Obesity, which is defined as an accumulation of excess body fat, is the most common nutritional disorder in small animals and is associated with various diseases such as diabetes mellitus, pancreatitis, cardiovascular disease, arthropathies, and increased surgical risk.1 Although most dogs with diabetes mellitus are thought to have a disease that is similar to type 1 diabetes in humans and are insulin dependent, it has been proposed that diabetes in adult dogs progresses through several stages; these stages begin with impaired glucose tolerance, followed by non–insulin-dependent stages resembling type 2 diabetes in humans, and finally progressing to insulin-dependent diabetes mellitus.2 Obesity often results in the development of insulin resistance. In a recent study,3 it was determined that optimum glucose tolerance and insulin response appear to be integrally involved in the health and longevity of dogs; it was suggested that insulin resistance in dogs has a similar etiology and consequence for health as it does in humans. However, dogs are most often evaluated by their veterinarian only when the owner suspects a problem, thus allowing insulin resistance to remain undetected.4 The link between obesity and the development of insulin resistance has yet to be elucidated. In humans and rodents, results of substantial research have indicated that adipose tissue is not simply an energy storage organ, but is a secretory organ that produces a variety of proteins that influence not only the metabolism of the body but also endocrinologic and immunologic functions.5,6 These metabolically active secretory products termed adipocytokines include leptin, tumor necrosis factor-A, adipsin, resistin, interleukin-6, plasminogen activator inhibitor-1, and adiponectin (Acrp30).7,8 The role these adipocytokines play in the development of insulin resistance is being studied primarily in humans and rodents, with few studies having been performed to investigate their effects in dogs.
Adiponectin is an adipocytokine produced exclusively by white adipose tissue. It was identified independently by 4 groups9–12 and is known to be abundantly secreted into human plasma (accounting for 0.01% to 0.03% of total plasma protein).13 Adiponectin has been established as an insulin sensitizer of the entire body because the globular C-terminal fragment of adiponectin is able to decrease plasma glucose concentrations and increase fatty acid oxidation in muscle and the fulllength fragment augments insulin-induced inhibition of glucose output in hepatocytes.14,15 Even though our understanding of both type 1 and type 2 diabetes mellitus has greatly improved, the exact underlying pathologic mechanism leading to insulin resistance in these conditions has remained elusive. Compared with clinically normal humans, serum adiponectin concentrations are decreased in humans that are obese or have type 2 diabetes; therefore, it is believed that decreased serum adiponectin concentration links these 2 conditions and promotes the development of insulin resistance in humans through the regulation of glucose homeostasis and hepatic insulin sensitivity. Serum adiponectin concentrations are similarly decreased from clinically normal values in rodents and nonhuman primates that are obese or have diabetes.16 Surprisingly, serum adiponectin concentrations are increased in humans with type 1 diabetes.17
Adiponectin circulates as 3 discrete protein complexes in the sera of mice and humans: a 90-kd trimer, a 180-kd LMW form (also called a hexamer), and a higher order complex (> 360-kd) comprised of 4 to 6 trimers termed the HMW form. In male mice, most adiponectin is present as the LMW form, whereas in female mice, there is a more even distribution of the LMW and HMW complexes. The HMW form selectively disappears (with no increase in the LMW form) in mice treated with insulin or glucose, suggesting that HMW adiponectin complexes circulating in serum represent a precursor pool that can be activated by metabolic stimuli and subsequently dissociate into a transient bioactive trimer.18 Recently, Pajvani et al19 determined that the ratio, and not the absolute amounts, of the 2 oligomeric forms of adiponectin (HMW and LMW) is critical in determining insulin sensitivity. They proposed a new index, called the SA index, that is calculated as the ratio of HMW to HMW plus LMW and can be used as a quantitative indicator of change in insulin sensitivity.
