O111:B4 LPS (100 pg/mL) and E5564 (10pM to 1μM). Results are expressed as the mean ± SE percentage of the maximal response (ie, 100%) to E coli LPS for samples obtained from 19 horses. The IC50 is 4.4nM (95% CI, 1.8 to 11nM).
Citation: American Journal of Veterinary Research 69, 6; 10.2460/ajvr.69.6.796
Schild plot of the effect of various concentrations of E5564 (0.1 to 100nM) on inhibition of LPS-induced PCA on monocytes obtained from 3 horses. In this plot, dose ratio (DR) is calculated from EC50 values determined for LPS in monocytes incubated with and without E5564. The value for pA2 derived from these analyses was 10.17 (95% CI, 9.67 to 11.0), with a slope of 1.04.
Citation: American Journal of Veterinary Research 69, 6; 10.2460/ajvr.69.6.796
Effects of E5564 on expression of proinflammatory and anti-inflammatory cytokine mRNA—The concentrations of RNA isolated and the CT values for 18s ribosomal RNA did not vary significantly among samples (data not shown). Analysis of real-time qPCR dissociation curves revealed single products for TNF-α, IL-1B, IL-6, and IL-10. The PCR amplification efficiency was approximately 100%, and all primers passed the validation experiment, which indicated that the efficiencies of the target amplification and reference (18s ribosomal RNA endogenous control sample) amplification were approximately equal. Expression of mRNA for TNF-α, IL-1B, IL-6, and IL-10 were increased by incubation with E coli O111:B4 LPS (Figure 5). Use of E5564 significantly inhibited LPS-induced TNF-α mRNA expression at 1 hour, but the inhibition was not significant (P = 0.06) at 4 hours. In addition, E5564 significantly inhibited LPS-induced IL-1B mRNA expression at 1 and 4 hours. There was no significant effect of E5564 on LPS-induced IL-6 gene expression at 1 or 4 hours, although the pattern of modulation was similar to that for the other cytokines. The LPS-induced expression of mRNA for the anti-inflammatory cytokine IL-10 was significantly inhibited by E5564 at 1 hour, but the inhibition was not significant (P = 0.07) at 4 hours. There was no significant difference in cytokine mRNA expression between values obtained from monocytes incubated with E5564 alone and E5564 plus LPS at 1 or 4 hours.
Effects of E5564 on LPS-induced expression of genes for TNF-α (A), IL-1B (B), IL-6, (C), and IL-10 (D) at 1 and 4 hours of incubation in samples obtained from 5 horses. Results are expressed as the fold change in mRNA expression from that for medium alone. The horizontal bar within each box represents the median value; the bottom and top of each box represent the first and third quartiles, respectively; and the bars represent the range of the data. *Within a time point, the value differs significantly (P < 0.05) from the value for LPS.
Citation: American Journal of Veterinary Research 69, 6; 10.2460/ajvr.69.6.796
Discussion
To assess the therapeutic potential of E5564 in horses, we investigated the pharmacologic actions of this compound by monitoring the synthesis of TNF-α in equine peripheral whole blood and isolated monocytes, expression of PCA by monocytes, and alteration of mRNA expression for 3 proinflammatory and 1 antiinflammatory mediator that play important roles in the response of horses to LPS.24
In contrast to results reported for LPS from R sphaeroides and E5531, a first-generation lipid A analogue, E5564 did not have agonist activity in equine whole blood or in isolated equine monocytes. Although E5531 and E5564 have similar structures, E5564 lacks a secondary side chain at position 3' and there is an extended side chain with a cis-double bond at position 2'.18 The mechanisms responsible for the agonist activity of E5531 in equine whole blood are unknown, but it is possible that the activity of the drug may be modified in whole blood as a result of deacylation.15
In 1 study,25 it was reported that neither E5664 nor its vehicle stimulated production of TNF-α after IV injection in mice, guinea pigs, and rats. In another study,26 it was reported that E5564 was safe for use in healthy male humans who received a 30-minute IV infusion of 0.35 to 3.5 mg. In the study reported here, we determined that E5564 at all concentrations evaluated (10 to 1,000nM) did not stimulate TNF-α production in equine whole blood, nor did it induce expression of PCA in monocytes for a similar concentration range (0.1 to 1,000nM). The IC50 values identified in this study for inhibition of LPS-induced TNF-α protein production in equine whole blood (0.9nM) and supernatants of monocytes (4.6nM) and for expression of PCA by monocytes (4.4nM) were similar to those reported for inhibition of TNF-α production by human (1.6nM) and murine (20nM) cells.25 Collectively, these findings suggest that E5564, in contrast to other LPS antagonists, should be safe for administration to horses, although in vivo studies will need to be performed before this compound can be used in the treatment of horses with endotoxemia.
