Materials and Methods

Isolation, identification, and sequence analysis of initial FCV—In April 2001, a young male cat named Bosco collapsed at a general practice veterinary clinic where treatment had been ongoing for the preceding 4 days. The cat was transferred to an animal emergency and critical care clinic. Several hours later, critical care treatments were unsuccessful and the cat developed severe hemorrhagic diarrhea, became comatose, and was euthanized. During necropsy, the peritoneal cavity contained bloody fluid, the small intestine was hemorrhagic, the liver was icteric, the lungs were diffusely hemorrhagic, and the intercostal muscles were hemorrhagic. Hepatic and intestinal tissue samples were submitted for virus examination to the Laboratory for Calicivirus Studies, College of Veterinary Medicine, Oregon State University.

A Vesivirus was successfully cultured from the icteric hepatic and hemorrhagic intestinal samples. Briefly, CrFK cells were inoculated with hepatic or intestinal homogenates from the infected cat and incubated at 37°C while being rotated in roller tubes at a rate of 0.33 revolutions/min. Cytopathic effect was evident for both the intestinal and hepatic tissue samples, and a virus with the morphologic features of calicivirus was detected by use of negative-stain direct electron microscopy. Subsequently, virus stocks with a high titer (10⁸ TCID₅₀ /mL) were cultured in CrFK cells, identified by use of FCV typing serum,¹⁷ and used for viral RNA isolation. Total RNA from the intestinal virus isolate was used to clone the entire viral genome by use of overlapping amplicons. The capsid gene of the virus was sequenced in 2 overlapping segments by RT-PCR assay that used reverse transcriptase^a and DNA polymerase^b with primers (FCV 5310f GAGCATGTGCTCAACCTGCGC and FCV 6391r CAGTTATGTCTGACCAGTAGCGG for the 5′ segment and FCV 6368f CCGCTACTGGTCAGACATAACTG and FCV 7342r CCTAATATTGAATTCATAACTTA for the 3′ segment complementary to sequences from the capsid gene of FCV-F9 [GenBank accession No. NC_001481]). Sequence alignments and analysis were performed with a sequence alignment program.³⁵,^c On the basis of genomic pairing and virus-neutralization typing, all FCVs are generally considered to belong to a single serotype.³⁶

Cell culture and antiviral challenges—Virus stocks were also used for in vitro PMO experiments. In those experiments, CrFK cells were grown in 6-well plates, treated with PMO via scrape-loading,^37,38 and inoculated with stock FCV-Bos by use of methods described elsewhere.⁵ Briefly, dilutions of PMO (1 to 20μM) were pipetted into each well of confluent monolayer CrFK cells (Appendix). After incubation for 1 minute at ambient temperature, the cells were gently scraped off the bottom of each well with a sterile rubber policeman, added to wells of a 96-well plate (100 μL/well) that contained logarithmic dilutions of virus isolate FCV-Bos (25 μL/well with 8 wells/virus dilution), incubated for 72 hours at 37°C in a carbon dioxide incubator, and then examined by use of a light microscope for evidence of cytopathic effect to determine viral titers (TCID₅₀).³⁹

RNA dot-blot analysis and RT-PCR assay—Total RNA was extracted from tissue culture samples by use of a phenol reagent.^d Because universal RT-PCR primer sets for identification and diagnosis of pathogenic Vesivirus isolates were not available but a genus-specific hybridization probe^e was available, RNA dot-blot analysis was performed by probing total RNA extracts with the approximately 300-bp biotin-labeled Vesivirus-specific hybridization probe^25,40,41 complementary to and derived from the protease region of the genome of the San Miguel sea lion virus serotype 5.

PMO synthesis—Synthesis of PMO, which is a platform system in which the chemistry of each nucleic acid analogue subunit used to assemble the oligomer is identical, was performed by a company^f by use of techniques described elsewhere.⁴² Purity of full-length oligomer was > 90%, as determined by reverse-phase high-pressure liquid chromatography and mass spectroscopy. Lyophilized PMO was dissolved in sterile saline (0.9% NaCl) solution and filtered through 0.2-μm filters^g prior to use in cell cultures. The antisense PMO sequence used in the study reported here corresponded to the complement of bases 15 to 34 of FCV-F9. Two scrambled-sequence PMOs of the same length as the antisense PMO sequence were used to control for non–sequence-specific actions of the PMO compounds.