In addition to humans, adiponectin has been identified in several other species, including rats, mice, dogs, and nonhuman primates. Adiponectin is highly homologous among species (rat:mouse, 92%; and dog: mouse, 84%).20 Serum adiponectin concentrations have been investigated in yellow-bellied marmots21 in relation to changes in lipid mass during hibernation and in fasting and fed arctic blue foxes.22 Adiponectin and its receptors (AdipoR1 and AdipoR2) have been identified in pigs.23,24 Unlike the numerous investigations in humans and laboratory animals, adiponectin has not yet been extensively studied in companion animals.20
The purpose of the study reported here was to assess serum concentrations of adiponectin and characterize adiponectin protein complexes in healthy dogs. Furthermore, the gene expression of adiponectin in visceral adipose tissue was evaluated. The hypotheses of this study were that adiponectin is present in canine serum as protein complexes that are similar to those in human serum and that serum adiponectin concentrations in clinically healthy dogs are similar to those in clinically healthy humans. In addition, we hypothesized that adiponectin was stable at various storage temperatures (−80° and −20°C) and that this stability was independent of the type of sample (serum, plasmaEDTA, or plasma-heparin samples).
Materials and Methods
Multiple alignment sequence—Nucleotide sequences for mouse (accession No. NM 009605), rat (accession No. NM 144744), human (accession No. NM 004797), and dog (accession No. NM 001006644) were identified by use of the National Center for Biotechnology Information GenBank nucleotide search engine, converted to their respective amino acid sequences by use of a basic local alignment search tool,a and compared by use of protein information resource multiple alignment computer software provided by Georgetown University.
Samples—Blood samples (total volume, 5 mL) were obtained from 10 healthy, university-owned dogs (4 females and 6 males; body weight range, 9.3 to 29.5 kg) of mixed breeds and various ages by jugular venipuncture; blood was collected without anticoagulant to provide serum samples and with EDTA or heparin to provide plasma-EDTA and plasma-heparin samples. Serum and plasma samples were also obtained from the Auburn University College of Veterinary Medicine Clinical Pathology Laboratory. Precautions were taken to collect, handle, and store samples intended for assessment of storage conditions on the stability of adiponectin in a similar manner. All samples were placed on ice immediately following collection. To obtain serum, blood samples collected without anticoagulant were centrifuged; serum samples were immediately stored appropriately at −20° or −80°C for a period of as long as 342 days. Adipose tissue was obtained from the falciform ligament of a healthy female dog during routine, elective ovariohysterectomy and stored in an aqueous, nontoxic tissue storage reagent.b
Of the sample analyses, those performed 8 days following collection were considered to provide baseline data because little protein degradation was expected to have occurred during that storage interval. All procedures were approved by the Auburn University Institutional Animal Care and Use Committee prior to initiation.
SDS-PAGE and western immunoblotting—One microliter of serum from each dog (processed separately) was solubilized in Laemmli sample buffer (1:10 dilution) in the absence or presence of 5% 2-mercaptoethanol. Samples were incubated at room temperature (approx 20° to 25°C). Samples were subsequently denatured by boiling for 10 minutes. Proteins were separated by SDS-PAGE (10%) and electrophoretically transferred to nitrocellulose membranes. Membranes were blocked in blocking buffer,c incubated overnight (approx 17 to 20 hours) with murine antiadiponectin polyclonal antibodyd (1:1,500 dilution), washed, and incubated with a fluorescently labeled secondary antibodye (1:20,000 dilution). Blots were evaluated by use of an infrared imaging system.f
Radioimmunoassay—For each dog, serum adiponectin concentration was measured by use of a commercially available murine radioimmunoassay kitg that measures total circulating adiponectin complexes (ie, HMW and LMW forms and trimers). Five microliters of serum was diluted in 2,495 μL of 1× assay buffer (1:500 dilution). Samples were centrifuged for 30 minutes at 2,500 × g. All samples were assayed in duplicate. The sensitivity of this assay was 1.0 ng/mL with a standard range of 0.78 to 100 ng/mL. The interassay and intraassay coefficients were 9.5% and 9.7%, respectively. Parallelism of canine samples was determined by serial dilution of 5 canine serum samples with comparison of results to the generated standard curve. Additivity was determined by spiking canine serum samples with known concentrations of murine adiponectin and assessment of subsequent measurements.