To test the ability of E5564 to prevent expression of a membrane-bound proinflammatory mediator, we evaluated the effect of the compound on LPS-induced PCA expression in monocytes. Procoagulant activity, which is also called tissue factor or thromboplastin, reflects the ability of stimulated cells to decrease the coagulation time of plasma.20,27 When LPS is included, PCA expression is increased by circulating cells (particularly monocytes) and endothelial cells.28 The importance of PCA in horses was exemplified by the fact that an increase in monocyte PCA has been significantly associated with coagulopathy and poor prognosis in horses with colic.29 Furthermore, activation of coagulation by increased PCA of cells initiates pathologic responses, such as disseminated intravascular coagulation, which is important in the pathogenesis of sepsis-associated organ injury.30,31 Our finding that E5564 significantly reduced expression of PCA by equine monocytes incubated with LPS suggested that this compound may be of use in endotoxemic horses at increased risk for development of coagulopathy.
In the study reported here, TNF-α activity and TNF-α protein production were measured with an in vitro cytotoxicity bioassay and ELISA, respectively. In the first experiment performed, the bioassay was used to evaluate E5564 at concentrations ≤ 1,000nM for potential agonist activity in whole blood. Once it was determined that the compound lacked significant agonist activity in that concentration range, experiments were then designed to assess the ability of E5564 to antagonize the effects of LPS. Because of the labor-intensive nature of the bioassay, those experiments were performed with a newly established ELISA for equine TNF-α. To ensure a sufficient number of data points from which to calculate an IC50 value for E5564, the concentration range was extended to include 10,000nM. Because E5564 at 10,000nM (when LPS was included) did not result in production of TNF-α as determined by results for the ELISA, it is highly unlikely that this concentration would have agonist effects on its own.
In the subsequent experiments, isolated equine monocytes were incubated with E5564 before LPS was added. On the basis of the encouraging results obtained with this study design, additional experiments were then performed in which LPS and E5564 were added simultaneously to whole blood samples in an effort to more closely simulate events in some clinical settings. Although it would have been optimal to measure other cytokine proteins, there are no validated equine cytokine protein assays other than the one for TNF-α. Although the horse-to-horse variability in response to LPS was large (5- to 30-fold, depending on the mediator), the inhibitory effects of E5564 were consistent. This variation in response to LPS is in keeping with the results of other studies32,33 on the effects of LPS in horses.
Tumor necrosis factor-A is a central mediator synthesized in response to LPS.34 As such, it induces production of inflammatory factors (such as IL-1B and IL-6), activates inflammatory cells, increases expression of adhesion molecules, and increases production of nitric oxide and reactive oxygen species.35 Increases in serum concentrations of TNF-α are detected in septic neonates and in horses with colic.36,37 Therefore, TNF-α is often used as a reliable, representative indicator of activation of inflammatory cells.24 The biological activity of IL-1B is similar to that of TNF-α because both induce the systemic inflammatory response syndrome. Interleukin-6 is responsible for inducing the synthesis of acute-phase proteins2,35 and can have anti-inflammatory properties.38 Interleukin-10 is an anti-inflammatory cytokine that inhibits production of TNF-α, IL-1B, and IL-6.39 Increases in concentrations of IL-10 have been reported in patients with sepsis and humans with experimentally induced endotoxemia.40,41,42
In the study reported here, E5564 clearly prevented E coli LPS–induced expression of mRNA for TNF-α, IL-1B, and IL-10. These findings are consistent with the fact that E5564 inhibits intracellular production of TNF-α and IL-6 in LPS-stimulated human monocytes, as assessed by flow cytometry.43 Of the 4 genes monitored in our study, expression of IL-6 and IL-10 in response to LPS varied most among the horses. Three of 5 horses had modest increases in IL-6 and IL-10 mRNA in response to LPS, whereas the other 2 horses expressed considerably more IL-6 and IL-10 mRNA. Despite this inherent horse-to-horse variability in gene expression in response to LPS, E5564 reduced expression of mRNA for all 4 cytokines in all horses to values that were indistinguishable from those identified for monocytes incubated in E5564 alone. The 2 time points (1 hour and 4 hours) were chosen to evaluate early gene response (TNF-α) and a later gene response (IL-1B, IL-6, and IL-10), similar to studies conducted by others.44,45,46 Additional studies would be needed to determine whether E5564 prevents E coli LPS–induced expression of mRNA for TNF-α, IL-1B, IL-6, and IL-10 at later time points.