Safety of the PMO platform has been evaluated for 3 PMO oligomers in numerous toxicologic and pharmacologic studies conducted in accordance with Good Laboratory Practices. Those studies used rodents and nonhuman primates, which were monitored after intraperitoneal, IV, or SC administration of up to 140 mg of PMO/kg daily for 28 days.^10-12 Toxicoses were not detected, and these tests revealed a wide margin of safety in comparison with the much smaller dosage of 0.7 to 5.0 mg/kg for 5 to 7 days that we used in our FCV outbreaks. Furthermore, a literature search of 204 peerreviewed publications that involved injection of PMOs into 47,122 zebrafish embryos was completed in an attempt to identify PMO-induced teratogenic events, and none were detected.¹³

Western blot analysis—Equal volumes of infected cell lysates were aspirated from each well of a specific treatment, combined, and evaluated for protein concentration by spectrophotometry with methods specified by the manufacturer.^h Samples were adjusted by the addition of distilled water to achieve a protein concentration of 1 mg/mL and processed as described elsewhere.⁵

Outbreaks and permission for interventions—All 4 trials reported here were the result of solicitations of help for humanitarian intervention during outbreaks of FCV disease. Each trial differed in that trials 1 to 3 involved acute and lethal infections, whereas the caliciviral disease associated with trial 4 was less severe. All outbreaks were at privately owned facilities, and all cats remained housed at and were treated by the attending veterinarians at those facilities. None of the facilities had an IACUC. Therefore, in consultation with the IACUC at Oregon State University, letters were written to address treatments and care of the animals. Subsequently, the Oregon State University IACUC representative approved the conduct of each trial.

For trial 1, the cats were privately owned pets at an adoption shelter,ⁱ and their ethical treatment with an experimental product was addressed in a letter from the attending veterinarian. For trials 2 and 3, the board of directors of a humane society^j provided a letter that requested treatment of cats by use of an experimental product. For trial 4, the executive director of the humane facility^k provided a letter that requested treatment of affected cats by use of an experimental product. These measures were used to ensure humane and ethical treatment, care, and use of animals. To avoid any conflict of interest, no financial compensation was provided to the facilities, their staffs, or veterinary personnel involved in the study.

Description of trials—All adult cats and kittens in the 4 trials had signs of severe FCV infection (oral ulcers, coughing, sneezing, nasal discharge, and purulent conjunctivitis). On the basis of clinical signs, an initial diagnosis of calicivirus infection was made for each cat by the attending veterinarian. This was subsequently supported by results of laboratory tests. Viral isolation and a fluorescent antibody assay²⁵ were conducted on tissues or swab specimens. The fluorescent antibody assay^l used application of a Vesivirus-specific monoclonal antibody conjugated to a fluorescent dye to stain FCVinfected CrFK cells and impression smears of tissues obtained during necropsy (ie, lungs, liver, intestines, and skin).

Cats (treated and untreated) were enrolled in the trials as each developed initial signs of severe FCV infection, which were detected during daily health checks and confirmed by the attending veterinarians. Treatments were administered by technical personnel who were under the direction of the attending veterinarians. During the study, the attending veterinarians confirmed the health status of each cat or kitten daily.

Trial 1 involved 28 ill and dying kittens, of which 22 were treated and 6 were untreated. The facility in Atlanta, Ga, housed 6 older adult cats that remained free of signs of disease and were not treated. The outbreak began July 27, 2002. The last ill kitten was started on PMO treatment August 12, 2002, and the observation period ended September 13, 2002.

Trial 2 began October 10, 2003, at a facility in Eugene, Ore. It involved 44 kittens (19 were treated with PMO, and 25 were not treated with PMO). The last ill kitten in the trial began PMO treatment on November 21, 2003.

Trial 3 was a follow-up intervention dose-response trial at the same facility in Eugene, Ore. Eighteen kittens (3 groups; 6 kittens/group) that met the criteria listed for caliciviral disease received PMO anticalicivirus treatment for 7 days. Three dosage amounts were used for the kittens.