Real-time PCR assay—Approximately 90 mg of adipose tissue collected from the falciform ligament of a clinically normal dog was stored in an aqueous nontoxic tissue storage reagent. The RNA from adipose tissue was extracted with an isolation reagent.h One microgram of total RNA was reverse transcribed by use of a cDNA synthesis kiti with 100 units of a reverse transcriptase. Adiponectin mRNA expression was measured by use of a quantitative real-time PCR assay.j Two microliters of each reverse transcriptase reaction was amplified in a 30-μL PCR assay containing 200μM of each primer and a fluorescein-based supermix.k Samples were incubated in the real-time PCR assay for initial denaturation at 95°C for 3 minutes followed by 40 PCR cycles; each cycle consisted of 95°C for 10 seconds and 58°C for 1 minute. Oligonucleotide primers used for adiponectin (accession No. AB 110099.1) were AATCTTCTACAATCTGCAAAACCAC (sense) and TCTCGTATCGGAACAGAAAGAACAT (antisense); those used for GAPDH (accession No. NM007475) were ACAGTCAAGGCTGAGAACGG (sense) and CCACAACATACTCAGCACCAGC (antisense). The fluorescence emission was measured after each cycle. Quantities of adiponectin mRNA were normalized to GAPDH expression. Amplification of specific transcripts was confirmed initially through sequencing and subsequently by generating melting-curve profiles (cooling the sample to 55°C and heating to 95°C with continuous measurement of fluorescence) during each real-time PCR run.
Statistical analysis—The factorial treatment structure of the storage experiment consisted of storage temperature (−20° or −80°C), storage method (as serum, plasma-EDTA, or plasma-heparin), and storage duration (8, 96, 173, 250, or 342 days). Because of radioactive decay, a new radioimmunoassay kit was used to analyze adiponectin concentrations in serum and plasma samples at each storage time.
Comparisons involving storage durations are thus confounded with differences among radioimmunoassay kits, and the data were treated as a series of 2-factor experiments. A further complication arose from the fact that the treatment combination of plasma in heparin stored at −20°C was eliminated for cost reasons. The final analysis thus comprised 2 parts: a 22 factorial of method (serum and plasma in EDTA) and storage temperature (−20° and −80°C), and a single-factor analysis of storage method (serum, plasma-EDTA, and plasma-heparin) at −80°C. The experiment was analyzed as a randomized complete block design with dog (≥ = 10) as the random effect representing blocks. The block-temperature interaction was used as the error term for temperature, and the pooled block-temperature-method interaction served as the experimental error term to test the effects of storage method and the storage temperaturemethod interaction. All treatment effects and their interactions were considered to be fixed. Because some observations were missing and the correlation among samples within blocks (aliquots were taken from blood that was collected from a given dog at a single time), mixed-model ANOVA procedures as implemented in a software programl were used.25 For all statistical analyses, a value of P ≤ 0.05 was considered significant.
Results
Multiple alignment sequence—Mouse, rat, human, and dog adiponectin protein sequences were compared. Resultant sequences were highly homologous (mouse:dog, 85%; rat:dog, 83%; and human:dog, 87%). Specific peptide sequences recognized by the mouse polyclonal antiadiponectin antibody (18 to 32 and 187 to 200) were examined. Peptide sequence 187 to 200 was identical among the species examined. Peptide sequence 18 to 32 was not identical among the species examined (Figure 1).
Comparison of multiple alignment sequences for adiponectin in mouse, rat, dog, and human. Peptide sequences of these species have marked homology (mouse:dog, 85%; rat: dog, 83%; and human:dog, 87%). The polyclonal murine antiadiponectin antibody used for western immunoblotting recognizes peptides 18 to 32 and 187 to 200 (highlighted regions).
Citation: American Journal of Veterinary Research 68, 1; 10.2460/ajvr.68.1.57
Comparison of multiple alignment sequences for adiponectin in mouse, rat, dog, and human. Peptide sequences of these species have marked homology (mouse:dog, 85%; rat: dog, 83%; and human:dog, 87%). The polyclonal murine antiadiponectin antibody used for western immunoblotting recognizes peptides 18 to 32 and 187 to 200 (highlighted regions).
Citation: American Journal of Veterinary Research 68, 1; 10.2460/ajvr.68.1.57
Comparison of multiple alignment sequences for adiponectin in mouse, rat, dog, and human. Peptide sequences of these species have marked homology (mouse:dog, 85%; rat: dog, 83%; and human:dog, 87%). The polyclonal murine antiadiponectin antibody used for western immunoblotting recognizes peptides 18 to 32 and 187 to 200 (highlighted regions).