Treatment of patients with endotoxemia involves IV administration of fluids and use of nonsteroidal anti-inflammatory drugs and antimicrobials.47 The use of nonsteroidal anti-inflammatory drugs in horses has potential adverse effects, such as development of gastrointestinal ulcers and renal papillary necrosis.48 The use of antimicrobials in patients with endotoxemia is controversial. Synthetic lipid A analogues inhibit LPS interaction with cells and prevent initiation of intracellular signaling pathways. Therefore, concurrent treatment with a lipid A antagonist could halt or reduce undesired inflammatory responses during endotoxemia. Other treatments with similar activity used in horses with endotoxemia are polymyxin B and anti-LPS hyperimmune plasma. Polymyxin B is a polycationic antimicrobial that has the ability to bind and neutralize LPS. Studies49,50 have revealed beneficial effects of polymyxin B in horses with endotoxemia; however, the use of hyperimmune plasma has yielded conflicting results.51,52
Analysis of results of the study reported here indicated that E5564 lacked agonist activity in equine whole blood and monocytes and was a potent antagonist of enteric LPS. Furthermore, E5564 inhibited LPS-induced expression of PCA; TNF-α protein production; and mRNA expression of TNF-α, IL-1B, and IL-10. Therefore, E5564 appears to have potential as an effective therapeutic agent in horses with endotoxemia.
ABBREVIATIONS
| CI | Confidence interval |
| ΔΔCT | Delta delta cycle threshold |
| DPBSS | Dulbecco phosphate-buffered saline solution |
| DPBST | Dulbecco phosphate-buffered saline solution containing 0.05% Tween 20 |
| EC50 | Concentration that produces 50% of the maximum plateau effect |
| HIFBS | Heat-inactivated fetal bovine serum |
| IC50 | Concentration that produces 50% of maximum inhibition |
| IL | Interleukin |
| LPS | Lipopolysaccharide |
| pA2 | Negative logarithm of the E5564 dissociation constant |
| PCA | Procoagulant activity |
| qPCR | Quantitative PCR |
| TNF | Tumor necrosis factor |
Escherichia coli O111:B4 LPS, List Biological Laboratories Inc, Campbell, Calif.
Dulbecco phosphate-buffered saline, Mediatech Inc, Herndon, Va.
Media RPMI-1640 1X with L-glutamine, Mediatech Inc, Herndon, Va.
Fetal bovine serum, Hyclone Laboratories Inc, Logan, Utah.
Provided by the Eisai Research Institute, Andover, Mass.
Heparin sodium (1,000 U/mL), American Pharmaceutical Partners Inc, Los Angeles, Calif.
Histopaque 1077, Sigma-Aldrich Inc, St Louis, Mo.
Penicillin-streptomycin solution (10,000 U of penicillin/mL, 10 μg of streptomycin/mL), Mediatech Inc, Herndon, Va.
E5564 vehicle, Eisai Company Ltd, Tokyo, Japan.
Recombinant equine TNF-α, Pierce Endogen, Rockford, Ill.
Immulon 4 HBX, Thermo, Milford, Mass.
Equine TNF-α PAb, Pierce Endogen, Rockford, Ill.
Carbonate-bicarbonate buffer capsules, Sigma-Aldrich Inc, St Louis, Mo.
Bovine serum albumin, Sigma-Aldrich Inc, St Louis, Mo.
Tween 20, Cayman Chemical Co, Ann Arbor, Mich.
Equine TNF-α biotin-labeled PAb, Pierce Endogen, Rockford, Il.
Avidin-horseradish peroxidase, BD Pharmingen, San Diego, Calif.
ABTS Peroxidase Stop Solution kit, Kirkegaard & Perry Laboratories Inc, Gaithersburg, Md.
Dynex MRX II, Dynex Technology Inc, Chantilly, Va.