Trial 4 began October 28, 2005, in Medford, Ore. It involved 22 ill kittens. Ten received anticalicivirus PMO treatment, and 12 received a control substance. The last ill kitten received PMO injections on December 18, 2005.

Treatment—The antisense compound tested was a PMO that had a negative-strand cDNA backbone that hybridized with the 5′ region of the FCV ORF-1 to mask the AUG translation start site.⁵ This antisense PMO was selected because it blocked replication of both FCV-F9 and FCV-Bos, the virus variant associated with fatal hemorrhage and hepatitis reported here. All ill animals in the 4 trials were treated in a similar manner (except for anti–FCV-specific PMO treatment or no anti–FCV-specific PMO treatment) by use of routine supportive care and palliative treatments, including parenteral administration of fluids and electrolytes and forced feeding as directed by the attending veterinarians, who also prescribed antimicrobials for all affected kittens throughout the trials.

Antisense PMO was shipped via overnight delivery to the facilities in the form of a sterile dry powder. For trials 1 and 2, PMO was dissolved in sterile saline solution at a concentration of 4 mg/mL and administered as SC injections of 0.5 mL (2 mg of PMO) every 12 hours for the first 2 injections and then every 24 hours until the kittens either died, had abatement of clinical signs, or reached the end of a 7-day treatment period. This dosage was expected to achieve FCV-inhibiting concentrations (0.5 to 1.0μM), as determined on the basis of pharmacokinetic studies^39-42 in other animals. Three kittens in outbreak 1 received PMO treatments for only 1 or 2 days because the supply of PMO was depleted. For outbreak 3, kittens were given 0.7, 2.0, or 5.0 mg of PMO by SC injection each day for 7 days.

For trials 1 to 3, facility directors insisted that as many kittens as possible that had developed signs of severe caliciviral disease be treated with the antiviral PMO because the usual supportive treatments with antimicrobials, fluid administration, forced feeding, and palliative treatments were failing and rapid death (within 1 to 4 days after onset of clinical signs) was the typical outcome. Selection for treated versus untreated control kittens was determined simply on the basis of PMO availability. For trial 1, the untreated control kittens were those enrolled in the study while initial supplies of anticaliciviral PMO were being shipped and kittens subsequently enrolled when the initial supply of PMO was depleted and additional PMO was being prepared and shipped. For trial 2, untreated control kittens were enrolled during 3 periods (once at the beginning, similar to trial 1; halfway through the outbreak when the high number of kittens receiving PMO treatment depleted the PMO supply; and again when the second shipment of PMO was depleted). This latter period represented the time that elapsed between trials 2 and 3 at the same facility.

Trial 3 was designed to measure clinical recovery versus dose response. Again, at the request of the facility director, all kittens were to be treated with PMO and none were to be given a control substance. Three groups (6 kittens/group) each were given 0.7, 2.0, or 5.0 mg of PMO by SC injection each day for 7 days. All kittens met the previously listed clinical criteria for caliciviral disease, including tongue erosions. The PMO dosage groups were assigned by use of a color code for each of the 3 dosages, and enrollment was randomized by assigning each subsequent kitten into a treatment group on the basis of the order of illness onset. Lesions were evaluated and scored daily for healing by technical personnel under supervision of the attending veterinarians (scale from 0 to 5, with 0 being no observable lesion and 5 being severe lesions). Swab specimens for virus isolation were collected from the throat and lesions of each kitten on days 0 (first day of treatment), 5, and 10.