Citation: American Journal of Veterinary Research 68, 1; 10.2460/ajvr.68.1.57
Real-time PCR assay—Gene expression of adiponectin was analyzed with primers specifically designed for canine adiponectin. Adiponectin gene expression was detected in the adipose tissue obtained from the falciform ligament of a healthy dog (Figure 2).
Assessment of adiponectin gene expression in adipose tissue obtained from the falciform ligament of a healthy dog that was undergoing routine, elective ovariohysterectomy. The visceral adipose tissue was analyzed by real-time PCR. A— PCR quantification plot of a single sample of canine adipose tissue run in quadruplicate. B—Melt curve of the PCR product from panel A demonstrating formation of a single product. CF RFU = Curve fit relative fluorescence units. −d(RFU)/dT = Negative first derivative of the temperature versus fluorescence plotted against temperature.
Citation: American Journal of Veterinary Research 68, 1; 10.2460/ajvr.68.1.57
Assessment of adiponectin gene expression in adipose tissue obtained from the falciform ligament of a healthy dog that was undergoing routine, elective ovariohysterectomy. The visceral adipose tissue was analyzed by real-time PCR. A— PCR quantification plot of a single sample of canine adipose tissue run in quadruplicate. B—Melt curve of the PCR product from panel A demonstrating formation of a single product. CF RFU = Curve fit relative fluorescence units. −d(RFU)/dT = Negative first derivative of the temperature versus fluorescence plotted against temperature.
Citation: American Journal of Veterinary Research 68, 1; 10.2460/ajvr.68.1.57
Assessment of adiponectin gene expression in adipose tissue obtained from the falciform ligament of a healthy dog that was undergoing routine, elective ovariohysterectomy. The visceral adipose tissue was analyzed by real-time PCR. A— PCR quantification plot of a single sample of canine adipose tissue run in quadruplicate. B—Melt curve of the PCR product from panel A demonstrating formation of a single product. CF RFU = Curve fit relative fluorescence units. −d(RFU)/dT = Negative first derivative of the temperature versus fluorescence plotted against temperature.
Citation: American Journal of Veterinary Research 68, 1; 10.2460/ajvr.68.1.57
Radioimmunoassay validation—The mouse adiponectin radioimmunoassay used in this study was validated by use of standard additivity and parallelism assays. Percent recovery from serum samples spiked with 0.1, 0.5, or 1.0 ng of murine adiponectin (because canine adiponectin is not commercially available) ranged from 76% to 96%. Recovery rates improved as the concentration of added protein increased. Differences between expected and measured concentrations were 24%, 11%, and 4% for the samples spiked with 0.1, 0.5, and 1.0 ng of murine adiponectin, respectively. A parallelism assay illustrated lines of equal slope, indicating that there was no significant proportional analytical error within the dilution range of 1:50 to 1:5,000 (Figure 3). Interassay and intra-assay coefficients of variation were 9.5% and 9.7%, respectively.
Evidence of parallelism of adiponectin concentrations in canine serum samples, compared with a generated standard curve. Serum samples were serially diluted (1:50, 1:100, 1:500, 1:1,000, and 1:5,000) and adiponectin concentrations measured by radioimmunoassay.
Citation: American Journal of Veterinary Research 68, 1; 10.2460/ajvr.68.1.57
Evidence of parallelism of adiponectin concentrations in canine serum samples, compared with a generated standard curve. Serum samples were serially diluted (1:50, 1:100, 1:500, 1:1,000, and 1:5,000) and adiponectin concentrations measured by radioimmunoassay.
Citation: American Journal of Veterinary Research 68, 1; 10.2460/ajvr.68.1.57
Evidence of parallelism of adiponectin concentrations in canine serum samples, compared with a generated standard curve. Serum samples were serially diluted (1:50, 1:100, 1:500, 1:1,000, and 1:5,000) and adiponectin concentrations measured by radioimmunoassay.