ACL Coulter 1000, Instrumentation Laboratory, Lexington, Mass.
Lysis solution, Gentra Systems Inc, Minneapolis, Minn.
Versagene RNA purification kit, Gentra Systems Inc, Minneapolis, Minn.
DNAse I, Gentra Systems Inc, Minneapolis, Minn.
High Capacity cDNA archive kit, Applied Biosystems, Foster City, Calif.
SYBR Green PCR master mix, Applied Biosystems, Foster City, Calif.
ABI 7900HT, Applied Biosystems, Foster City, Calif.
Human 18s rRNA, Applied Biosystems, Foster City, Calif.
Primer Express software, Applied Biosystems, Foster City, Calif.
GraphPad Software, San Diego, Calif.
References
- 1.↑
Tinker MK, White NA, Lessard P, et al. Prospective study of equine colic incidence and mortality. Equine Vet J 1997;29:448–453.
- 2.
Werners AH, Bull S, Fink-Gremmels J. Endotoxaemia: a review with implications for the horse. Equine Vet J 2005;37:371–383.
- 3.
Moore JN, Barton MH. Treatment of endotoxemia. Vet Clin North Am Equine Pract 2003;19:681–695.
- 4.↑
Hawkins LD, Christ WJ, Rossignol DP. Inhibition of endotoxin response by synthetic TLR4 antagonists. Curr Top Med Chem 2004;4:1147–1171.
- 5.
Takayama K, Qureshi N, Beutler B, et al. Diphosphoryl lipid A from Rhodopseudomonas sphaeroides ATCC 17023 blocks induction of cachectin in macrophages by lipopolysaccharide. Infect Immun 1989;57:1336–1338.
- 6.↑
Qureshi N, Takayama K, Kurtz R. Diphosphoryl lipid A obtained from the nontoxic lipopolysaccharide of Rhodopseudomonas sphaeroides is an endotoxin antagonist in mice. Infect Immun 1991;59:441–444.
- 7.↑
Golenbock DT, Hampton RY, Qureshi N, et al. Lipid A-like molecules that antagonize the effects of endotoxins on human monocytes. J Biol Chem 1991;266:19490–19498.
- 8.↑
Manthey CL, Perera PY, Qureshi N, et al. Modulation of lipopolysaccharide-induced macrophage gene expression by Rhodobacter sphaeroides lipid A and SDZ 880.431. Infect Immun 1993;61:3518–3526.
- 9.↑
Lei MG, Qureshi N, Morrison DC. Lipopolysaccharide (LPS) binding to 73-kDa and 38-kDa surface proteins on lymphoreticular cells: preferential inhibition of LPS binding to the former by Rhodopseudomonas sphaeroides lipid A. Immunol Lett 1993;36:245–250.
- 10.↑
Zuckerman SH, Qureshi N. In vivo inhibition of lipopolysaccharide-induced lethality and tumor necrosis factor synthesis by Rhodobacter sphaeroides diphosphoryl lipid A is dependent on corticosterone induction. Infect Immun 1992;60:2581–2587.
- 11.
Kobayashi S, Kawata T, Kimura A, et al. Suppression of murine endotoxin response by E5531, a novel synthetic lipid A antagonist. Antimicrob Agents Chemother 1998;42:2824–2829.
- 12.
Loppnow H, Libby P, Freudenberg M, et al. Cytokine induction by lipopolysaccharide (LPS) corresponds to lethal toxicity and is inhibited by nontoxic Rhodobacter capsulatus LPS. Infect Immun 1990;58:3743–3750.
- 13.↑
Christ WJ, Asano O, Robidoux AL, et al. E5531, a pure endotoxin antagonist of high potency. Science 1995;268:80–83.
- 14.↑
Bunnell E, Lynn M, Habet K, et al. A lipid A analog, E5531, blocks the endotoxin response in human volunteers with experimental endotoxemia. Crit Care Med 2000;28:2713–2720.
- 15.↑
Bryant CE, Ouellette A, Lohmann K, et al. The cellular Toll-like receptor 4 antagonist E5531 can act as an agonist in horse whole blood. Vet Immunol Immunopathol 2007;116:182–189.
- 16.
Lohmann KL, Vandenplas M, Barton MH, et al. Lipopolysaccharide from Rhodobacter sphaeroides is an agonist in equine cells. J Endotoxin Res 2003;9:33–37.