Trial 4 was used to compare the FCV-1 PMO with a PMO designed to treat West Nile virus (ie, AVI-4020), which was intended to serve as an unrelated antisense control treatment. This trial was at a facility located 240 km from the outbreak where trials 2 and 3 were conducted, and it involved 22 kittens, of which 14 were ≤ 16 weeks old. It differed from the other 3 trials in that the FCV pathotype induced mild disease. Signs were oral ulcers, conjunctivitis with ocular discharge, and sneezing with nasal discharge. Kittens typically recovered after 7 to 10 days when given only antimicrobials, fluids, and routine palliative treatments, but the outbreak continued unabated. Vaccination, isolation, and quarantine were ineffective in controlling the disease. Because all kittens were expected to recover when provided the aforementioned treatments, recovery rate rather than survival rate was the variable evaluated. The treatment regimen was daily injections of PMO (4 mg/kitten, SC), which was equivalent to approximately 2 mg/kg for kittens up to 16 weeks of age (n = 14). Eight older, larger kittens received smaller doses per body weight. Therefore, these data were developed by allocating treated kittens (both FCV-1 PMO and AVI-4020 PMO) into 2 additional groups on the basis of body weight and antisense dosage. All kittens were examined and clinical signs scored daily. This included daily monitoring of body weight, ulcer score (scale of 0 to 5), ocular score (scale of 0 to 5), nasal score (scale of 0 to 5), overall clinical score (scale of 0 to 5), and number of days to complete clinical recovery. Two kittens that were > 20 weeks old (1 from each treatment group) were euthanized on the fourth day of treatment because of severe uveitis, which in the opinion of the attending veterinarian, would have resulted in blindness and was believed to not be related to calicivirus infection. Changes in body weight and scores for ulcers, ocular discharge, nasal discharge, and overall clinical condition from days 1 to 7, as well as the number of days to clinical recovery, were calculated and compared between the 2 groups.

Statistical analysis—Kaplan-Meier survival curves and survival data were evaluated with a log-rank test by use of commercially available software.^m Yates corrected χ² test and Fisher exact test were used to assess significant differences among groups.ⁿ Values were considered significant at P < 0.05.

Results

Characterization of the initial virus—The hemorrhagic Vesivirus isolate was characterized as an FCV (neutralization data not shown). It was designated FCV-Bos (Figure 1).

View Full Size

Transmission electron photomicrographs of FCV-Bos from hepatic samples obtained from the liver of an initial infected cat (A and B), an RNA dot-blot (C), and gels of overlapping RT-PCR products resulting from amplification of total RNA extracted from FCV-Bos–infected CrFK cells. In panels A and B, notice the distinct appearance of the same calicivirus virions at lower and higher magnification (bar = 50 and 25 nm for panels A and B, respectively). In panel C, specimens were evaluated by use of a biotin-labeled 300-bp Vesivirus-specific riboprobe made from the protease genomic region of San Miguel sea lion virus 5 (SMSV-5). Blots 1 to 4, respectively, represent 10 ng of SMSV-5 viral RNA, 500 ng of mouse lung total RNA, 500 ng of total RNA from the hepatic tissues of the initially infected cat, and 500 ng of total RNA from the intestinal tissues of the initially infected cat. In panel D, the RT-PCR assay used primers complementary to sequences of FCV-F9. Lanes were as follows: 1, DNA ladder; 2, approximately 1 kilobase of FCV-Bos capsid gene (3′ portion); and 3, approximately 1 kilobase of FCV-Bos capsid gene (5′ portion). Numerals on the left side represent molecular weight in number of kilodaltons.

Citation: American Journal of Veterinary Research 69, 1; 10.2460/ajvr.69.1.23

• Download Figure
• Download figure as PowerPoint slide

Molecular analysis of FCV-Bos—An RNA dot-blot analysis yielded a strongly positive signal when total RNA from hepatic and intestinal samples from the cat was incubated with the 300-bp calicivirus-specific riboprobe (Figure 1). The full-length genomic sequence was determined for FCV-Bos, and the complete capsid gene sequence (2.03 kilobases) was generated by RT-PCR assay from FCV-Bos intestinal RNA (GenBank accession No. AF486286). Alignment analysis revealed that FCV-Bos had sequence identity of 75% to 82% for nucleic acids and 87% to 91% for amino acids with other full-length FCV capsid gene sequences contained in GenBank (data not shown). Because of the limited length of capsid protein sequences available (68 amino acids of region E) from the other reported hemorrhagic FCV isolate (ie, FCV-Ari),¹⁴ further comparisons were performed only for that region. Analysis of the alignment and pairwise matrix indicated higher amino acid similarity between FCV-Bos and FCV-F9 (85%) than that between FCV-F9 and FCV-Ari (79%; Tables 1 and 2). The similarity in amino acids between FCV-Bos and FCV-Ari was within the range of that evident among other, more distinct strains.