Citation: American Journal of Veterinary Research 68, 1; 10.2460/ajvr.68.1.57
Radioimmunoassay of canine serum samples— Radioimmunoassay of sera from 10 healthy dogs revealed circulating adiponectin concentrations that ranged from 0.85 to 1.5 μg/mL; mean concentration was 1.22 μg/mL. Analysis of residuals from mixedmodels analysis based on statistical diagnostic tests and quantile-quantile plots revealed that residuals were normally distributed, thereby fulfilling one of the basic assumptions underlying ANOVA procedures. In the 22 factorial analysis, there was no significant (P > 0.22) interaction between storage method (serum or plasmaEDTA) and storage temperature (−20° or −80°C) for all time points (data not shown). Furthermore, the effect of storage method was also not significant in both the 22 factorial (P > 0.41) and the single-factor analysis (P > 0.30) involving all 3 storage methods at −80°C. The only significant effect on serum adiponectin concentration was storage temperature at the first 3 time points (Figure 4).
Effect of storage temperature on adiponectin concentration in serum samples obtained from 10 healthy dogs after samples had been stored for as long as 342 days at −20°C (black bars) or −80°C (white bars). The P values above the bars represent the probabilities from the linear contrast of concentration at −20°C versus concentration at −80°C at each time point.
Citation: American Journal of Veterinary Research 68, 1; 10.2460/ajvr.68.1.57
Effect of storage temperature on adiponectin concentration in serum samples obtained from 10 healthy dogs after samples had been stored for as long as 342 days at −20°C (black bars) or −80°C (white bars). The P values above the bars represent the probabilities from the linear contrast of concentration at −20°C versus concentration at −80°C at each time point.
Citation: American Journal of Veterinary Research 68, 1; 10.2460/ajvr.68.1.57
Effect of storage temperature on adiponectin concentration in serum samples obtained from 10 healthy dogs after samples had been stored for as long as 342 days at −20°C (black bars) or −80°C (white bars). The P values above the bars represent the probabilities from the linear contrast of concentration at −20°C versus concentration at −80°C at each time point.
Citation: American Journal of Veterinary Research 68, 1; 10.2460/ajvr.68.1.57
SDS-PAGE and western immunoblotting of canine serum samples—Adiponectin protein complexes in serum samples obtained from clinically normal dogs were investigated via SDS-PAGE and western immunoblotting. Untreated samples yielded a protein band at 180 kd (LMW). In denatured serum, bands at 180, 90, and 60 kd (LMW, trimer, and dimer, respectively) were detected. Reduction of serum resulted in detection of 2 protein bands located at approximately 90 and 60 kd (trimer and dimer, respectively). Reduction and denaturation combined resulted in detection of protein bands at approximately 60, 30, and 28 kd (dimer, monomer, and globular head region; Figure 5).
Results of SDS-PAGE to evaluate adiponectin protein complexes in serum from a healthy dog after samples were exposed to various reducing and denaturing conditions. Lane 1 represents serum exposed to nondenaturing, nonreducing conditions; a 180-kd band is visible. Lane 2 represents serum exposed to denaturing, nonreducing conditions; 180-, 90-, and 60-kd bands are visible. Lane 3 represents serum exposed to nondenaturing, reducing conditions; 90- and 60-kd bands are visible. Lane 4 represents denaturing and reducing conditions; 60-, 30-, and 28-kd bands are visible. Resultant adiponectin protein complexes are indicated to the right of the image.
Citation: American Journal of Veterinary Research 68, 1; 10.2460/ajvr.68.1.57
Results of SDS-PAGE to evaluate adiponectin protein complexes in serum from a healthy dog after samples were exposed to various reducing and denaturing conditions. Lane 1 represents serum exposed to nondenaturing, nonreducing conditions; a 180-kd band is visible. Lane 2 represents serum exposed to denaturing, nonreducing conditions; 180-, 90-, and 60-kd bands are visible. Lane 3 represents serum exposed to nondenaturing, reducing conditions; 90- and 60-kd bands are visible. Lane 4 represents denaturing and reducing conditions; 60-, 30-, and 28-kd bands are visible. Resultant adiponectin protein complexes are indicated to the right of the image.
Citation: American Journal of Veterinary Research 68, 1; 10.2460/ajvr.68.1.57
Results of SDS-PAGE to evaluate adiponectin protein complexes in serum from a healthy dog after samples were exposed to various reducing and denaturing conditions. Lane 1 represents serum exposed to nondenaturing, nonreducing conditions; a 180-kd band is visible. Lane 2 represents serum exposed to denaturing, nonreducing conditions; 180-, 90-, and 60-kd bands are visible. Lane 3 represents serum exposed to nondenaturing, reducing conditions; 90- and 60-kd bands are visible. Lane 4 represents denaturing and reducing conditions; 60-, 30-, and 28-kd bands are visible. Resultant adiponectin protein complexes are indicated to the right of the image.