- 17.↑
Rossignol DP, Christ WJ, Hawkins LD, et al. Synthetic endotoxin antagonists. In: Brade H,Opal SM,Vogel SN, et al, eds. Endotoxin in health and disease. New York: Marcel Dekker, 1999;699–717.
- 18.↑
Rossignol DP, Lynn M. Antagonism of in vivo and ex vivo response to endotoxin by E5564, a synthetic lipid A analogue. J Endotoxin Res 2002;8:483–488.
- 19.↑
Lynn M, Wong YN, Wheeler JL, et al. Extended in vivo pharmacodynamic activity of E5564 in normal volunteers with experimental endotoxemia. J Pharmacol Exp Ther 2004;308:175–181.
- 20.↑
Okano S, Hurley DJ, Vandenplas ML, et al. Effect of fetal bovine serum and heat-inactivated fetal bovine serum on microbial cell wall-induced expression of procoagulant activity by equine and canine mononuclear cells in vitro. Am J Vet Res 2006;67:1020–1024.
- 21.↑
Morris DD, Moore JN, Fischer K, et al. Endotoxin-induced tumor necrosis factor activity production by equine peritoneal macrophages. Circ Shock 1990;30:229–236.
- 22.↑
Arunlakshana O, Schild HO. Some quantitative uses of drug antagonists. Br J Pharmacol Chemother 1959;14:48–58.
- 23.↑
MacKay D. How should values of pA2 and affinity constants for pharmacological competitive antagonists be estimated? J Pharm Pharmacol 1978;30:312–313.
- 24.↑
Morris DD. Endotoxemia in horses. A review of cellular and humoral mediators involved in its pathogenesis. J Vet Intern Med 1991;5:167–181.
- 25.↑
Mullarkey M, Rose JR, Bristol J, et al. Inhibition of endotoxin response by E5564, a novel Toll-like receptor 4-directed endotoxin antagonist. J Pharmacol Exp Ther 2003;304:1093–1102.
- 26.↑
Wong YN, Rossignol D, Rose JR, et al. Safety, pharmacokinetics, and pharmacodynamics of E5564, a lipid A antagonist, during an ascending single-dose clinical study. J Clin Pharmacol 2003;43:735–742.
- 27.
Henry MM, Moore JN. Endotoxin-induced procoagulant activity in equine peripheral blood monocytes. Circ Shock 1988;26:297–309.
- 28.↑
Mackman N. Role of tissue factor in hemostasis and thrombosis. Blood Cells Mol Dis 2006;36:104–107.
- 29.↑
Henry MM, Moore JN. Clinical relevance of monocyte procoagulant activity in horses with colic. J Am Vet Med Assoc 1991;198:843–848.
- 30.
Osterud B, Bjorklid E. The tissue factor pathway in disseminated intravascular coagulation. Semin Thromb Hemost 2001;27:605–617.
- 31.
Vickers J, Russwurm S, Dohrn B, et al. Monocyte tissue factor (CD142) and Mac-1 (CD11b) are increased in septic patients. Thromb Haemost 1998;79:1219–1220.
- 32.
Werners AH, Bull S, Vendrig JC, et al. Genotyping of Toll-like receptor 4, myeloid differentiation factor 2 and CD-14 in the horse: an investigation into the influence of genetic polymorphisms on the LPS induced TNF-alpha response in equine whole blood. Vet Immunol Immunopathol 2006;111:165–173.
- 33.
Baskett A, Barton MH, Norton N, et al. Effect of pentoxifylline, flunixin meglumine, and their combination on a model of endotoxemia in horses. Am J Vet Res 1997;58:1291–1299.
- 34.↑
Beutler B, Milsark IW, Cerami AC. Passive immunization against cachectin/tumor necrosis factor protects mice from lethal effect of endotoxin. Science 1985;229:869–871.
- 35.↑
Mei YQ, Ji Q, Liu H, et al. Study on the relationship of APACHE III and levels of cytokines in patients with systemic inflammatory response syndrome after coronary artery bypass grafting. Biol Pharm Bull 2007;30:410–414.
- 36.
Morris DD, Moore JN, Crowe N. Serum tumor necrosis factor activity in horses with colic attributable to gastrointestinal tract disease. Am J Vet Res 1991;52:1565–1569.
- 37.
Morris DD, Moore JN. Tumor necrosis factor activity in serum from neonatal foals with presumed septicemia. J Am Vet Med Assoc 1991;199:1584–1589.