Table 1—

Percentage of matching for a 204-bp partial capsid sequence between the FCV-Bos isolate and other FCV isolates.

View Table

Table 2—

Comparison of the percentage of homology for a 68-amino acid partial capsid sequence between the FCV-Bos isolate and other isolates.

View Table

Cell culture—The effect of 3 PMOs on the titer of FCV-Bos was determined (Figure 2). Treating FCV-Bos–infected cells with FCV-1 PMO resulted in a dose-dependent reduction in viral titer. Thus, 1μM PMO resulted in approximately a 25% inhibition of viral titer, 5μM PMO caused approximately 45% inhibition, 10μM PMO caused approximately 60% inhibition, and 20μM PMO caused approximately 70% inhibition. Inhibition for 20μM PMO was consistent with a reported maximal efficiency of PMO delivery of 60% to 90% into tissue culture cells by the scrape-loading method. Neither of 2 scrambled negative control PMOs used at 20μM reduced viral titer. Western blot analysis, which measured FCV-Bos capsid protein expression, was consistent with the infective viral titer measured by use of cell culture.

View Full Size

Viral titers (A) and western blots (B) of viral capsid protein expression in CrFK cells infected with FCV-Bos after scrapeloading with saline (0.9% NaCl) solution or PMO. Columns in panel A correspond to lanes in panel B. In panel B, the 60-kd FCV-Bos capsid band is evident after incubation with monoclonal antibody against the capsid protein, and the 43-kd band from the blot is evident after incubation with antibody against β-actin. Lanes were as follows: 1, saline solution (Sal); 2, 20μM scrambled-sequence PMO (negative control sample 1 [NC-1]); 3, 20μM scrambled-sequence PMO (negative control sample 2 [NC-2]); 4, 1μM FCV-1 PMO; 5, 5μM FCV-1 PMO; 6, 10μM FCV-1 PMO; and 7, 20μM FCV-1 PMO.

Citation: American Journal of Veterinary Research 69, 1; 10.2460/ajvr.69.1.23

• Download Figure
• Download figure as PowerPoint slide

Outbreak survival and efficacy studies—Significant survival benefit was detected for kittens treated with the FCV-1 PMO. Analysis of survival among kittens ≤ 15 weeks old in trial 1 that received only supportive treatment, compared with those administered the antisense PMO, was conducted (Figure 3; Table 3). Fifteen of 22 PMO-treated kittens survived, but none of the 6 kittens that received only supportive care survived (P = 0.003). Analysis of survival of kittens in trial 2 revealed survival of 16 of 19 PMO-treated kittens, compared with survival of only 3 of 25 kittens that did not receive PMO treatment (P < 0.001). All cats were treated with PMO in trial 3, and 16 of 18 survived. Combined data for trials 1 to 3 revealed that 47 of 59 (80%) PMO-treated kittens survived severe FCV infection, compared with survival of only 3 of 31 (10%) kittens that did not receive PMO treatment (P < 0.001).

View Full Size

Kaplan-Meier survival curves for 28 kittens in an outbreak of FCV-associated disease (trial 1) in the fall of 2002 (A) and 44 kittens in an outbreak of FCV-associated disease (trial 2) in the fall of 2003 (B). The PMO treatment regimen for the 2002 trial (22 PMO-treated kittens) was 2 mg/kitten, SC, at time 0 and 12 hours later and daily doses thereafter for up to 7 additional days, whereas the PMO treatment regimen for the 2003 trial (25 PMO-treated kittens) was 2 mg/kg, SC, daily for up to 7 days, beginning at time 0. Survival for PMO-treated kittens (black lines) differed significantly (P = 0.003 and P < 0.001 for outbreaks 1 and 2, respectively) from the survival for kittens that did not receive PMO treatment (gray lines).

Citation: American Journal of Veterinary Research 69, 1; 10.2460/ajvr.69.1.23

• Download Figure
• Download figure as PowerPoint slide

Table 3—

Survival data for 3 clinical trials involving kittens with FCV-associated disease during 2 naturally developing outbreaks.