Citation: American Journal of Veterinary Research 68, 1; 10.2460/ajvr.68.1.57
Discussion
Circulating adiponectin complexes account for approximately 0.01% of total plasma proteins in mammalian species; plasma adiponectin concentrations range from 5 to 30 μg/mL in humans, 9 to 17.4 μg/mL in mice, and 3 to 12 μg/mL in arctic blue foxes.22,26,27 Compared with findings in those species, results of radioimmunoassay of serum samples in the present study indicated that circulating adiponectin concentrations were lower in dogs, ranging from 0.85 to 1.5 μg/mL (mean concentration, 1.22 μg/mL). These concentrations are decreased, compared with values in dogs reported by Ishioka et al20; those investigators used a mouse-rat adiponectin ELISA kit, which may account for the differences. Storage method (serum, plasma-heparin, and plasma-EDTA) did not influence the adiponectin concentration, but storage temperature did. However, the effect of temperature was not consistent. In 2 of 3 instances in which temperature effects were significant, adiponectin concentrations were higher when serum samples were stored at −20°C, compared with storage at −80°C.
Currently, the radioimmunoassay only allows for the measurement of total adiponectin concentration and does not account for differences in the protein complexes of adiponectin that are present in the circulation. Therefore, it is necessary to identify protein complex profiles through other methods. Via SDS-PAGE and western immunoblotting in the present study, canine serum yielded a protein band at 180 kd, which was analogous to the LMW form described by Pajvani et al.19 Denaturation yielded protein bands of 180, 90, and 60 kd, which represented the LMW, trimer, and dimer, respectively. Under reducing conditions, 2 protein bands of 60 and 30 kd (the dimeric and monomeric forms of adiponectin) were detected. Reduction and denaturation in combination resulted in protein bands at 60, 30, and 28 kd; these represented the dimer, monomer, and globular head region, respectively. The HMW form could not be resolved under the electrophoresis conditions applied in the present study. However, preliminary data from velocity sedimentation studies performed in our lab have suggested that the HMW form is present in canine serum.
The results of the present study seem to correlate with data obtained from humans. In human serum, adiponectin circulates as a trimer, an LMW form, and a HMW form; the LMW and HMW forms predominate, and the smaller trimeric complex circulates at virtually undetectable concentrations.18,28 Under reducing and denaturing conditions, multimer species of adiponectin are separated into cross-linked products whose molecular sizes are multiples of 30 kd.9
The importance of companion animals in comparative medicine has increased with the completion of the canine gene sequence, which has a higher degree of homology with the human counterpart than sequences of the frequently studied mouse or rat.29 Diseases affecting humans and dogs are often very similar clinically, indicating that the use of dogs may be more effective than the extensive use of mice for gaining insights into metabolic disorders in humans.30 For example, the lipoprotein profile of dogs is quite different from that of humans, except when insulin resistance is induced. Normally, canine plasma is rich in high-density lipoproteins (the concentration is 3 times as great as that of humans31), whereas human plasma is rich in low-density lipoproteins and very-low-density lipoproteins.32 However, when insulin resistance is induced through feeding a high-energy diet in dogs, the lipoprotein profile is altered, resulting in increased plasma nonesterified fatty acids concentration and triglyceridemia (through increases in concentrations of very-low-density and high-density lipoproteins) and decreased amounts of high-density lipoprotein-total cholesterol, which are the main profile changes identified in insulin-resistant humans.33 Because of the similarities of the disease states in dogs and humans, these data suggest that an insulin-resistant, obese dog model could be useful in studying insulin resistance-associated dyslipidemia in humans.