- 38.↑
Barton BE. IL-6: insights into novel biological activities. Clin Immunol Immunopathol 1997;85:16–20.
- 39.↑
Moore KW, de Waal Malefyt R, Coffman RL, et al. Interleukin-10 and the interleukin-10 receptor. Annu Rev Immunol 2001;19:683–765.
- 40.
Marchant A, Deviere J, Byl B, et al. Interleukin-10 production during septicaemia. Lancet 1994;343:707–708.
- 41.
van der Poll T, de Waal Malefyt R, Coyle SM, et al. Antiinflammatory cytokine responses during clinical sepsis and experimental endotoxemia: sequential measurements of plasma soluble interleukin (IL)-1 receptor type II, IL-10, and IL-13. J Infect Dis 1997;175:118–122.
- 42.
O'Dwyer MJ, Mankan AK, Stordeur P, et al. The occurrence of severe sepsis and septic shock are related to distinct patterns of cytokine gene expression. Shock 2006;26:544–550.
- 43.↑
Czeslick E, Struppert A, Simm A, et al. E5564 (Eritoran) inhibits lipopolysaccharide-induced cytokine production in human blood monocytes. Inflamm Res 2006;55:511–515.
- 44.
Blanque R, Meakin C, Millet S, et al. Hypothermia as an indicator of the acute effects of lipopolysaccharides: comparison with serum levels of IL1 beta, IL6 and TNF alpha. Gen Pharmacol 1996;27:973–977.
- 45.
Hirotani T, Yamamoto M, Kumagai Y, et al. Regulation of lipopolysaccharide-inducible genes by MyD88 and Toll/IL-1 domain containing adaptor inducing IFN-beta. Biochem Biophys Res Commun 2005;328:383–392.
- 46.
Lin WJ, Yeh WC. Implication of Toll-like receptor and tumor necrosis factor alpha signaling in septic shock. Shock 2005;24:206–209.
- 47.↑
Shuster R, Traub-Dargatz J, Baxter G. Survey of diplomates of the American College of Veterinary Internal Medicine and the American College of Veterinary Surgeons regarding clinical aspects and treatment of endotoxemia in horses. J Am Vet Med Assoc 1997;210:87–92.
- 48.↑
MacAllister CG, Morgan SJ, Borne AT, et al. Comparison of adverse effects of phenylbutazone, flunixin meglumine, and ketoprofen in horses. J Am Vet Med Assoc 1993;202:71–77.
- 49.
Morresey PR, Mackay RJ. Endotoxin-neutralizing activity of polymyxin B in blood after IV administration in horses. Am J Vet Res 2006;67:642–647.
- 50.
Barton MH, Parviainen A, Norton N. Polymyxin B protects horses against induced endotoxaemia in vivo. Equine Vet J 2004;36:397–401.
- 51.
Spier SJ, Lavoie JP, Cullor JS, et al. Protection against clinical endotoxemia in horses by using plasma containing antibody to an Rc mutant E coli (J5). Circ Shock 1989;28:235–248.
- 52.
Durando MM, MacKay RJ, Linda S, et al. Effects of polymyxin B and Salmonella typhimurium antiserum on horses given endotoxin intravenously. Am J Vet Res 1994;55:921–927.
Appendix
Forward and reverse primers used for the detection of mRNA for equine TNF-α, IL-1β, IL-6, and IL-10 by use of a real-time qPCR assay.
| Cytokine | Genbank accession No. | Primer | Sequence (5′ to 3′) | Predicted size (bp) |
|---|---|---|---|---|
| Equine TNF-α | AB035735 | Forward | AAAGGACATCATGAGCACTGAAAG | 82 |
| Reverse | GGGCCCCCTGCCTTCT | |||
| Equine IL-1β | ECU92481 | Forward | ATGACTTACTGCAGCGGCAAT | 84 |
| Reverse | GTCTTGGAAGCTGCCCTTCA | |||
| Equine IL-6 | ECU64794 | Forward | TGCTGGCTAAGCTGCATTCA | 81 |
| Reverse | GGAAATCCTCAAGGCTTCGAA | |||
| Equine IL-10 | U38200 | Forward | GCCTTGTCGGAGATGATCCA | 101 |
| Reverse | TTTTCCCCCAGGGAGTTCAC |