View Table

In trial 3, viral inhibition was measured by evaluating recovery from viral-induced lesions. Survival did not differ significantly (P = 0.135) among treatment groups. There was a dose-dependent reduction in lesion score and detection of virus determined by virus isolation from swab specimens obtained from the throat and lesions (Table 4). Complete resolution of lesions appeared to be a dose-dependent event, with none of the cats that received 0.7 mg/kg, 1 cat that received 2.0 mg/kg, and 4 cats that received 5.0 mg/kg having complete resolution of lesions by the end of the treatment period (Figure 4). However, use of the log-rank test revealed that these results were not significant (P = 0.074).

Table 4—

Scores for FCV-associated lesions and results of virus isolation for samples obtained from kittens during trial 3 that were treated for 7 days with an FCV-1 PMO.

View Table

View Full Size

Dose-response curve for the percentage of 18 kittens with complete resolution of clinical signs of FCV during trial 4 after treatment with various dosages of PMO. Kittens were randomly assigned to 3 treatment groups (6 kittens/group). Treatment with PMO (0.7, 2.0, or 5.0 mg/kg, IP, administered daily for 7 days) was initiated on day 0. Survival did not differ significantly (P = 0.135) among groups. Clinical signs were evaluated daily. Use of a log-rank test revealed the results were not significant (P = 0.074).

Citation: American Journal of Veterinary Research 69, 1; 10.2460/ajvr.69.1.23

• Download Figure
• Download figure as PowerPoint slide

Severe FCV infection can be lethal in cats of all ages, but the risk of fatal infection was greater in younger cats in which only 19 of 28 (68%) PMOtreated kittens ≤ 15 weeks old survived, compared with 29 of 31 (94%) PMO-treated kittens > 16 weeks old that survived. Use of the same age categories for kittens not given PMO revealed that 2 of 15 in the younger group survived and 1 of 16 in the older group survived (Table 5). Cats of all ages that received PMO treatment had significant survival benefits, which were evident independent of age.

Table 5—

Influence of age of kittens in trials 1 to 3 on outcome after PMO treatment in FCV-associated outbreaks.

View Table

Results for trial 4 for a dosage of 2 mg/kg were summarized (Table 6). All kittens, except the 2 euthanized because of uveitis, were in various stages of recovery when the experimental period ended. Although significant differences were not detected in kittens ≤ 20 weeks old between the 2 treatment groups for any of the 6 variables measured, the FCV-1 PMO–treated group had numerically superior improvement for all 6 variables, compared with results for the control group treated with the unrelated control PMO antisense. Increasing age to ≥ 20 weeks and an increase in body weight such that the FCV-1 PMO dosage decreased to < 2 mg/kg (data not shown) were not associated with any measurable increase in rates of recovery between the cats treated by use of PMO FCV-1 and PMO AVI-4020.

Table 6—

Mean ± SD values for clinical outcomes during an outbreak of nonlethal FCV-associated disease (trial 4) for kittens ≤ 16 weeks old (n = 14)* treated by administration of a PMO at a dosage of 2 mg/kg.

View Table

Discussion

Efficacious, safe, and specific antiviral treatment for blocking antiviral replication in compliant host cells is generally unavailable, especially when the disease is severe and rapidly fatal. The PMO platform reported here had been tested and yielded positive results for efficacious and safe antiviral treatment^8-13, and it was virus-specific for a broad array of viral pathogens that affect a diversity of host species, including humans^5-13 and cats with calicivirus. Prior PMO antiviral testing has been performed only by use of in vitro cell culture and in vivo experimental infectivity in laboratory animals; therefore, PMO antivirals had not been field tested during outbreaks of naturally developing disease.^2,5,6 For this reason alone, results for our study cannot be compared with results of other studies at this time; however, comparisons can be made between the series of outbreaks reported here.

These naturally developing disease outbreaks were at 3 facilities (1 in the southern United States and 2 in the northwestern United States) in different cat populations that involved different pathotypes of FCV and extended over a 3.5-year period. Each of the 3 facilities was staffed by its own attending veterinarians and support personnel. Despite all of these factors, results for the 4 trials validate each other. In trials 1 to 3, the PMO was a significant (P < 0.001) life-sparing treatment. In trials 3 and 4, use of PMO at dosages up to 5 mg/kg reduced the severity of disease without causing detectable adverse effects.