In humans, the antiatherogenic effects of adiponectin have been investigated and results indicate that serum adiponectin concentrations are negatively correlated with serum triglyceride and low-density lipoprotein concentrations and positively correlated with serum high-density lipoprotein concentration. Unlike humans, atherosclerosis is uncommon in dogs, and dogs with atherosclerosis are more likely to also have other illnesses such as diabetes mellitus and hypothyroidism, compared with dogs without atherosclerosis.34 With increasing evidence that adiponectin may physiologically regulate energy metabolism and is important in the relationship between obesity and the development of insulin resistance, adiponectin could potentially serve as a treatment target or marker for obesity and insulin resistance or as an indicator of the development of diabetes mellitus in multiple species. Further investigation into the metabolic functions of adiponectin may further elucidate its role in the underlying pathogenesis of obesity-associated diseases in dogs as well as offer insights into the differences between metabolic diseases in humans and dogs.
ABBREVIATIONS
| LMW | Low molecular weight |
| HMW | High molecular weight |
| GAPDH | Glyceraldehyde-3-phosphate dehydrogenase |
BLAST 2, National Center for Biotechnology Information, Bethesda, Md, Available at: URL. Accessed Jun 6, 2005.
RNAlater, Ambion Inc, Austin, Tex.
Odyssey blocking buffer, LI-COR Biosciences, Lincoln, Neb.
Affinity Bioreagents, Golden, Colo.
LI-COR Biosciences, Lincoln, Neb.
Odyssey infrared imaging system, LI-COR Biosciences, Lincoln, Neb.
LINCO Research, St Louis, Mo.
TRIzol, Invitrogen, Carlsbad, Calif.
iScript cDNA synthesis kit with Superscript II reverse transcriptase, Bio-Rad, Hercules, Calif.
iCycler iQ real-time PCR detection system, Bio-Rad, Hercules, Calif.
SYBR green supermix, Bio-Rad, Hercules, Calif.
SAS procedure MIXED, version 2, SAS Institute Inc, Cary, NC.
References
- 1↑
Ishioka K, Soliman MM, Sagawa M, et al. Experimental and clinical studies on plasma leptin in obese dogs. J Vet Med Sci 2002;64:349–353.
- 2↑
Feldman EC, Nelson RW. In: Canine and feline endocrinology and reproduction. Philadelphia: WB Saunders Co, 1996;339–391.
- 3↑
Larson BT, Lawler DF, Spitznagel EL Jr, et al. Improved glucose tolerance with lifetime diet restriction favorably affects disease and survival in dogs. J Nutr 2003;133:2887–2892.
- 4↑
Irvine AJ, Butterwick R, Watson T, et al. Determination of insulin sensitivity in the dog: an assessment of three methods. J Nutr 2002;132:1706S–1708S.
- 5
Beltowski J. Adiponectin and resistin—new hormones of white adipose tissue. Med Sci Monit 2003;9:RA55–RA61.
- 6
Arita Y, Kihara S, Ouchi N, et al. Paradoxical decrease of an adipose-specific protein, adiponectin, in obesity. Biochem Biophys Res Commun 1999;257:79–83.
- 7
Choy LN, Rosen BS, Spiegelman BM. Adipsin and an endogenous pathway of complement from adipose cells. J Biol Chem 1992;267:12736–12741.
- 8
Diez JJ, Iglesias P. The role of the novel adipocyte-derived hormone adiponectin in human disease. Eur J Endocrinol 2003;148:293–300.
- 9↑
Scherer PE, Williams S, Fogliano M, et al. A novel serum protein similar to C1q, produced exclusively in adipocytes. J Biol Chem 1995;270:26746–26749.
- 10
Hu E, Liang P, Spiegelman BM. AdipoQ is a novel adipose-specific gene dysregulated in obesity. J Biol Chem 1996;271:10697–10703.
- 11
Maeda K, Okubo K, Shimomura I, et al. cDNA cloning and expression of a novel adipose specific collagen-like factor, apM1 (AdiPose Most abundant Gene transcript 1). Biochem Biophys Res Commun 1996;221:286–289.
- 12
Nakano Y, Tobe T, Choi-Miura NH, et al. Isolation and characterization of GBP28, a novel gelatin-binding protein purified from human plasma. J Biochem (Tokyo) 1996;120:803–812.
- 13↑
Phillips SA, Ciaraldi TP, Kong AP, et al. Modulation of circulating and adipose tissue adiponectin levels by antidiabetic therapy. Diabetes 2003;52:667–674.
- 14
Lu HL, Wang HW, Wen Y, et al. Roles of adipocyte derived hormone adiponectin and resistin in insulin resistance of type 2 diabetes. World J Gastroenterol 2006;12:1747–1751.
- 15
Fasshauer M, Paschke R. Regulation of adipocytokines and insulin resistance. Diabetologia 2003;46:1594–1603.
- 16↑
Hotta K, Funahashi T, Bodkin NL, et al. Circulating concentrations of the adipocyte protein adiponectin are decreased in parallel with reduced insulin sensitivity during the progression to type 2 diabetes in rhesus monkeys. Diabetes 2001;50:1126–1133.
- 17↑
Imagawa A, Funahashi T, Nakamura T, et al. Elevated serum concentration of adipose-derived factor, adiponectin, in patients with type 1 diabetes. Diabetes Care 2002;25:1665–1666.
- 18↑
Pajvani UB, Du X, Combs TP, et al. Structure-function studies of the adipocyte-secreted hormone Acrp30/adiponectin. Implications for metabolic regulation and bioactivity. J Biol Chem 2003;278:9073–9085.
- 19↑
Pajvani UB, Hawkins M, Combs TP, et al. Complex distribution, not absolute amount of adiponectin, correlates with thiazolidinedione-mediated improvement in insulin sensitivity. J Biol Chem 2004;279:12152–12162.
- 20↑
Ishioka K, Omachi A, Sagawa M, et al. Canine adiponectin: cDNA structure, mRNA expression in adipose tissues and reduced plasma levels in obesity. Res Vet Sci 2006;80:127–132.
- 21↑
Florant GL, Porst H, Peiffer A, et al. Fat-cell mass, serum leptin and adiponectin changes during weight gain and loss in yellow-bellied marmots (Marmota flaviventris). J Comp Physiol [B] 2004;174:633–639.
- 22↑
Mustonen AM, Pyykonen T, Nieminen P. Adiponectin and peptide YY in the fasting blue fox (Alopex lagopus). Comp Biochem Physiol A Mol Integr Physiol 2005;140:251–256.
- 23
Jacobi SK, Ajuwon KM, Weber TE, et al. Cloning and expression of porcine adiponectin, and its relationship to adiposity, lipogenesis and the acute phase response. J Endocrinol 2004;182:133–144.
- 24
Ding ST, Liu BH, Ko YH. Cloning and expression of porcine adiponectin and adiponectin receptor 1 and 2 genes in pigs. J Anim Sci 2004;82:3162–3174.
- 25↑
Littell RC, Milliken G, Stroup WW, et al. SAS system for mixed models. 2nd ed. Cary, NC: SAS Institute Inc, 2006.
- 26
Qi Y, Takahashi N, Hileman SM, et al. Adiponectin acts in the brain to decrease body weight. Nat Med 2004;10:524–529.
- 27
Gil-Campos M, Canete RR, Gil A. Adiponectin, the missing link in insulin resistance and obesity. Clin Nutr 2004;23:963–974.
- 28
Trujillo ME, Scherer PE. Adiponectin—journey from an adipocyte secretory protein to biomarker of the metabolic syndrome. J Intern Med 2005;257:167–175.
- 29↑
Rijnberk A, Kooistra HS, Mol JA. Endocrine diseases in dogs and cats: similarities and differences with endocrine diseases in humans. Growth Horm IGF Res 2003;13 (suppl A):S158–S164.
- 30↑
Eisele I, Wood IS, German AJ, et al. Adipokine gene expression in dog adipose tissues and dog white adipocytes differentiated in primary culture. Horm Metab Res 2005;37:474–481.
- 31↑
Duncan JR, Prasse KW, Mahaffey EA. Veterinary laboratory medicine. Ames, Iowa: Iowa State University Press, 1994:118–119.
- 32↑
Maldonado EN, Romero JR, Ochoa B, et al. Lipid and fatty acid composition of canine lipoproteins. Comp Biochem Physiol B Biochem Mol Biol 2001;128:719–729.
- 33↑
Bailhache E, Nguyen P, Krempf M, et al. Lipoproteins abnormalities in obese insulin-resistant dogs. Metabolism 2003;52:559–564.
- 34↑
Hess RS, Kass PH, Van Winkle TJ. Association between diabetes mellitus, hypothyroidism or hyperadrenocorticism, and atherosclerosis in dogs. J Vet Intern Med 2003;17:489–494.