Highly virulent and often fatal FCV biotypes are emerging in cats, for which the reported control measures include closing veterinary hospitals, depopulating cat colonies, and letting the disease burn itself out.^14-16 Vesivirus-specific diagnostic reagents, including a 300-bp riboprobe, which has been found to be more sensitive than current real-time RT-PCR tests that do not detect San Miguel sea lion serotype 8 and 12,^25,41 have been used to detect this pathogen in infected tissues. The new FCV pathotypes and patterns of disease outbreak provide methods for testing Vesivirus group–specific diagnostic reagents²⁵ and field testing anti-FCV PMO treatments, as well as determining relevance for possible PMO platform applications in other species (including humans) during outbreaks of viral diseases.^1-7

Some basic attributes of the PMO platform, which have been discussed at length elswere,⁸ make it possible to understand its broad application as an antiviral. These include stability because no intermediary metabolites are formed and it is an uncharged molecule that readily passes into cells in vivo to affect viral replication. The PMOs are widely distributed throughout the body and even cross the blood-brain barrier into the CSF. They are unaffected by pH changes within physiologic systems and can be administered orally, parenterally, or transdermally or via application to mucous membranes. The half-life of PMOs in biological systems is quite long (approx 36 hours), so single daily doses would typically suffice. Another critically important aspect of safety is that PMO antivirals target specific viral sequences rather than host functions; therefore, the probability of adverse host effects because of blockade of critical host functions is greatly reduced, and such concerns can be further addressed by comparing the selected PMO antiviral sequence against the host genome.

The PMO target sequence is relatively short (approx 20 mer). For Caliciviridae and many other virus families, this 20 mer will be synthesized to bridge and block the 5′ region AUG translation start site of ORF-1, which is highly conserved within viral families such that a single PMO sequence will typically block replication of multiple serotypes of a virus as long as there is ≥ 85% matching between the PMO and the base sequences of the 5′ target.^5,8

Target sites for PMOs need to be specific. For example, when the 5′ AUG translation start site for Vesivirus ORF-2 is targeted, rather than the start site for ORF-1, there is no reduction in viral titer, and when the 5′ AUG start site for ORF-3 is targeted, viral titer increases.⁵

Some disadvantages for the PMO platform are that the viral genome must be exposed for the PMO to pair with the AUG start-site target, which typically means that virus replication has been initiated. Therefore, the target becomes an active virus, rather than a latent virus. Also, there must be sufficient uptake of PMO to saturate the open and active AUG start sites if replication is to be completely blocked, although this does not appear to be a serious issue because the therapeutic dose is many-fold less than the highest nontoxic doses tested in vivo.^8-13 All tissue systems in the various species may not take up the PMO equally, such that dose and effect may depend on viral location. Another disadvantage is that cells in cultures (as opposed to cells in vivo) are routinely refractory to PMO uptake, unless the cells are injured by use of a scrap-loading technique. This typically results in approximately 80% of the culture cells becoming loaded with PMO.⁸ Examination of the FCV-Bos in vitro data reported here and other in vitro data⁵ revealed that the reduction of calicivirus titer in cell culture is equivalent to the number of cells that contain PMO (approx 80%). For this reason, cell culture procedures do not always accurately predict in vivo dose or effects and are of limited value as experimental viral infectivity techniques for studies of PMO.

The trials reported here addressed the therapeutic effect in kittens that were not treated until they developed signs of caliciviral disease, as defined by the investigators. This, in effect, standardized the treatment and control populations for better comparison between these 2 groups and also among trials; however, it precluded testing any preventative effect in which the PMO would be given prior to viral exposure or onset of signs of disease. Such studies should be performed in the future. The expectations would be that a PMO-treated group would become exposed but not ill, resulting in acquired protective immunity against the active calicivirus pathotype, whereas an untreated control group would develop clinical caliciviral disease. Other studies could be devised to examine dosages, treatment regimens, prophylactic effects, excretion in milk of lactating animals, additional genomic targets, multivalent PMOs for mixed viral exposures and diseases, precise effects on viral shedding, and species differences.

Mixed viral infections were suspected in trial 1, and it was determined that parvovirus, herpesvirus, and coronavirus were all active in addition to calicivirus. In 8 of 9 necropsies performed (data not shown), calicivirus-associated pneumonia was detected by fluorescent antibody testing with a monoclonal antibody. Deaths were attributed to bacterial sepsis and disseminated intravascular coagulation. Blocking replication of a pathogenic calicivirus in the mixture of viral infections resulted in a profound life-sparing effect (Figure 3). These data are even more interesting in that 3 of the deaths in the treatment group were kittens whose treatment had been discontinued between days 1 and 3 after onset because the facility depleted its supply of PMO. Although the monitoring period for survival was 30 days after end of treatment, some kittens placed for adoption subsequent to that period died as a result of infectious peritonitis.

In trials 2 and 3, herpesvirus was found in a few kittens. When corneal lesions were detected, those kittens were not enrolled in the study nor cleared for adoption. The monitoring period for survival was 10 days after the end of PMO treatment, and all kittens that survived were cleared for adoption 10 days after the end of the monitoring period.

In trials 3 and 4 in which dose effects and recovery rates were tested, there were numeric differences that were not significantly different among dosages and between recovery rates for treatment with the FCV-1 PMO or no anticaliciviral PMO treatment. This could have resulted from a combination of healing rate for epithelial lesions independent of treatment and the number of test kittens in each group for each treatment, which may have been insufficient to validate small changes in healing rate.

Effects on virus shedding were also evaluated. We did not attempt to quantify virus shedding, but instead we simply tested for viable virus. There were PMO dose–associated differences in virus shedding, which were not significant; however, the only 2 kittens that died during trial 3 were in the group of 6 that received the lowest PMO dosage (0.7 mg/kg). Enrolling more kittens and quantifying viral assays in trials 3 and 4 may have strengthened our conclusions for these 2 trials. The inability to ensure complete isolation of cats such that there could be no reexposure may have altered the outcomes of tests for viral shedding. Testing whether reexposure resulted in reinfection was outside the scope of the study reported here.

The economic impacts of FCV disease outbreaks are typically limited to those that affect individual cat owners; however, economic losses can be quite high when there is an outbreak in a cattery, research facility, or animal hospital. Outbreaks of new hemorrhagic variants of FCV have, in some instances, resulted in the need to close these facilities and quarantine or depopulate the animals, sometimes by euthanizing cats that were not dying directly as a result of acute hemorrhagic disease.^14-16 Institutional costs can skyrocket, and the livelihood of proprietors and associated businesses can be devastated. Severity of the caliciviral disease outbreaks reported here forced closure of 2 of the facilities for several weeks.

The use of natural disease outbreaks in domestic animal populations, such as reported here, should not be overlooked as possible opportunities to evaluate effects on human health care. They revealed that specific PMO antiviral treatments provided within a health-care delivery setting and coupled with standard control measures for infectious diseases can be useful and sometimes are necessary in reducing morbidity and fatalities in outbreaks of severe disease. These data are much more robust and predictive of future treatment outcomes of natural disease outbreaks than would be the expectation if a similar number of experimentally infected animals had been used for testing. It is also worth mentioning that the interventions were performed to spare the lives of affected kittens, rather than committing them to euthanasia, which is typically the outcome for animals in experimental infectivity studies, particularly when lethal pathogens are involved.

Efficacy and safety for the use of PMO antivirals have been determined in vitro and in several instances in vivo by use of experimental infectivity testing against high-priority zoonotic pathogens in domestic animals and humans. These include caliciviruses, Ebola virus, West Nile virus, viruses associated with sudden acute respiratory syndrome, influenza viruses, and dengue virus. However, to our knowledge, PMO antivirals have not been used during other outbreaks of naturally developing disease.^2-6 In the study reported here, PMO treatment was safely and efficaciously used to ameliorate clinical and lethal effects of naturally developing outbreaks of severe and often fatal disease in cats.